ID: 961252155

View in Genome Browser
Species Human (GRCh38)
Location 3:125516485-125516507
Sequence TATCCTACCCCAAGAGGTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 105}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961252155_961252162 30 Left 961252155 3:125516485-125516507 CCACAACCTCTTGGGGTAGGATA 0: 1
1: 0
2: 0
3: 9
4: 105
Right 961252162 3:125516538-125516560 CTGCAGTCAAAAATAAGGCTGGG 0: 1
1: 0
2: 1
3: 15
4: 210
961252155_961252160 25 Left 961252155 3:125516485-125516507 CCACAACCTCTTGGGGTAGGATA 0: 1
1: 0
2: 0
3: 9
4: 105
Right 961252160 3:125516533-125516555 AAAATCTGCAGTCAAAAATAAGG 0: 1
1: 0
2: 1
3: 48
4: 468
961252155_961252161 29 Left 961252155 3:125516485-125516507 CCACAACCTCTTGGGGTAGGATA 0: 1
1: 0
2: 0
3: 9
4: 105
Right 961252161 3:125516537-125516559 TCTGCAGTCAAAAATAAGGCTGG 0: 1
1: 0
2: 0
3: 16
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961252155 Original CRISPR TATCCTACCCCAAGAGGTTG TGG (reversed) Intronic
902356263 1:15903469-15903491 TATCTAAGCCCAGGAGGTTGAGG - Intronic
905829884 1:41057094-41057116 TATCCAACCCAAAGAGGTGGGGG + Intronic
906999281 1:50833590-50833612 TGTCCTCTCCCCAGAGGTTGGGG + Intronic
910425447 1:87116177-87116199 TCTCATACCCCCAGAGGTTATGG + Intronic
914680984 1:149938121-149938143 TTTCTTCCCCCAAGAGGTTGAGG - Exonic
915716019 1:157946005-157946027 TCTCCTAACCCAAGATGATGGGG + Intergenic
919034241 1:192285074-192285096 CAACCTACCCCAAAAGGCTGAGG - Intergenic
921738827 1:218660052-218660074 TTTGATACCCCAAGAGGCTGAGG + Intergenic
923855412 1:237839843-237839865 TATCCTATCTCATGAGCTTGAGG - Intergenic
1063725757 10:8635675-8635697 TATCCCACCCCAATAGGAGGCGG - Intergenic
1063981700 10:11457727-11457749 GATCCCAGCCCAAGAGGTTCAGG - Intronic
1064077518 10:12281208-12281230 TGACCGACCCCAAGAGTTTGAGG + Intergenic
1069872908 10:71544039-71544061 TATCCTGCCCCACGAGGACGAGG - Intronic
1070393292 10:75989673-75989695 TAGCCTACCTCATGGGGTTGTGG - Intronic
1075473811 10:122715712-122715734 TGTCCTCCTCCTAGAGGTTGGGG + Intergenic
1076020197 10:127066169-127066191 TGTTCTGCCCCAAGAGATTGTGG + Intronic
1078375354 11:10788850-10788872 CATTTGACCCCAAGAGGTTGAGG + Intergenic
1079350507 11:19687866-19687888 TGTCCTAACTCAAGAGGTTGAGG - Intronic
1081797101 11:45828154-45828176 GATCCTACCCCAGTAGGTTTTGG - Intergenic
1083375836 11:62220189-62220211 TACCCTAGCCAAACAGGTTGTGG + Intergenic
1083699618 11:64467298-64467320 TATCCTTGCCCCAGAAGTTGGGG - Intergenic
1086528173 11:87753608-87753630 TATACTACCCAAAGAAGTTTCGG + Intergenic
1089901414 11:121989838-121989860 CAACCTACCCCAAGTGGGTGGGG + Intergenic
1091128708 11:133125179-133125201 TAAACTACCCCAGGAAGTTGAGG + Intronic
1092330332 12:7581194-7581216 TCTCCTATCCCCAGAGGTTGGGG - Intergenic
1092681567 12:10988272-10988294 TATGCTACACCAAGAGTGTGGGG + Intronic
1093511169 12:19930027-19930049 TATCCTAGCCCCAGAGGTAGTGG + Intergenic
1093911464 12:24752371-24752393 TATTCGAACCCAGGAGGTTGAGG - Intergenic
1094393335 12:29977316-29977338 GATCCTACCCCTGGGGGTTGTGG + Intergenic
