ID: 961243154

View in Genome Browser
Species Human (GRCh38)
Location 3:125429820-125429842
Sequence GAAGCCCAGGCAGCCACATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961243150_961243154 -4 Left 961243150 3:125429801-125429823 CCAGCCTCCATGTTGTGAGGAAG No data
Right 961243154 3:125429820-125429842 GAAGCCCAGGCAGCCACATGTGG No data
961243151_961243154 -8 Left 961243151 3:125429805-125429827 CCTCCATGTTGTGAGGAAGCCCA 0: 39
1: 164
2: 238
3: 318
4: 490
Right 961243154 3:125429820-125429842 GAAGCCCAGGCAGCCACATGTGG No data
961243148_961243154 7 Left 961243148 3:125429790-125429812 CCGGTTGGAAGCCAGCCTCCATG No data
Right 961243154 3:125429820-125429842 GAAGCCCAGGCAGCCACATGTGG No data
961243147_961243154 8 Left 961243147 3:125429789-125429811 CCCGGTTGGAAGCCAGCCTCCAT No data
Right 961243154 3:125429820-125429842 GAAGCCCAGGCAGCCACATGTGG No data
961243146_961243154 11 Left 961243146 3:125429786-125429808 CCTCCCGGTTGGAAGCCAGCCTC No data
Right 961243154 3:125429820-125429842 GAAGCCCAGGCAGCCACATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961243154 Original CRISPR GAAGCCCAGGCAGCCACATG TGG Intergenic
No off target data available for this crispr