ID: 961237112

View in Genome Browser
Species Human (GRCh38)
Location 3:125376100-125376122
Sequence GCAGTATGCAGAAGCACCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 108}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961237112_961237114 23 Left 961237112 3:125376100-125376122 CCTGAGGTGCTTCTGCATACTGC 0: 1
1: 0
2: 0
3: 10
4: 108
Right 961237114 3:125376146-125376168 TGTGTACACACCCTAGCACAAGG 0: 1
1: 0
2: 0
3: 19
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961237112 Original CRISPR GCAGTATGCAGAAGCACCTC AGG (reversed) Intergenic
900414368 1:2528293-2528315 GGAGTGTGCAGCAGCAACTCGGG + Intergenic
900881345 1:5383303-5383325 CCAGAATGCAGAGGAACCTCAGG + Intergenic
902954002 1:19912145-19912167 GCAGTGAGCAGCAGCAGCTCTGG - Exonic
903603186 1:24556578-24556600 GCCCTATGCAGAGGCCCCTCCGG + Intronic
908525551 1:64984505-64984527 GCAGCATTCAGAAGCAGCCCTGG + Intergenic
909663871 1:78112512-78112534 GGAGTATGGAGCAGCACCTATGG - Intronic
910257447 1:85261875-85261897 TCTAGATGCAGAAGCACCTCAGG + Intergenic
913699410 1:121360245-121360267 TCAGAAGGCAAAAGCACCTCTGG + Intronic
914138135 1:144919791-144919813 TCAGAAGGCAAAAGCACCTCTGG - Intronic
915710727 1:157895708-157895730 GCAGTGTACAGCAGCACCACAGG - Intronic
916170185 1:161995995-161996017 GCAGTCTGCAGAAACACAGCAGG + Intronic
917156903 1:172012290-172012312 GCAGCATGCAGGAGCACATGTGG + Intronic
917490764 1:175496461-175496483 GCCATATGCAGAAGCATCTCTGG + Intronic
917845537 1:179017062-179017084 CCAGCATGCAGCAGCAGCTCAGG + Intergenic
917965389 1:180175548-180175570 GCAGGATGAAGAAGCCCTTCAGG + Intronic
919586625 1:199447897-199447919 GCAGTCTGCAGCATCACTTCAGG - Intergenic
920486820 1:206378953-206378975 TCAGAAGGCAAAAGCACCTCTGG + Intronic
921316713 1:213898440-213898462 GCAGCTTGCAGGAGCACCTGGGG + Intergenic
921391534 1:214619762-214619784 TGAGAATGCAGAAGTACCTCTGG + Intronic
1069221449 10:65888811-65888833 GCAATGTGCTGCAGCACCTCGGG + Intergenic
1070711288 10:78685150-78685172 GATGTCTGCAGCAGCACCTCTGG + Intergenic
1078179867 11:9003013-9003035 GCATTAAGTAGAAGCACCTCAGG - Intronic
1080607034 11:33871875-33871897 GCAGTATGCGGTAGTAGCTCTGG + Intronic
1093375138 12:18416587-18416609 GCAGAATTCTGAAGCACCCCAGG - Intronic
1096485051 12:51974469-51974491 GCAGTGTACACAATCACCTCTGG - Intronic
1102219283 12:111183453-111183475 GCAATAGGCAGAAGCAACACCGG + Intronic
1103735804 12:123060170-123060192 GCAGTATGCTGGAGCATCTTTGG - Intronic
1105915291 13:24909832-24909854 ACAGTATCAAGAAGCACCTGTGG - Exonic
1106043944 13:26120125-26120147 GCAGTTTCCAGAAGCTCCTCTGG - Intergenic
1108580898 13:51827379-51827401 GATGTATGCACAAGGACCTCAGG + Intergenic
1117281555 14:54246299-54246321 GTAGTATGCAGGAGTTCCTCTGG - Intergenic
1117460510 14:55940321-55940343 GCAGGAGGCAGAATCACCTCAGG - Intergenic
1121512287 14:94521506-94521528 CCAGCAGGCAGAAGCCCCTCTGG + Intergenic
1126176743 15:45743041-45743063 GCAGTTTGCAGGAGCTCCTGGGG + Intergenic
1127636479 15:60875608-60875630 GCTGTATGGAGAGGCACTTCAGG + Intronic
1128377963 15:67090709-67090731 GCAGTAAGGAGAAGCATCTAGGG - Intronic
1128790019 15:70426289-70426311 GCCGGAGGCAGAGGCACCTCTGG - Intergenic
1132218142 15:100083144-100083166 GCAGGAGCCTGAAGCACCTCAGG + Intronic
1135805021 16:25534748-25534770 AAAGTATGCAGAAGCACAGCAGG + Intergenic
1139795173 16:69477023-69477045 GCTGTCTGCAGAGGGACCTCTGG + Intergenic
1143357470 17:6341154-6341176 GCTATTTGCAGAAGCACCACAGG + Intergenic
1146109849 17:30079008-30079030 GCTGTAGGCAGTAGCCCCTCAGG - Intronic
1153530382 18:6040302-6040324 GCAATATCCAGAAGCACTTTTGG + Intronic
1153968311 18:10201909-10201931 GCCTTATGCAGAAAGACCTCTGG - Intergenic
1158199786 18:54926903-54926925 GCAGTTTTCAGAATAACCTCAGG - Intronic
1159509933 18:69383603-69383625 TAAGTATGCAAAAGCACCTTAGG - Intergenic
1159950056 18:74476350-74476372 GCAGTATCCGGAAGGACCACTGG - Intergenic
1160372472 18:78385551-78385573 ATAATATGCAGAAACACCTCAGG - Intergenic
925550847 2:5072765-5072787 ACAGGGAGCAGAAGCACCTCAGG + Intergenic
925927274 2:8679243-8679265 GCGGTAATCAGAAGCAGCTCCGG - Exonic
929101280 2:38316871-38316893 GAAGCAAGCAGAAGCCCCTCAGG - Intronic
931881789 2:66576731-66576753 GCCTTAGGCAGAAGCTCCTCAGG + Intergenic
932851053 2:75187278-75187300 GCAGAGTGCAGTAGCACCTCAGG + Intronic
933571718 2:84021909-84021931 GCAATATGAAGAAGGCCCTCAGG - Intergenic
935247017 2:101227366-101227388 GGAGAATGCTGAAGCACATCTGG + Intronic
937775517 2:125770946-125770968 GAAGCATCCAGACGCACCTCTGG + Intergenic
942822995 2:180138606-180138628 GCAGACAGAAGAAGCACCTCAGG - Intergenic
943040811 2:182802824-182802846 TCAGTATGGAGAAGGATCTCAGG - Intergenic
944889649 2:204104012-204104034 GCAGTATACAGAAGCCTCTCAGG + Intergenic
947288680 2:228546888-228546910 GAAGTAGGGAGAAGCCCCTCTGG - Intergenic
1169339070 20:4782469-4782491 GCAGCTTGCAGAAGCCCTTCTGG + Exonic
1172610443 20:36247341-36247363 GCATTATGGAGCAGCACCTCAGG - Intronic
1173647554 20:44642884-44642906 GCAGGAGGCAGGAGCGCCTCTGG + Intronic
1177097945 21:16861667-16861689 GCAGTAGGCAGAAGCATCAATGG + Intergenic
1177760154 21:25394123-25394145 GGATTATGCAGAAGCCACTCTGG + Intergenic
1178012736 21:28305702-28305724 TCAGTATGCAGTCGCACATCTGG - Intergenic
1179311905 21:40203509-40203531 GCATATTGCAGAAGCAGCTCAGG + Intronic
1179376539 21:40854311-40854333 GCAGAATGAGGAAGCAGCTCAGG + Intergenic
1179517252 21:41917104-41917126 GCAGTATGCAGAAGGGGCACCGG - Intronic
1183836523 22:40458771-40458793 GCTGTTTTCAGAAACACCTCAGG + Intronic
1184032244 22:41901957-41901979 GCATGCTGCAGAAGCACCTGTGG - Intronic
1185035896 22:48476736-48476758 GCAGGATGGAGAAGGACCTGGGG + Intergenic
950797178 3:15519655-15519677 GCAGGATAAAGAAGCAACTCAGG - Intronic
952651110 3:35727937-35727959 ACAGTGTGCAGAAGCCCCTAAGG - Intronic
952787966 3:37175480-37175502 GCAGCATGCAGGAGGACCTAAGG - Intronic
953297043 3:41729426-41729448 GCATTATGCAGTAGCAGCTTGGG - Intronic
961237112 3:125376100-125376122 GCAGTATGCAGAAGCACCTCAGG - Intergenic
