ID: 961259808

View in Genome Browser
Species Human (GRCh38)
Location 3:125593168-125593190
Sequence GCTTCGTCCTGACCTGCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 3, 3: 1, 4: 59}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961259808_961259816 12 Left 961259808 3:125593168-125593190 CCCATAGCAGGTCAGGACGAAGC 0: 1
1: 0
2: 3
3: 1
4: 59
Right 961259816 3:125593203-125593225 GGACCCGCGGCCCCTGCCACAGG 0: 1
1: 0
2: 2
3: 20
4: 212
961259808_961259814 -1 Left 961259808 3:125593168-125593190 CCCATAGCAGGTCAGGACGAAGC 0: 1
1: 0
2: 3
3: 1
4: 59
Right 961259814 3:125593190-125593212 CGCCACGGACAGGGGACCCGCGG 0: 2
1: 0
2: 1
3: 9
4: 80
961259808_961259813 -9 Left 961259808 3:125593168-125593190 CCCATAGCAGGTCAGGACGAAGC 0: 1
1: 0
2: 3
3: 1
4: 59
Right 961259813 3:125593182-125593204 GGACGAAGCGCCACGGACAGGGG 0: 1
1: 1
2: 0
3: 3
4: 58
961259808_961259812 -10 Left 961259808 3:125593168-125593190 CCCATAGCAGGTCAGGACGAAGC 0: 1
1: 0
2: 3
3: 1
4: 59
Right 961259812 3:125593181-125593203 AGGACGAAGCGCCACGGACAGGG 0: 1
1: 1
2: 0
3: 3
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961259808 Original CRISPR GCTTCGTCCTGACCTGCTAT GGG (reversed) Intronic
901234810 1:7662040-7662062 GCCTCGTCCTGCCCTGCAACTGG + Intronic
904043870 1:27599117-27599139 GCTCCTTCCTGACCTACCATGGG + Intronic
907667208 1:56443837-56443859 GCTGCTTCCTGCCCTGCTTTAGG + Intergenic
908783945 1:67716765-67716787 GCTTCCTGCTGATTTGCTATGGG - Intronic
1064148497 10:12843663-12843685 TCTTTGTGCTGACCTGCTGTAGG - Intergenic
1066598804 10:37081503-37081525 GTTTTGTTCTGACCTGTTATTGG - Intergenic
1074503511 10:114045637-114045659 GCTTCGAGTTCACCTGCTATCGG - Exonic
1074708618 10:116158525-116158547 CCCTCCTCCTGACCTGCCATGGG - Intronic
1075844444 10:125534213-125534235 GCTTCCTCCTCTCCTGCTGTGGG + Intergenic
1076562377 10:131375556-131375578 GCATCGTCCTGACCTGGGGTGGG + Intergenic
1080590310 11:33717716-33717738 GCTTCCTCCTAACCTGCAACTGG + Intronic
1083625984 11:64072200-64072222 GCTTCATCCTCAGCTGCTGTGGG + Intronic
1086811360 11:91314300-91314322 GCTGTGTCCTGACCTGGTAGAGG - Intergenic
1089260374 11:117220084-117220106 CCTTTGCCCTGCCCTGCTATTGG - Intronic
1089814717 11:121162194-121162216 GCTTCTTCCAGCCCTGCTATGGG + Exonic
1101519434 12:105467861-105467883 GCTTCCTCCGGCCCTGCTCTTGG + Intergenic
1118224954 14:63890141-63890163 GCTTCGTCCTGCTGTGCTCTGGG + Intronic
1122974083 14:105163950-105163972 GCTTCGGCCTGAGCTGCTGCTGG - Intronic
1131430294 15:92382659-92382681 ACTTTCTCCTTACCTGCTATGGG + Intergenic
1143765458 17:9134870-9134892 TCTTCCTCCTGCCCTGCTTTTGG + Intronic
1146223623 17:31047952-31047974 GCTTGATCCTGACCTGGTGTTGG + Intergenic
1147232730 17:39030860-39030882 GCTTGGTCCTGGCCTGCTATTGG - Intergenic
1147232781 17:39031212-39031234 GCTTGATCCTGACCTGGTGTTGG - Intergenic
