ID: 961237866

View in Genome Browser
Species Human (GRCh38)
Location 3:125383843-125383865
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961237862_961237866 1 Left 961237862 3:125383819-125383841 CCTGCTCAGTTTTTCCCCACAGC No data
Right 961237866 3:125383843-125383865 CTTACTGTGAGACGTGTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr