ID: 961259813

View in Genome Browser
Species Human (GRCh38)
Location 3:125593182-125593204
Sequence GGACGAAGCGCCACGGACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 1, 2: 0, 3: 3, 4: 58}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961259803_961259813 2 Left 961259803 3:125593157-125593179 CCACCCACAGCCCCATAGCAGGT 0: 1
1: 0
2: 3
3: 26
4: 324
Right 961259813 3:125593182-125593204 GGACGAAGCGCCACGGACAGGGG 0: 1
1: 1
2: 0
3: 3
4: 58
961259804_961259813 -1 Left 961259804 3:125593160-125593182 CCCACAGCCCCATAGCAGGTCAG 0: 1
1: 0
2: 1
3: 18
4: 204
Right 961259813 3:125593182-125593204 GGACGAAGCGCCACGGACAGGGG 0: 1
1: 1
2: 0
3: 3
4: 58
961259801_961259813 3 Left 961259801 3:125593156-125593178 CCCACCCACAGCCCCATAGCAGG 0: 1
1: 1
2: 3
3: 34
4: 390
Right 961259813 3:125593182-125593204 GGACGAAGCGCCACGGACAGGGG 0: 1
1: 1
2: 0
3: 3
4: 58
961259798_961259813 21 Left 961259798 3:125593138-125593160 CCAGGGCCGCGGCGGCGCCCCAC 0: 1
1: 0
2: 4
3: 37
4: 319
Right 961259813 3:125593182-125593204 GGACGAAGCGCCACGGACAGGGG 0: 1
1: 1
2: 0
3: 3
4: 58
961259808_961259813 -9 Left 961259808 3:125593168-125593190 CCCATAGCAGGTCAGGACGAAGC 0: 1
1: 0
2: 3
3: 1
4: 59
Right 961259813 3:125593182-125593204 GGACGAAGCGCCACGGACAGGGG 0: 1
1: 1
2: 0
3: 3
4: 58
961259800_961259813 4 Left 961259800 3:125593155-125593177 CCCCACCCACAGCCCCATAGCAG 0: 1
1: 0
2: 8
3: 60
4: 566
Right 961259813 3:125593182-125593204 GGACGAAGCGCCACGGACAGGGG 0: 1
1: 1
2: 0
3: 3
4: 58
961259809_961259813 -10 Left 961259809 3:125593169-125593191 CCATAGCAGGTCAGGACGAAGCG 0: 1
1: 0
2: 0
3: 2
4: 32
Right 961259813 3:125593182-125593204 GGACGAAGCGCCACGGACAGGGG 0: 1
1: 1
2: 0
3: 3
4: 58
961259805_961259813 -2 Left 961259805 3:125593161-125593183 CCACAGCCCCATAGCAGGTCAGG 0: 1
1: 0
2: 3
3: 24
4: 225
Right 961259813 3:125593182-125593204 GGACGAAGCGCCACGGACAGGGG 0: 1
1: 1
2: 0
3: 3
4: 58
961259799_961259813 15 Left 961259799 3:125593144-125593166 CCGCGGCGGCGCCCCACCCACAG 0: 1
1: 0
2: 1
3: 16
4: 178
Right 961259813 3:125593182-125593204 GGACGAAGCGCCACGGACAGGGG 0: 1
1: 1
2: 0
3: 3
4: 58
961259807_961259813 -8 Left 961259807 3:125593167-125593189 CCCCATAGCAGGTCAGGACGAAG 0: 1
1: 0
2: 0
3: 5
4: 71
Right 961259813 3:125593182-125593204 GGACGAAGCGCCACGGACAGGGG 0: 1
1: 1
2: 0
3: 3
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961259813 Original CRISPR GGACGAAGCGCCACGGACAG GGG Intronic
900563793 1:3322557-3322579 GGACGAAGCTCCTGAGACAGTGG - Intronic
1065288663 10:24208969-24208991 GGACGGAGGGCCAGGGGCAGGGG + Intronic
1076814461 10:132907972-132907994 GGACAAAGGGCCACAGACCGGGG - Intronic
1077537992 11:3133677-3133699 GGACGCAGCACCATGCACAGTGG - Intronic
1080980522 11:37399041-37399063 GCACCTAGCGCCAGGGACAGAGG + Intergenic
1085079713 11:73624223-73624245 GGATGAAGGGCCACAGAAAGTGG - Intergenic
1090904551 11:131063837-131063859 GGACAAAGGGCCACGGTAAGAGG - Intergenic
1092999646 12:13982166-13982188 GGAGGAGGCGCCACGGACTCGGG - Intergenic
1097067883 12:56334009-56334031 GGAAGAAGCGCCTCGGACCCCGG - Intronic
1100431186 12:94533299-94533321 GGCCGAAGCGCCACTGACCCGGG - Intergenic
1104641476 12:130470020-130470042 GGACCAGGAGCCAGGGACAGGGG + Intronic
1112818394 13:103300859-103300881 GGACCAAGAGCCACGGCCCGTGG + Intergenic
1118854782 14:69612118-69612140 GGACGGCGCGCCCCGGACCGCGG - Intronic
1119357469 14:74019149-74019171 GGACGAAGCGCTACCGCCTGGGG + Intronic