1096012649 12:48234018-48234040 TAACCTACCTTAGGAGGTTGTGG - Intergenic
1096463794 12:51837254-51837276 TCTACTACCCCAGGAGGTTGGGG + Intergenic
1100150003 12:91725363-91725385 TCTCCCAACCCCAGAGGTTGGGG - Intergenic
1100249637 12:92804976-92804998 TTTCCTACCCCAATAGGATGTGG + Intronic
1100927409 12:99565394-99565416 TATCCTACCATTATAGGTTGGGG - Intronic
1105807327 13:23962021-23962043 TATCTTGCACCAGGAGGTTGAGG - Intergenic
1106812909 13:33377810-33377832 TGTCCTAAACCCAGAGGTTGGGG + Intergenic
1115435051 14:33362773-33362795 TATCCTCCCCCATAAGGTGGAGG - Intronic
1119217534 14:72880638-72880660 CACCCGAGCCCAAGAGGTTGAGG - Intronic
1124183807 15:27503057-27503079 TCTCCTCTCCCTAGAGGTTGGGG + Intronic
1124335899 15:28856899-28856921 GATGTTACCCCAAGTGGTTGGGG + Intergenic
1126202839 15:46007077-46007099 TCTACTCTCCCAAGAGGTTGTGG + Intergenic
1128721101 15:69948946-69948968 AGTCCTAGCCCAGGAGGTTGAGG - Intergenic
1132485922 16:190927-190949 AGTCCTCCCCCAAGAGGGTGAGG - Intronic
1133263504 16:4568710-4568732 CTTCCTAGCCCAGGAGGTTGAGG - Intronic
1133471884 16:6083558-6083580 CATCTGAGCCCAAGAGGTTGAGG - Intronic
1135955077 16:26949557-26949579 TAGCCTTCACCAGGAGGTTGAGG + Intergenic
1139295621 16:65897943-65897965 TATCCCAGCCCAAGAGGTCAAGG - Intergenic
1141279160 16:82614937-82614959 TGTTCGAGCCCAAGAGGTTGAGG + Intergenic
1143115127 17:4577658-4577680 TGTCCTCCCCCAAGAGGCGGGGG - Intergenic
1143152165 17:4814517-4814539 TATCCTGCCCCATGTTGTTGGGG - Intronic
1143595357 17:7910738-7910760 TATCCTACCCTTAGCAGTTGTGG + Intronic
1144542128 17:16154597-16154619 TATCCCACCAGAAGAGGTTTTGG - Intronic
1145860311 17:28204228-28204250 CATCCTAGCCCCAGAGTTTGTGG + Intergenic
1147929287 17:43967481-43967503 CATCCTAGCCCCAGAGTTTGTGG - Intronic
1148131158 17:45263326-45263348 TCCCCTGCCCCAGGAGGTTGAGG + Exonic
1149372752 17:56011419-56011441 TATTCTGACCCAAGAGATTGTGG + Intergenic
1151033484 17:70770806-70770828 TATCCTAGCCCATAAGGATGTGG + Intergenic
1159567409 18:70067964-70067986 TAACTTACCCCATGTGGTTGGGG + Intronic
1161064112 19:2229195-2229217 ACTCCTCCCCCAAGAGGCTGTGG + Intronic
1162272772 19:9629882-9629904 AGTCCTGCCCCAAGAGTTTGTGG + Intronic
1164745700 19:30611143-30611165 TATTCTACCCCCAGAGGGTTTGG - Intronic
1166101799 19:40575892-40575914 GATCCTGCCCCAAGAAGCTGGGG + Exonic
1166768755 19:45267742-45267764 TATTTGAGCCCAAGAGGTTGAGG - Intronic
926924305 2:17971465-17971487 TTTCATACCCCAAGAGTGTGAGG + Intronic
928083329 2:28328866-28328888 TATACAACCCAAAGAGGTTGGGG - Intronic
939392729 2:141589808-141589830 TAACATACCCAAAGAGGATGTGG - Intronic
941086569 2:161125090-161125112 TAAATTACCCCAAGAGGCTGAGG - Intergenic
947235153 2:227933848-227933870 TATCCTGCTCCACGAGGTTTTGG + Intergenic
1169161954 20:3387980-3388002 CATCTGAGCCCAAGAGGTTGAGG + Intronic
1171408366 20:24929031-24929053 TCTCCTCCCCCAAGATGGTGGGG - Intergenic
1178007413 21:28237147-28237169 CTCCCTAGCCCAAGAGGTTGAGG + Intergenic
1183353710 22:37347583-37347605 CACACTGCCCCAAGAGGTTGAGG + Intergenic
