ID: 961253941

View in Genome Browser
Species Human (GRCh38)
Location 3:125530646-125530668
Sequence AAGCAACACCTTCACTGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 227}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961253938_961253941 13 Left 961253938 3:125530610-125530632 CCCTCTAATATTATCAAAATCAG 0: 1
1: 0
2: 0
3: 33
4: 309
Right 961253941 3:125530646-125530668 AAGCAACACCTTCACTGAAATGG 0: 1
1: 0
2: 0
3: 21
4: 227
961253939_961253941 12 Left 961253939 3:125530611-125530633 CCTCTAATATTATCAAAATCAGT 0: 1
1: 0
2: 2
3: 21
4: 305
Right 961253941 3:125530646-125530668 AAGCAACACCTTCACTGAAATGG 0: 1
1: 0
2: 0
3: 21
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961253941 Original CRISPR AAGCAACACCTTCACTGAAA TGG Intronic
900730325 1:4254634-4254656 CAGAAACACCATCACTGAAGAGG - Intergenic
900936618 1:5770184-5770206 AATCAAAACCTTGCCTGAAAAGG + Intergenic
901542263 1:9926381-9926403 ATGCAACTCCACCACTGAAATGG - Intronic
901985416 1:13071736-13071758 AAGCAACATCTTAACAAAAAAGG + Intronic
901996393 1:13155031-13155053 AAGCAACATCTTAACAAAAAAGG - Intergenic
902525001 1:17051338-17051360 AAGCAACAACTGAACTGAGAAGG + Intronic
902961748 1:19968509-19968531 AAACATCACCTTCACTCAATAGG - Intergenic
904999967 1:34660375-34660397 GAGCAGGACCTTCACTGGAATGG - Intergenic
907048070 1:51312110-51312132 ATGCCACACCTTCAGTGAATTGG + Exonic
909316472 1:74225775-74225797 GAAAATCACCTTCACTGAAAGGG + Intronic
909346764 1:74598609-74598631 AAGCAAAATATTCACAGAAAAGG + Intronic
912201892 1:107467706-107467728 CAGCATCAACTTCATTGAAAAGG + Intronic
916434399 1:164763783-164763805 AAGCAACAGCAACACTGAAAAGG + Intronic
916697148 1:167250025-167250047 ATGCAAAATCTTCATTGAAAAGG + Intronic
918147369 1:181769159-181769181 AACCAACACCTCCACTGTACTGG - Intronic
919123141 1:193365714-193365736 TAGTAACAACTTCACTGAAGTGG + Intergenic
919502256 1:198351830-198351852 AACCAAAACATTCACTGAATAGG - Intergenic
919618419 1:199836166-199836188 AACCAACACCTTAACTAAGAAGG + Intergenic
919996403 1:202755192-202755214 AAGACACATCTGCACTGAAAAGG + Intronic
920162859 1:204012938-204012960 AAGCAAAAACCTCACTGGAATGG + Intergenic
920533644 1:206723231-206723253 TAATAACACCTTCATTGAAATGG + Intronic
921010590 1:211136934-211136956 AAGCCACTCCTTCATTTAAAGGG + Intergenic
923347430 1:233068074-233068096 AAGAAACACCTTATCTAAAAAGG + Intronic
923635701 1:235693905-235693927 AAGCAACACCTAGCCTGAGAAGG + Intronic
924090312 1:240494232-240494254 AAGTGACCCCTTCACTGTAAAGG - Intronic
924520192 1:244799570-244799592 ATGCAAAATCTTCACTGAGAAGG + Intergenic
924867411 1:247999839-247999861 TAGCATCAGTTTCACTGAAATGG - Intronic
1065040989 10:21695980-21696002 AAGCTACACTTTCAGTGGAAGGG - Intronic
1065642771 10:27802189-27802211 TAGCAAAACCTTAACTCAAATGG - Intergenic
1068130206 10:52887158-52887180 TAGAAACACCCTCACTGAAATGG - Intergenic
1069587006 10:69613591-69613613 AAGCAACAGCTTCACACAGATGG + Intergenic
1070471720 10:76786963-76786985 AAGCAAAATATTCACTGAAGTGG - Intergenic
1071583725 10:86798648-86798670 AAGGAACCACTTCACTGTAAGGG + Intronic