1122065912 14:99174518-99174540 GGCCGCAGCGGCACGGCCAGCGG - Exonic
1122725371 14:103747104-103747126 GGACACAGAGCCACAGACAGAGG + Intronic
1125730898 15:41892341-41892363 GGCCGGAGCTCCAGGGACAGAGG - Intronic
1128657769 15:69475023-69475045 GGACAGAGCCCCAGGGACAGTGG - Intergenic
1129365478 15:75051433-75051455 AGACGAACCCCCAGGGACAGGGG - Intronic
1136503321 16:30685869-30685891 GGACGATGAGCCAGGCACAGTGG - Intergenic
1136585102 16:31179679-31179701 GGACGAGGCGCCCCATACAGCGG + Intergenic
1142316015 16:89345466-89345488 GGACGAAGCCCCAAGCACGGAGG + Intronic
1142810920 17:2395169-2395191 TGACGAGGCGCCAGGGGCAGAGG + Exonic
1144521123 17:15952914-15952936 GGAGACAGCGCCACGGGCAGCGG + Intronic
1152421218 17:80194174-80194196 GGAGGAAGTGGCATGGACAGAGG - Intronic
1152600713 17:81260752-81260774 GGACGGAGCGGGAGGGACAGCGG + Intronic
1160390588 18:78528279-78528301 GGAAGAAGCGCCACGGCAGGTGG + Intergenic
1161129508 19:2579696-2579718 GGACGCACCCCCACGGACAGGGG + Intronic
1161447552 19:4327029-4327051 GGAGGAAGCGCGGCGGCCAGGGG + Intronic
1161744507 19:6047444-6047466 GGACGCAGAGCCACGGACGCTGG + Exonic
1165092319 19:33393624-33393646 GGAGGCAGCACCCCGGACAGTGG + Intronic
1167218361 19:48180441-48180463 GGAGGAAGAGCCAGGCACAGTGG - Intronic
1168327900 19:55547220-55547242 GTGGGAAGCGCCAGGGACAGAGG + Intergenic
929808531 2:45169432-45169454 GAGGGAAGCGCCACGGACTGGGG + Intergenic
936962353 2:118088780-118088802 GGTCGAGGCTCCCCGGACAGTGG + Intronic
937152497 2:119695573-119695595 GGAGGAAGCGCCATGGAGGGAGG + Intergenic
948924842 2:241088771-241088793 GGAGGAGGGGCCACGGGCAGCGG + Exonic
1168750584 20:278874-278896 GGAGGAAGCACCACGTGCAGTGG + Intronic
1174386297 20:50190310-50190332 GGAGGAAGGGCCACGGAGATGGG + Intergenic
1176146507 20:63567917-63567939 GGAGGAAGAGCCTGGGACAGTGG - Intronic
1178710216 21:34910497-34910519 GGACAAAGGGCAACCGACAGTGG - Intronic
1180000573 21:44993619-44993641 GGAGGAAGTCCCAGGGACAGGGG - Intergenic
1183366702 22:37410756-37410778 GGCCGGAGCCCCACGGCCAGCGG + Intronic
961259813 3:125593182-125593204 GGACGAAGCGCCACGGACAGGGG + Intronic
961260043 3:125595155-125595177 GGACGGAGCGCCACGGACAGGGG + Intergenic
961388361 3:126537242-126537264 GGGCCAAGCGCCACAGGCAGAGG + Intronic
961497767 3:127306729-127306751 GGGCGGAGGGCCAGGGACAGAGG - Intergenic
968583031 4:1403663-1403685 GGACGAAGCGCCCGAGACGGAGG - Exonic
978621436 4:110637503-110637525 GGAGGAAGCGACAGGGAAAGTGG + Intronic
987099241 5:14577582-14577604 GGACCCGGCGCCACGGACAGGGG - Intergenic
1001314350 5:170631995-170632017 GGACGATTTGCCACAGACAGGGG + Intronic
1006059621 6:31410666-31410688 GGGCAAAGCCCCAGGGACAGTGG + Exonic
1006072110 6:31505740-31505762 GGGCAAAGCCCCAGGGACAGTGG + Exonic
1021959851 7:25860386-25860408 TGAGGAACCGCCACGGGCAGAGG + Intergenic
1035393497 7:158521062-158521084 GGACTGAGCGCCTCGCACAGAGG - Intronic
1048533257 8:135270026-135270048 GAAAGAAGAGCCACAGACAGAGG - Intergenic
1049747390 8:144268805-144268827 GGAGGCAGCGGCAGGGACAGAGG + Intronic
1057168827 9:92948761-92948783 GGAAGAAGAGCTATGGACAGTGG - Intronic
1060665932 9:125432181-125432203 GGCTGAAGGGCCAGGGACAGGGG - Intergenic
1061821938 9:133233808-133233830 GGACGGAACCCCAGGGACAGAGG - Intergenic
1186349930 X:8731134-8731156 GGAAGAAGTGCCGGGGACAGGGG - Intronic
1187226024 X:17375901-17375923 GGTCGAGGCGCCAGGGCCAGAGG + Exonic
1194920479 X:99758970-99758992 GGACGAAGTGCCAAGCACAGAGG - Intergenic