ID: 961259812

View in Genome Browser
Species Human (GRCh38)
Location 3:125593181-125593203
Sequence AGGACGAAGCGCCACGGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 1, 2: 0, 3: 3, 4: 50}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961259800_961259812 3 Left 961259800 3:125593155-125593177 CCCCACCCACAGCCCCATAGCAG 0: 1
1: 0
2: 8
3: 60
4: 566
Right 961259812 3:125593181-125593203 AGGACGAAGCGCCACGGACAGGG 0: 1
1: 1
2: 0
3: 3
4: 50
961259803_961259812 1 Left 961259803 3:125593157-125593179 CCACCCACAGCCCCATAGCAGGT 0: 1
1: 0
2: 3
3: 26
4: 324
Right 961259812 3:125593181-125593203 AGGACGAAGCGCCACGGACAGGG 0: 1
1: 1
2: 0
3: 3
4: 50
961259799_961259812 14 Left 961259799 3:125593144-125593166 CCGCGGCGGCGCCCCACCCACAG 0: 1
1: 0
2: 1
3: 16
4: 178
Right 961259812 3:125593181-125593203 AGGACGAAGCGCCACGGACAGGG 0: 1
1: 1
2: 0
3: 3
4: 50
961259805_961259812 -3 Left 961259805 3:125593161-125593183 CCACAGCCCCATAGCAGGTCAGG 0: 1
1: 0
2: 3
3: 24
4: 225
Right 961259812 3:125593181-125593203 AGGACGAAGCGCCACGGACAGGG 0: 1
1: 1
2: 0
3: 3
4: 50
961259808_961259812 -10 Left 961259808 3:125593168-125593190 CCCATAGCAGGTCAGGACGAAGC 0: 1
1: 0
2: 3
3: 1
4: 59
Right 961259812 3:125593181-125593203 AGGACGAAGCGCCACGGACAGGG 0: 1
1: 1
2: 0
3: 3
4: 50
961259807_961259812 -9 Left 961259807 3:125593167-125593189 CCCCATAGCAGGTCAGGACGAAG 0: 1
1: 0
2: 0
3: 5
4: 71
Right 961259812 3:125593181-125593203 AGGACGAAGCGCCACGGACAGGG 0: 1
1: 1
2: 0
3: 3
4: 50
961259801_961259812 2 Left 961259801 3:125593156-125593178 CCCACCCACAGCCCCATAGCAGG 0: 1
1: 1
2: 3
3: 34
4: 390
Right 961259812 3:125593181-125593203 AGGACGAAGCGCCACGGACAGGG 0: 1
1: 1
2: 0
3: 3
4: 50
961259804_961259812 -2 Left 961259804 3:125593160-125593182 CCCACAGCCCCATAGCAGGTCAG 0: 1
1: 0
2: 1
3: 18
4: 204
Right 961259812 3:125593181-125593203 AGGACGAAGCGCCACGGACAGGG 0: 1
1: 1
2: 0
3: 3
4: 50
961259798_961259812 20 Left 961259798 3:125593138-125593160 CCAGGGCCGCGGCGGCGCCCCAC 0: 1
1: 0
2: 4
3: 37
4: 319
Right 961259812 3:125593181-125593203 AGGACGAAGCGCCACGGACAGGG 0: 1
1: 1
2: 0
3: 3
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961259812 Original CRISPR AGGACGAAGCGCCACGGACA GGG Intronic
911287020 1:96008098-96008120 AGGACTTACCACCACGGACATGG + Intergenic
912759926 1:112357763-112357785 AGGATCAAGGGCCATGGACATGG + Intergenic
916942405 1:169689557-169689579 AGGAGGAAGGGCCTGGGACAGGG - Intronic
923638069 1:235721592-235721614 AGGAAGAAGAGCCACAGATATGG + Intronic
1066421930 10:35271736-35271758 AGGGCAAAGCGCCAAGGAAATGG - Intronic
1067105345 10:43362593-43362615 AGGACAAGGCGGCACGGAAATGG - Intergenic
1080622344 11:33997119-33997141 AGGATGGAGCCCCGCGGACAGGG + Intergenic
1083096410 11:60255585-60255607 AGGATGAAGCACCACACACAAGG + Intergenic
1092999647 12:13982167-13982189 GGGAGGAGGCGCCACGGACTCGG - Intergenic
1095954228 12:47797323-47797345 AGGGGGAAGGGCCTCGGACATGG - Intronic
1097894109 12:64807217-64807239 AGGAAGAAGCGCCAAGCAAAAGG - Intronic