1074261623 10:111859469-111859491 ATGAAACAACTTCAGTGAAAGGG - Intergenic
1074562512 10:114546601-114546623 CTGAAACACCTGCACTGAAAGGG - Intronic
1075393698 10:122112293-122112315 AACTAACTCCTTCACTGACATGG - Intronic
1075661314 10:124198659-124198681 AAGTAACCCCTGCCCTGAAATGG + Intergenic
1078815174 11:14813722-14813744 ACACAACTCTTTCACTGAAAAGG + Intronic
1080284663 11:30595932-30595954 AAATAACACCTTGAATGAAAAGG - Intergenic
1083515152 11:63250664-63250686 CAGAAACATCTTCACTGTAAAGG + Intronic
1084224633 11:67708212-67708234 ATGCAACACCTTTAGAGAAAGGG - Intergenic
1084262453 11:67988082-67988104 ATGCAACACCTTTAGAGAAAGGG - Intergenic
1085141887 11:74152286-74152308 ATTCAACAACTTCAATGAAATGG + Intronic
1085419712 11:76345384-76345406 AAGCTACATTTTCACTGAGAAGG + Intergenic
1085646420 11:78226486-78226508 ACGCAACACCCTCCCTGCAATGG - Exonic
1086399234 11:86447199-86447221 CAGCAACACCTACAGGGAAAAGG + Exonic
1087817642 11:102676898-102676920 CAACAACACCTTGAGTGAAAAGG - Intergenic
1089032244 11:115344463-115344485 AAGCAACATCTGCACAGAAAAGG + Intronic
1089410454 11:118237267-118237289 AAGCAACACCATGAGAGAAAAGG + Intronic
1089630663 11:119782242-119782264 AGACAACACGTTCACAGAAAGGG - Intergenic
1093254999 12:16856149-16856171 AAAGACCACATTCACTGAAAGGG - Intergenic
1095432652 12:42150620-42150642 AAGGAACACTTTCACTTAATTGG - Intergenic
1095840680 12:46688232-46688254 AAGCAACACCCTCATGGAAAAGG - Intergenic
1096710845 12:53454155-53454177 GATCAACACCCTCACTGAAAAGG - Intronic
1096932866 12:55234473-55234495 AAGCAATTTCTTCACTGAGATGG - Intergenic
1099737227 12:86585836-86585858 AATCATCACCTTCAGTTAAAAGG - Intronic
1100202230 12:92311780-92311802 ATGAAACAACCTCACTGAAAGGG - Intergenic
1100458161 12:94772808-94772830 CAGCAACATTTTCCCTGAAATGG + Intergenic
1101599927 12:106200328-106200350 AAGAAAAGCCTTCACAGAAAAGG - Intergenic
1101769116 12:107732279-107732301 CAGCTACAACTTCACTAAAAAGG + Intergenic
1102108893 12:110349156-110349178 CAGCAAAGCCTTCAGTGAAATGG - Intronic
1104612291 12:130239055-130239077 ATGAAACAACCTCACTGAAAAGG + Intergenic
1105273053 13:18895446-18895468 AAGCCACACCTCCACTGGAAAGG - Intergenic
1107273687 13:38652078-38652100 ATACAACACCTTCATTGATACGG - Intergenic
1108311631 13:49198005-49198027 AGGCTACTACTTCACTGAAAGGG - Exonic
1108600499 13:51989737-51989759 AAGCAGCACATTCTCTGAAACGG - Intronic
1108830626 13:54473650-54473672 AAGCAACACATACATTGAAGAGG + Intergenic
1109076207 13:57838857-57838879 AACCATCAGCTTCACCGAAATGG - Intergenic
1111406649 13:87815355-87815377 AAGAAACACCTTCCCTAAAGAGG + Intergenic
1111976327 13:94969904-94969926 AAGTAACACTTTCACCGAGAAGG + Intergenic
1112213048 13:97400586-97400608 AAGCAGCACCTATACTGAGATGG + Intergenic
1112426013 13:99301926-99301948 CATCAACACCTTGAATGAAAAGG + Intronic
1113419724 13:110161468-110161490 AATCAACATAATCACTGAAATGG + Intronic
1113752180 13:112784081-112784103 AAGAAACAGCTTCATTGAAGAGG + Intronic
1114207153 14:20582703-20582725 AAACAACGCCTACACTGACAAGG + Intergenic
