ID: 961244612

View in Genome Browser
Species Human (GRCh38)
Location 3:125440588-125440610
Sequence CTCCAATGTCAGGCAGGATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961244606_961244612 -2 Left 961244606 3:125440567-125440589 CCGAAAAGGAGCTGCCCAGAGCT No data
Right 961244612 3:125440588-125440610 CTCCAATGTCAGGCAGGATTGGG No data
961244603_961244612 21 Left 961244603 3:125440544-125440566 CCAGAAAGGAACATGAGCTGGGC No data
Right 961244612 3:125440588-125440610 CTCCAATGTCAGGCAGGATTGGG No data
961244601_961244612 22 Left 961244601 3:125440543-125440565 CCCAGAAAGGAACATGAGCTGGG No data
Right 961244612 3:125440588-125440610 CTCCAATGTCAGGCAGGATTGGG No data
961244598_961244612 24 Left 961244598 3:125440541-125440563 CCCCCAGAAAGGAACATGAGCTG No data
Right 961244612 3:125440588-125440610 CTCCAATGTCAGGCAGGATTGGG No data
961244605_961244612 -1 Left 961244605 3:125440566-125440588 CCCGAAAAGGAGCTGCCCAGAGC No data
Right 961244612 3:125440588-125440610 CTCCAATGTCAGGCAGGATTGGG No data
961244599_961244612 23 Left 961244599 3:125440542-125440564 CCCCAGAAAGGAACATGAGCTGG No data
Right 961244612 3:125440588-125440610 CTCCAATGTCAGGCAGGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961244612 Original CRISPR CTCCAATGTCAGGCAGGATT GGG Intergenic
No off target data available for this crispr