1100431187 12:94533300-94533322 TGGCCGAAGCGCCACTGACCCGG - Intergenic
1100700289 12:97140142-97140164 AGGCAGAAGCTCCACGGAAAAGG - Intergenic
1104013872 12:124949891-124949913 AGGACAAAGCACCACACACAGGG - Intronic
1105522988 13:21148053-21148075 AGGGAGAAGAGCCAAGGACAAGG + Exonic
1113508028 13:110830650-110830672 AGGACGAAGCACCATAGACCAGG - Intergenic
1119357468 14:74019148-74019170 AGGACGAAGCGCTACCGCCTGGG + Intronic
1121329793 14:93042688-93042710 AGGGAGAAGGGCCTCGGACAAGG + Intronic
1150221994 17:63500984-63501006 AGGAAGAGGCGACACGGGCAGGG - Intronic
1152934330 17:83127446-83127468 AGGACCAAGGGCCACACACAGGG - Intergenic
1159692012 18:71500161-71500183 AGCAGGAAGAGCCACAGACATGG + Intergenic
1161129507 19:2579695-2579717 GGGACGCACCCCCACGGACAGGG + Intronic
1162538645 19:11279708-11279730 ATGACCAAGCACCACAGACAGGG - Intergenic
926286933 2:11496063-11496085 GGGAGGAAGCGCCACGGATAAGG - Intergenic
943705986 2:191034919-191034941 AGGACGAAGCATGATGGACATGG + Intronic
944300932 2:198123979-198124001 ATGACAAAGCACCACAGACAGGG - Intronic
944866849 2:203870827-203870849 AGGACTGAGGGCCATGGACACGG + Exonic
947333636 2:229056793-229056815 AGGATGAACCACCAGGGACACGG - Intronic
1174386296 20:50190309-50190331 GGGAGGAAGGGCCACGGAGATGG + Intergenic
1180000574 21:44993620-44993642 AGGAGGAAGTCCCAGGGACAGGG - Intergenic
1181099749 22:20531362-20531384 AGGACGAAGGTGCACAGACAGGG - Intronic
953484892 3:43286315-43286337 AGGAGGAAGCACCAGGGACACGG - Intergenic
954763771 3:52896742-52896764 AGGAAGAAGGGCCACGGAGAGGG + Intronic
960973473 3:123155426-123155448 AGGGCGAGGCTCCACTGACATGG - Intronic
961259812 3:125593181-125593203 AGGACGAAGCGCCACGGACAGGG + Intronic
961260042 3:125595154-125595176 AGGACGGAGCGCCACGGACAGGG + Intergenic
968449321 4:667724-667746 AGGAGGGAGCGCCACGGAGGGGG - Intronic
984893395 4:184513722-184513744 AGGATGAAGAGCCATGGAGAAGG + Intergenic
985580404 5:692969-692991 AGGCCAAAGCGCCAGGCACAGGG + Intronic
985595067 5:784359-784381 AGGCCAAAGCGCCAGGCACAGGG + Intergenic
987099242 5:14577583-14577605 GGGACCCGGCGCCACGGACAGGG - Intergenic
990042092 5:51388136-51388158 AGGATGAAGCTCCAGGGACCCGG - Intronic
1000786182 5:165546795-165546817 AGGAAGAAGAGTCATGGACAAGG + Intergenic
1001314349 5:170631994-170632016 AGGACGATTTGCCACAGACAGGG + Intronic
1002695391 5:181085088-181085110 TGGAGAAAGCGCCAGGGACAGGG + Intergenic
1027346268 7:77262914-77262936 ATGACCAAGCGCCACTGAAAGGG + Intronic
1031656036 7:124356781-124356803 ATGACAAAGCGCCACAGACTGGG - Intergenic
1036515561 8:9440312-9440334 AGGACGAAGACCCACGGAGCAGG + Intergenic
1038494617 8:27992555-27992577 AGGACCAGGCACCAAGGACAGGG - Exonic
1044634066 8:94304918-94304940 AGGGAGAAGCGCCCAGGACATGG + Intergenic
1049037399 8:140087215-140087237 AGGAGGAAGAGCCAGGGACTGGG - Intronic
1062366450 9:136211717-136211739 AGGAGGATGAGCCACGGACTCGG + Intronic
1185764627 X:2715464-2715486 AGGAGGAGGCCCCACGGAGAAGG - Intronic
1186186787 X:7028772-7028794 ATAACAAAGCGCCACGGACCGGG + Intergenic
1191661227 X:63653256-63653278 AGGATGAAGTGGCACAGACATGG - Intronic