1114984928 14:28215140-28215162 GAAAATCACCTTCACTGAAAGGG - Intergenic
1117803993 14:59471009-59471031 AGGCAAGACCCTCACTGAGATGG + Intronic
1118553270 14:66981341-66981363 AGGCACCAGCTTTACTGAAAGGG + Intronic
1118618556 14:67593784-67593806 AAGCACTACCTTCATAGAAATGG - Exonic
1120133486 14:80835644-80835666 AATTAACACCTCCACTGAGAAGG + Intronic
1120564756 14:86042037-86042059 ATGGGACAACTTCACTGAAAAGG + Intergenic
1122105045 14:99446669-99446691 AAGCAACACTTTTCCTAAAAGGG + Intronic
1124107587 15:26754689-26754711 AAACAACACCTCCAATGAATCGG + Intronic
1124108450 15:26763365-26763387 AAGATACACCTTTACTGCAAGGG + Intronic
1124398535 15:29328493-29328515 ACGAAACAACCTCACTGAAAGGG + Intronic
1125082030 15:35686011-35686033 AAGCCACACCTTCAGAGAAAAGG - Intergenic
1127200726 15:56647045-56647067 AATCAAGACCTTCCCTGAAGAGG - Intronic
1127514337 15:59677081-59677103 AAGCACTACCTTCATAGAAATGG + Intronic
1128061637 15:64739181-64739203 AAGCAACCTCTTCACAGACAAGG + Intergenic
1130004445 15:80081164-80081186 AATGAAAACCTACACTGAAAAGG + Intronic
1131864110 15:96688755-96688777 AAGCAACAAATTCAGTGAATTGG - Intergenic
1133540179 16:6743740-6743762 AAGCAACACCCTGTCTCAAAAGG + Intronic
1136184044 16:28574667-28574689 AAGCCACACCTTCCCTGATCTGG + Intronic
1137021820 16:35435683-35435705 AGGCAACACCGTCTATGAAATGG - Intergenic
1137297944 16:47114915-47114937 AGGCAACACCTACACTCAACAGG + Intronic
1138132727 16:54495179-54495201 ACTTAACACCTTCTCTGAAATGG + Intergenic
1139098960 16:63742953-63742975 ATGGAACAACCTCACTGAAAAGG + Intergenic
1143737793 17:8925818-8925840 ATGCATCACATTCACTGAGATGG + Intronic
1145198820 17:20921133-20921155 AAGCAGCACCATAACTGAATTGG - Intergenic
1151056730 17:71040509-71040531 AAGTGAGACATTCACTGAAATGG + Intergenic
1152498782 17:80694506-80694528 AACCAACACATTCACGGGAAAGG - Intronic
1154464820 18:14633024-14633046 AAGCCACACCTCGACTGGAAGGG - Intergenic
1156772390 18:40744389-40744411 AAATAACACCTTTAATGAAATGG - Intergenic
1156940433 18:42760447-42760469 AAACAACACTATCACTGCAATGG + Intronic
1157240199 18:46002127-46002149 AAATGACACCTTCACTAAAAGGG - Intronic
1158164978 18:54530036-54530058 AATCAACAATTTCACTGAAGTGG - Intergenic
1159764241 18:72468344-72468366 AAGCAGCTCCTTCTCAGAAAGGG + Intergenic
1161243570 19:3236328-3236350 AGGCCACACATGCACTGAAAAGG - Intronic
1162504132 19:11072700-11072722 AAACACCAGCATCACTGAAATGG + Intergenic
1163936424 19:20448757-20448779 AAGCAACATCAGCACTGACAGGG + Intergenic
1163984373 19:20931187-20931209 AAGCAACATCAGCACTGACAGGG + Intronic
1164354527 19:27405286-27405308 AAGAAATATCTTCACTTAAAAGG - Intergenic
930254131 2:49069379-49069401 TAGCGAAAGCTTCACTGAAATGG - Intronic
931180694 2:59897572-59897594 AAACATTACCTTCACTGAGATGG + Intergenic
933409132 2:81903109-81903131 ATGCAACAACTTCACTGAAGGGG + Intergenic
933671748 2:85014522-85014544 AATCATCACCTTCCCTTAAAAGG + Intronic
936793994 2:116185612-116185634 AGGCAACACTTACACTGATAAGG - Intergenic
937908104 2:127062125-127062147 GAGCAACACCTTCACGGTCAAGG - Exonic
940838958 2:158557484-158557506 CAGCAACATTTTCACTGCAAAGG - Intronic