949682103 3:6526251-6526273 TATTCTACACCAAAATGTTGGGG + Intergenic
950215151 3:11153911-11153933 AACCCTACCCCTAGAGGTTTCGG - Intronic
951701072 3:25497210-25497232 AATACTATCCCAAGAGATTGTGG - Intronic
951715066 3:25633526-25633548 TCTCCTCTCCCCAGAGGTTGGGG + Intronic
953530666 3:43737105-43737127 TATCCTATTCCCAGAGGGTGAGG + Intergenic
954066502 3:48110952-48110974 TCTCCTCTCCCAGGAGGTTGGGG - Intergenic
954073071 3:48157451-48157473 ATTCCCACCCCAAGAAGTTGAGG + Exonic
954427650 3:50451831-50451853 TAACCAACCCCAGGAGGTGGAGG + Intronic
956002416 3:64743306-64743328 TATCCTATTCCAAGTGGGTGAGG - Intergenic
960872452 3:122263558-122263580 TATCCTTCCCAAAGGGTTTGTGG - Intronic
961252155 3:125516485-125516507 TATCCTACCCCAAGAGGTTGTGG - Intronic
962771981 3:138620577-138620599 CATCTTAGCCCAGGAGGTTGAGG - Intronic
964066460 3:152585881-152585903 TATCTGAGCCCAGGAGGTTGAGG - Intergenic
969237495 4:5876301-5876323 TCTCCCACCCCAGGAAGTTGGGG + Intronic
969608432 4:8213800-8213822 TATCTGAGCCCAGGAGGTTGAGG + Intronic
980130653 4:128812606-128812628 TTTCCCACCCCAAGCGGGTGGGG + Intronic
980886296 4:138766485-138766507 TATCCGACCCCACGAAGCTGAGG - Intergenic
982952847 4:161721687-161721709 TATCCTAGCCCATGAGGTCAAGG - Intronic
983535556 4:168853495-168853517 TTTCCTGCCCTCAGAGGTTGTGG - Intronic
988992429 5:36684417-36684439 CATCCTAGCCCAATAGGGTGAGG + Intronic
996975651 5:129430472-129430494 AAAGCTACCCCAAGATGTTGTGG + Intergenic
999292939 5:150439304-150439326 GATCCTGCACCAAGAGATTGAGG + Intergenic
999997903 5:157109854-157109876 TCCCCTACCCCAAGAGGCTTTGG + Intronic
1000440551 5:161258251-161258273 TAGCCTACCCCAAATGGCTGAGG - Intergenic
1004416232 6:15426735-15426757 TTTCCAACCCCCAGAGGATGAGG + Intronic
1007943615 6:45805236-45805258 AAACCTACCTCAAGGGGTTGTGG + Intergenic
1008606699 6:53146948-53146970 TACCCGAGCCCAGGAGGTTGAGG + Intronic
1015471663 6:133613007-133613029 TATCTAACCCCAAGAGTATGAGG + Intergenic
1025834528 7:65082062-65082084 TAGCCTAGCCCAGGAGGGTGCGG - Intergenic
1030283651 7:107802584-107802606 TAGCTTAGCCCAAGAGTTTGAGG - Intronic
1039554214 8:38465562-38465584 TATCCTACCCCCAGTGGGTTAGG - Intronic
1040446925 8:47505214-47505236 TGTCCTGCCCCCAGAGGTGGAGG + Intronic
1044617564 8:94157830-94157852 TGCTCTAGCCCAAGAGGTTGAGG + Intronic
1046916442 8:119682787-119682809 TAACCTATTCCAAGAGGATGTGG - Intergenic
1050666074 9:7938001-7938023 AATCATGCCCCAAAAGGTTGAGG + Intergenic
1056006982 9:82283457-82283479 TCTCCTACCCAAGGAAGTTGAGG - Intergenic
1058475202 9:105326152-105326174 TACTCAAGCCCAAGAGGTTGAGG - Intronic
1058726950 9:107813492-107813514 TCTCCTCGCCCCAGAGGTTGTGG + Intergenic
1059177106 9:112177132-112177154 TACCTGAGCCCAAGAGGTTGAGG - Intergenic
1059344331 9:113617816-113617838 TATCCTACTCCCAGGGGTTGTGG + Intergenic
1203749286 Un_GL000218v1:63463-63485 TCTCCCACCCCTAAAGGTTGAGG - Intergenic
1185968066 X:4630266-4630288 TAGCCAAGCCCAGGAGGTTGAGG + Intergenic
1187195705 X:17081400-17081422 AATCCTACACCAAGAGTCTGTGG - Intronic