ID: 961243150

View in Genome Browser
Species Human (GRCh38)
Location 3:125429801-125429823
Sequence CTTCCTCACAACATGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961243150_961243154 -4 Left 961243150 3:125429801-125429823 CCAGCCTCCATGTTGTGAGGAAG No data
Right 961243154 3:125429820-125429842 GAAGCCCAGGCAGCCACATGTGG No data
961243150_961243158 1 Left 961243150 3:125429801-125429823 CCAGCCTCCATGTTGTGAGGAAG No data
Right 961243158 3:125429825-125429847 CCAGGCAGCCACATGTGGAAGGG No data
961243150_961243156 0 Left 961243150 3:125429801-125429823 CCAGCCTCCATGTTGTGAGGAAG No data
Right 961243156 3:125429824-125429846 CCCAGGCAGCCACATGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961243150 Original CRISPR CTTCCTCACAACATGGAGGC TGG (reversed) Intergenic
No off target data available for this crispr