ID: 961237114

View in Genome Browser
Species Human (GRCh38)
Location 3:125376146-125376168
Sequence TGTGTACACACCCTAGCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961237111_961237114 24 Left 961237111 3:125376099-125376121 CCCTGAGGTGCTTCTGCATACTG No data
Right 961237114 3:125376146-125376168 TGTGTACACACCCTAGCACAAGG No data
961237112_961237114 23 Left 961237112 3:125376100-125376122 CCTGAGGTGCTTCTGCATACTGC No data
Right 961237114 3:125376146-125376168 TGTGTACACACCCTAGCACAAGG No data
961237113_961237114 1 Left 961237113 3:125376122-125376144 CCATCGTTTACAATTACTCATCT No data
Right 961237114 3:125376146-125376168 TGTGTACACACCCTAGCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961237114 Original CRISPR TGTGTACACACCCTAGCACA AGG Intergenic