ID: 961237112

View in Genome Browser
Species Human (GRCh38)
Location 3:125376100-125376122
Sequence GCAGTATGCAGAAGCACCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961237112_961237114 23 Left 961237112 3:125376100-125376122 CCTGAGGTGCTTCTGCATACTGC No data
Right 961237114 3:125376146-125376168 TGTGTACACACCCTAGCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961237112 Original CRISPR GCAGTATGCAGAAGCACCTC AGG (reversed) Intergenic