1147232814 17:39031404-39031426 GCTTGATCCTGACCTGGTGTTGG - Intergenic
1147922003 17:43923426-43923448 GCTTGATCCTGACCTGGTGTTGG + Intergenic
1148173985 17:45548543-45548565 GCTTGATCCTGACCTGGTGTTGG + Intergenic
1148275282 17:46296904-46296926 GCTTGATCCTGACCTGGTGTTGG - Exonic
1148297388 17:46514483-46514505 GCTTGATCCTGACCTGGTGTTGG - Exonic
1148361942 17:47018963-47018985 GCTTGATCCTGACCTGGTGTTGG - Intronic
1150405199 17:64895465-64895487 GCTTGATCCTGACCTGGTGTTGG + Exonic
1150784229 17:68150071-68150093 GCTTGATCCTGACCTGGTGTTGG + Intergenic
1150784285 17:68150428-68150450 GCTTGATCCTGACCTGGTGTTGG + Intergenic
1155651590 18:28150209-28150231 GCTCCGGCCTGACCTGTCATGGG - Intronic
1156881710 18:42088204-42088226 GCTTCCTCCTCACCTCCTCTTGG + Intergenic
1160694391 19:475531-475553 GCTGCCTCCTCACCTGCTTTGGG - Intergenic
1160804236 19:984769-984791 GCTCAGGCCTGAGCTGCTATGGG + Intronic
925214967 2:2086629-2086651 GCTTCTGCCTGCCCTGCTGTTGG + Intronic
937858887 2:126692869-126692891 GCCAAGTCCTGACCTGATATCGG + Intronic
940335129 2:152518784-152518806 GCTTAGTCCTGGCCTCCTACTGG + Intronic
944893973 2:204145326-204145348 GCCTCATCCTCACCTGCTTTTGG - Intergenic
945260244 2:207836399-207836421 ACTTCTTCCTCACTTGCTATGGG - Intronic
947929840 2:233955241-233955263 GCTTCGTGCTTACCTCCCATCGG - Exonic
948467953 2:238161180-238161202 GCTTCTTCCTGAGCACCTATGGG + Intronic
1172851641 20:37970710-37970732 GCTTTGTCCAGAACTGCTGTAGG + Intergenic
1174806245 20:53606715-53606737 GCTCAGCCCTGACCTGCTGTGGG - Intronic
950453378 3:13078336-13078358 GCTCCATCCTGTCCTGCCATTGG - Intergenic
951749095 3:26013954-26013976 GTTACATCCTGACCTGCCATGGG + Intergenic
961259808 3:125593168-125593190 GCTTCGTCCTGACCTGCTATGGG - Intronic
969463926 4:7343685-7343707 GCTTCCTCTTGACCTCCTAAGGG - Intronic
974593659 4:63988510-63988532 GCTTGGTCTTGTCCTGCTTTTGG - Intergenic
996561051 5:124829842-124829864 GCTTCATTCTGCCCAGCTATAGG - Intergenic
1006829795 6:36961864-36961886 GCATCCTCCTGACCTCCTGTAGG + Exonic
1012492528 6:99798150-99798172 GCCTCGTCCTGAGCTGCGGTCGG + Intergenic
1035645204 8:1213815-1213837 GCTGCCTCCTGACCTGGTCTGGG + Intergenic
1039595005 8:38784119-38784141 GCTTCGTTCTTACCTGGTACAGG - Intronic
1042032079 8:64487246-64487268 TCTTCTTCCTGACATGCTCTGGG - Intergenic
1047174218 8:122525129-122525151 CCTTCCTCCTGCCCTGCAATAGG - Intergenic
1055198783 9:73630245-73630267 GCTTGGTCTGGACCTGCTAAAGG + Intergenic
1061713120 9:132501265-132501287 GCTTCTTCCTCACCTGCAAATGG + Intronic
1189316445 X:40060401-40060423 CCTTAGTCCAGGCCTGCTATAGG + Intronic
1192089649 X:68140494-68140516 GCTTCATGCTGACCTGCAAGTGG - Intronic
1199600261 X:149537501-149537523 GTTTCGTGCTGACCTGCTATTGG + Intergenic
1199650322 X:149942439-149942461 GTTTCGTGCTGACCTGCTATTGG - Intergenic
1200224819 X:154411668-154411690 GCTCCGGCCTGACCTGCGAAGGG + Exonic