941205203 2:162563442-162563464 AAGCAAAACCACCACTGAGAAGG - Intronic
942222193 2:173780991-173781013 CAGCAAGCCCTTCACTGAAAGGG + Intergenic
942663692 2:178293263-178293285 AAGCCACACTTCCACAGAAAGGG + Intronic
943010100 2:182437411-182437433 ATGTTTCACCTTCACTGAAAAGG + Intronic
944044306 2:195391029-195391051 AGCCTACACCTTCAGTGAAAGGG + Intergenic
945828591 2:214755648-214755670 AAGCAACATGATTACTGAAATGG + Intronic
947024907 2:225726428-225726450 AAGTAACAACACCACTGAAAGGG + Intergenic
947257894 2:228185771-228185793 CAGCAACACCATCACCCAAAAGG + Intergenic
1170816078 20:19715584-19715606 AAGTCACATCTTCACAGAAAGGG + Intronic
1172757173 20:37293867-37293889 ATTAAACAACTTCACTGAAAGGG - Intronic
1173359989 20:42334559-42334581 CAACCACAGCTTCACTGAAATGG - Intronic
1174239461 20:49121497-49121519 GAGCAACACCTTTGCTGAACTGG + Intronic
1176809717 21:13525359-13525381 AAGCCACACCTCGACTGGAAGGG + Intergenic
1177734913 21:25076872-25076894 AAGCAACAGATTCACTGCAGTGG - Intergenic
1178673699 21:34614143-34614165 AAGCCACACCTTCACACAAGGGG + Intronic
1182536276 22:31005620-31005642 ATGCAACAACTTCACTGAAGAGG + Intergenic
1182999322 22:34841996-34842018 AAGCAACAACCTCACAGTAATGG + Intergenic
1183935198 22:41257968-41257990 TGACAACACCTTCACTGAGAAGG - Exonic
1185164300 22:49251258-49251280 AATTAACACCTTCATTGAAATGG + Intergenic
949108540 3:229945-229967 AAGCAACAGCTGCACAGACAAGG - Intronic
949303064 3:2606789-2606811 CAGAAAAACTTTCACTGAAATGG - Intronic
949325451 3:2858309-2858331 AAGCATCACAATCACTGGAAAGG - Intronic
949486289 3:4542649-4542671 AAGCTACAGCTTCAATGCAATGG - Intronic
949833453 3:8242444-8242466 ATGAAACAACCTCACTGAAAGGG + Intergenic
950313684 3:11981350-11981372 AATCATCACCTTCAGTTAAAAGG - Intergenic
951038287 3:17958943-17958965 AAGCAACAACTTAAATGAAGGGG - Intronic
953091816 3:39734993-39735015 ATGAAAAATCTTCACTGAAAAGG - Intergenic
955340149 3:58118922-58118944 CAGCAACACCCACAGTGAAAGGG - Exonic
955503293 3:59606325-59606347 AATAAACACCTTCACAGACAGGG - Intergenic
957077874 3:75615971-75615993 ATGCAACACCTTTAGAGAAAGGG - Intergenic
957267959 3:77991686-77991708 AAGAAACACATAGACTGAAAAGG - Intergenic
958103536 3:89045112-89045134 AGGCAACACCTTAATTGGAATGG - Intergenic
958154889 3:89743884-89743906 AATCAACACAATCACAGAAATGG - Intergenic
958940573 3:100308619-100308641 AAGAAACACATTCACTAAAAAGG - Intronic
958976034 3:100668658-100668680 AACCAACTTCTTCATTGAAATGG - Intronic
959700675 3:109296283-109296305 AAAAAACACCTTAACTGTAAAGG + Intronic
961253941 3:125530646-125530668 AAGCAACACCTTCACTGAAATGG + Intronic
961354029 3:126322726-126322748 AGGCAAGAGCTACACTGAAATGG - Intergenic
961961497 3:130860145-130860167 AAGCTACACTGTCACAGAAAAGG - Intronic
962695657 3:137944835-137944857 AAGCAAGTCCTTCATTGAAGAGG + Intergenic
963481916 3:145886818-145886840 AACCAGCACATTCACTGAGAGGG - Intergenic
963549877 3:146706085-146706107 AACCTACACTTCCACTGAAATGG - Intergenic
963815003 3:149819836-149819858 AGGGAACACCTTCTCTTAAAAGG - Intronic