962400760 3:135056993-135057015 GCAGTATGGAGAGTCCCCTCTGG + Intronic
963817416 3:149847424-149847446 GCAATGTGCAGAAGCACAGCTGG - Intronic
964333645 3:155631814-155631836 GAATAATGCAGAAGCACCTGTGG + Intronic
969122451 4:4920194-4920216 GCAGCATGCAGCAGATCCTCTGG + Intergenic
971935099 4:33137689-33137711 GCAGTACGAAGACGCACATCAGG - Intergenic
975353836 4:73376189-73376211 GCATTATGCAGAGGCCCCTGTGG - Intergenic
979528071 4:121738331-121738353 GCAGGAGGCTGAAGGACCTCAGG + Intergenic
982048772 4:151477534-151477556 GAAGTATGCAGAAGCTACTCAGG - Intronic
982092515 4:151892684-151892706 GCAGCATGGAGAAACACCTAGGG + Intergenic
983064445 4:163192739-163192761 GCAATGAGCAGATGCACCTCAGG + Intergenic
985151531 4:186952144-186952166 GCATTGTTAAGAAGCACCTCAGG + Intergenic
985351274 4:189064844-189064866 GGAGCATGCATAAGCATCTCTGG - Intergenic
990515282 5:56525665-56525687 ACAGTGTGCAGAATCACCTGAGG + Intronic
1000135693 5:158348146-158348168 GCAGGCTGCAGAAGCTCCCCTGG + Intergenic
1001984276 5:176060867-176060889 GCAGTTTGCAGTTGCAGCTCAGG - Intronic
1002233200 5:177783198-177783220 GCAGTTTGCAGTTGCAGCTCTGG + Intronic
1002262779 5:178006583-178006605 GCAGTTTGCAGTTGCAGCTCAGG - Intronic
1002438681 5:179251788-179251810 GCTGTGTGCAGAAGCAGCTCTGG + Intronic
1002576168 5:180175317-180175339 GCATTTTCCAGAAGCTCCTCTGG - Intronic
1007055371 6:38877941-38877963 GCAGTTTCTAGAAGCAGCTCAGG + Intronic
1007922009 6:45618729-45618751 GCACTCAGCAGAAGCACCTGAGG + Intronic
1008379295 6:50823764-50823786 GCCGAATGCAGCAGCACGTCCGG - Exonic
1008440894 6:51530832-51530854 GCAGAAGGCAGAAGTACCCCTGG - Intergenic
1018475643 6:164138186-164138208 GCAATATGGAGAAGCTCATCAGG - Intergenic
1022042734 7:26595831-26595853 GCAGGAAGCAGCAGCACCCCAGG + Intergenic
1031654793 7:124341398-124341420 GAATTATGCAGAATCAACTCTGG - Intergenic
1032896049 7:136251935-136251957 GCTGGGTGCAGAAGCATCTCAGG - Intergenic
1037346213 8:17904148-17904170 TCAGTATCCAGAAGCCGCTCAGG + Intronic
1041437208 8:57855412-57855434 GCAGGATGCAGATGCACGTCAGG - Intergenic
1043251156 8:78074903-78074925 GCAGTATTCCTGAGCACCTCAGG - Intergenic
1043541879 8:81273074-81273096 TCAGTATGCATCACCACCTCAGG + Intergenic
1049087806 8:140491703-140491725 GCAGATTCCAGACGCACCTCAGG - Intergenic
1058342851 9:103920021-103920043 GCAGAATTCAGAATTACCTCAGG - Intergenic
1060113330 9:120922022-120922044 GAATTATGCAGAACCACCCCTGG + Intronic
1061309349 9:129752219-129752241 GCAGAATGCAGAAAGACCCCAGG - Intronic
1189131787 X:38506505-38506527 GCAATAGGGAGAAGCACTTCAGG + Intronic
1192203481 X:69081780-69081802 CCAGCATGCTGAAGCAGCTCTGG + Intergenic
1192634401 X:72804166-72804188 GCAGTCTGTAGAATTACCTCAGG + Intronic
1192647309 X:72916635-72916657 GCAGTCTGTAGAATTACCTCAGG - Intronic
1194155284 X:90380415-90380437 TCAGTATGCAATTGCACCTCTGG + Intergenic
1200501634 Y:3957348-3957370 TCAGTATGCAATTGCACCTCTGG + Intergenic
1201544115 Y:15141896-15141918 GCAGGAAGCAAAATCACCTCAGG + Intergenic