964810722 3:160661238-160661260 AATCATCACACTCACTGAAAGGG - Intergenic
965129593 3:164679884-164679906 AATTAACACCTTCACAGAGAAGG - Intergenic
966758401 3:183392901-183392923 AAAGAACACCTCCACTGCAATGG + Intronic
969020954 4:4139979-4140001 ATGCAACACCTTTAGAGAAAGGG - Intergenic
969081510 4:4622222-4622244 AACCACCACCCTCACTGAGAGGG + Intergenic
969195330 4:5558658-5558680 AAGAAACAACTTTACTGAAAAGG + Intronic
969792480 4:9501524-9501546 ATGCAACACCTTTAGAGAAAGGG + Intergenic
971634706 4:29043445-29043467 AAGGAAGAATTTCACTGAAACGG - Intergenic
972788958 4:42352252-42352274 AAGCAAAACCTTGGCTAAAAGGG - Intergenic
973317614 4:48779210-48779232 AAGCAACAACTTCCATCAAACGG + Intronic
977452252 4:97213566-97213588 CAGCAATACCATCACTGAGAAGG + Intronic
979194380 4:117902864-117902886 AAGCAAAAACTTTAATGAAAAGG + Intergenic
979324458 4:119362406-119362428 TAGCGACACCTACACTGATATGG - Intergenic
979444405 4:120794175-120794197 TAGCAACACCTTAAATGAATGGG + Intronic
980637320 4:135524684-135524706 AAACAACACCTTCGTTTAAATGG - Intergenic
981591481 4:146368265-146368287 AAGCCCAACCTTGACTGAAAGGG - Intronic
982731610 4:158961938-158961960 AACCAATATCTTCATTGAAATGG + Intronic
984315669 4:178128403-178128425 AAGCCACAACTCCACTGAAATGG + Intergenic
984833731 4:183999873-183999895 AAGCAACACCCTCCCCGACAAGG - Intronic
987263116 5:16223196-16223218 GTGCAGCACCTTCAGTGAAAAGG - Intergenic
989287563 5:39720417-39720439 AAGCAAAACCAACACTGAAGTGG - Intergenic
989323286 5:40161504-40161526 AAGCAAGTCCTTCTTTGAAAGGG + Intergenic
989671060 5:43917602-43917624 CAGCACCAACATCACTGAAAAGG - Intergenic
994637988 5:102366276-102366298 AAACAAAACCATCACAGAAAAGG + Intergenic
994847348 5:105006232-105006254 CAGCAACTCCTTAACTCAAAGGG + Intergenic
997481886 5:134191788-134191810 ACTCAAGACCTTCACTGCAAAGG + Intronic
998568423 5:143236273-143236295 CAGGAACACCTTCACTGGCAAGG + Intergenic
998909740 5:146946143-146946165 AAGCAACAGCTTTACACAAAAGG + Intronic
999530096 5:152453440-152453462 ATGAAACATCTTCACTGAAGAGG - Intergenic
1000273310 5:159708101-159708123 AAGCAAGACGATCCCTGAAAAGG + Intergenic
1002711394 5:181197346-181197368 AGGGAAGACCCTCACTGAAAAGG + Intronic
1002793597 6:452690-452712 AAGCAAAACCTTTAGTGGAAGGG + Intergenic
1003106560 6:3221149-3221171 AAGCCACATCTTAACTAAAATGG + Intergenic
1003461077 6:6328730-6328752 AAGAAACACTTTCACAGGAAGGG - Intergenic
1005246944 6:23897289-23897311 AAGAAACAACTTAACTGAAAGGG - Intergenic
1006910405 6:37559705-37559727 AAGCCCCGCTTTCACTGAAATGG - Intergenic
1008061988 6:47008226-47008248 CAGCAAAACCTTCACTGAACTGG + Intronic
1008868790 6:56247481-56247503 GAGCAAGACCTGCGCTGAAACGG + Exonic
1010620363 6:78066147-78066169 AAGAAACAACCTCACTGAAGGGG - Intergenic
1010843667 6:80678667-80678689 AAGCAACACCTTGATGGGAATGG + Intergenic
1013438904 6:110141106-110141128 AAGCAAAACCATGAATGAAAGGG + Intronic
1014055474 6:117009606-117009628 AGGCAACACCTGCTCTAAAATGG + Intergenic
1015458058 6:133451757-133451779 AAGAAACAACTTCAAAGAAAAGG + Intronic
1016427578 6:143950650-143950672 AAGCAGCTCCTTCTCTGAAGGGG - Intronic
1016480631 6:144477082-144477104 TAGCAACATCTTCACTTAGACGG - Intronic
1017023566 6:150161780-150161802 ATGCAACAACCTCACTGAAGGGG - Intronic
1018779192 6:167046653-167046675 AACAAAGCCCTTCACTGAAAAGG - Exonic
1019722532 7:2582053-2582075 AAGCAAGACATTCACAGAAAAGG + Intronic
1020308378 7:6852004-6852026 ATGCAACACCTTTAGAGAAAGGG - Intergenic
1027874303 7:83749430-83749452 TTGCAACACCTTCACTGATCTGG + Intergenic
1028293167 7:89093359-89093381 ATGAAACAACCTCACTGAAAAGG - Intronic
1028700760 7:93776378-93776400 AACCAACACGTTCAAGGAAATGG - Intronic
1032283039 7:130521303-130521325 TAGCAACACATTCAGTGAAGTGG + Intronic
1033219027 7:139515697-139515719 AAGCAACACATTCAATGGCAGGG - Intergenic
1035516175 8:233922-233944 AAGCACCAGCTTCACAGGAATGG - Intronic
1035959614 8:4122728-4122750 AAGTAACACTTTCTGTGAAAGGG + Intronic
1038773350 8:30504542-30504564 AGGCAACCTCTTCACAGAAATGG - Intronic
1040590986 8:48791762-48791784 AAGAAAGAACTTCACTGAGAGGG + Intergenic
1042481885 8:69313523-69313545 AAGCAAAACCTTCGCTTACAGGG - Intergenic
1044363127 8:91311221-91311243 ATGCAACAACCTCACTGAAGTGG - Intronic
1044771548 8:95640938-95640960 AAGCAGCTCCTACACTGAGAGGG + Intergenic
1045615495 8:103905468-103905490 AAGCAACACCTTACCTAAAGGGG - Intronic
1046501236 8:115080157-115080179 AAGCAACACCATCAGAGTAAGGG - Intergenic
1046872691 8:119221234-119221256 AAAAAATACCTTCATTGAAAAGG + Intronic
1047329214 8:123870884-123870906 ATGAAACAACCTCACTGAAAGGG + Intronic
1047460241 8:125056809-125056831 CTGCAAAACCTTCAGTGAAAAGG + Exonic
1047497047 8:125415900-125415922 AACCAAAACCTCCACTTAAAGGG - Intergenic
1048106158 8:131412243-131412265 AAGCAATGTCTTCAATGAAATGG - Intergenic
1048559706 8:135520615-135520637 AAGAAACACTTGCACAGAAAAGG + Intronic
1048912246 8:139147009-139147031 AAGCATCACCTTACCTGATAAGG - Intergenic
1050157458 9:2682610-2682632 AAGCAAAAACTTTACTAAAATGG - Intergenic
1050643714 9:7695821-7695843 ATGCAACAACTTCACAGAAGTGG + Intergenic
1054455797 9:65429794-65429816 CAGCAATGGCTTCACTGAAAAGG + Intergenic
1055034164 9:71800218-71800240 AGGCAGCAACTTCTCTGAAAAGG - Intronic
1058609081 9:106755563-106755585 AAGCAACAGCTTCCCTCAAATGG - Intergenic
1060496089 9:124119500-124119522 AAGACCCACCTTTACTGAAAGGG + Intergenic
1062224796 9:135443818-135443840 AAGCCACACTTCCACTCAAATGG + Intergenic
1186113519 X:6280272-6280294 AAGAAACAGCATCACGGAAATGG - Intergenic
1187434083 X:19251017-19251039 TAGCAACATATTCTCTGAAAAGG - Intergenic
1188375171 X:29419734-29419756 GAGCAACAGCTGCACTGAAGTGG - Intronic
1189731716 X:44027776-44027798 AAGCAACATGTTCATTGACAAGG + Intergenic
1192509260 X:71712378-71712400 ATCCAACACCTTCCCTGAGAGGG - Intergenic
1192517437 X:71769175-71769197 ATCCAACACCTTCCCTGAGAGGG + Intergenic
1193789706 X:85802502-85802524 AATCAACAGCTTCCCTGAAATGG - Intergenic
1196284389 X:113863104-113863126 TAGCAACACCTTTACAGCAAGGG - Intergenic
1196889798 X:120280854-120280876 AAGCAATACCTTCAATGCAGGGG - Intronic
1202033905 Y:20611442-20611464 TAGGAACACATTCACTGAAATGG - Intergenic