ID: 961259814

View in Genome Browser
Species Human (GRCh38)
Location 3:125593190-125593212
Sequence CGCCACGGACAGGGGACCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 2, 1: 0, 2: 1, 3: 9, 4: 80}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961259808_961259814 -1 Left 961259808 3:125593168-125593190 CCCATAGCAGGTCAGGACGAAGC 0: 1
1: 0
2: 3
3: 1
4: 59
Right 961259814 3:125593190-125593212 CGCCACGGACAGGGGACCCGCGG 0: 2
1: 0
2: 1
3: 9
4: 80
961259807_961259814 0 Left 961259807 3:125593167-125593189 CCCCATAGCAGGTCAGGACGAAG 0: 1
1: 0
2: 0
3: 5
4: 71
Right 961259814 3:125593190-125593212 CGCCACGGACAGGGGACCCGCGG 0: 2
1: 0
2: 1
3: 9
4: 80
961259800_961259814 12 Left 961259800 3:125593155-125593177 CCCCACCCACAGCCCCATAGCAG 0: 1
1: 0
2: 8
3: 60
4: 566
Right 961259814 3:125593190-125593212 CGCCACGGACAGGGGACCCGCGG 0: 2
1: 0
2: 1
3: 9
4: 80
961259798_961259814 29 Left 961259798 3:125593138-125593160 CCAGGGCCGCGGCGGCGCCCCAC 0: 1
1: 0
2: 4
3: 37
4: 319
Right 961259814 3:125593190-125593212 CGCCACGGACAGGGGACCCGCGG 0: 2
1: 0
2: 1
3: 9
4: 80
961259804_961259814 7 Left 961259804 3:125593160-125593182 CCCACAGCCCCATAGCAGGTCAG 0: 1
1: 0
2: 1
3: 18
4: 204
Right 961259814 3:125593190-125593212 CGCCACGGACAGGGGACCCGCGG 0: 2
1: 0
2: 1
3: 9
4: 80
961259805_961259814 6 Left 961259805 3:125593161-125593183 CCACAGCCCCATAGCAGGTCAGG 0: 1
1: 0
2: 3
3: 24
4: 225
Right 961259814 3:125593190-125593212 CGCCACGGACAGGGGACCCGCGG 0: 2
1: 0
2: 1
3: 9
4: 80
961259799_961259814 23 Left 961259799 3:125593144-125593166 CCGCGGCGGCGCCCCACCCACAG 0: 1
1: 0
2: 1
3: 16
4: 178
Right 961259814 3:125593190-125593212 CGCCACGGACAGGGGACCCGCGG 0: 2
1: 0
2: 1
3: 9
4: 80
961259809_961259814 -2 Left 961259809 3:125593169-125593191 CCATAGCAGGTCAGGACGAAGCG 0: 1
1: 0
2: 0
3: 2
4: 32
Right 961259814 3:125593190-125593212 CGCCACGGACAGGGGACCCGCGG 0: 2
1: 0
2: 1
3: 9
4: 80
961259801_961259814 11 Left 961259801 3:125593156-125593178 CCCACCCACAGCCCCATAGCAGG 0: 1
1: 1
2: 3
3: 34
4: 390
Right 961259814 3:125593190-125593212 CGCCACGGACAGGGGACCCGCGG 0: 2
1: 0
2: 1
3: 9
4: 80
961259803_961259814 10 Left 961259803 3:125593157-125593179 CCACCCACAGCCCCATAGCAGGT 0: 1
1: 0
2: 3
3: 26
4: 324
Right 961259814 3:125593190-125593212 CGCCACGGACAGGGGACCCGCGG 0: 2
1: 0
2: 1
3: 9
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961259814 Original CRISPR CGCCACGGACAGGGGACCCG CGG Intronic
900637862 1:3674683-3674705 GGCCAAGGACAGGGGTCCCCCGG - Intronic
901321558 1:8343312-8343334 AGCCTCGGACAGAGGACCAGCGG + Intronic
902467699 1:16628403-16628425 GGGCACTGTCAGGGGACCCGAGG + Intergenic
902506882 1:16944325-16944347 GGGCACTGTCAGGGGACCCGAGG - Intronic
910678976 1:89843486-89843508 CGCCACGGCCAGGGGAGCGCTGG + Intronic
915021817 1:152786600-152786622 AGCCATGGACAGGGGACCAGAGG + Intronic
1072654307 10:97319671-97319693 CGCCGCAGCCAGGGGCCCCGGGG - Exonic
1072656579 10:97334333-97334355 CGCCGCAGCCAGGGGCCCCGGGG + Exonic
1076869521 10:133186491-133186513 CAGCACGGACAGGGGCCCTGGGG + Exonic
1082792849 11:57359270-57359292 CGGCACTGGCAGGGGACCCGAGG - Intronic
1084946849 11:72643012-72643034 CGCCACTGACTGGGGCCCCCAGG + Intronic
1090965291 11:131592807-131592829 GGCCAGGGAGAGGGGACCTGGGG - Intronic
1093461681 12:19412873-19412895 CGCCAGGGACCGGGCCCCCGGGG - Intronic
1094845820 12:34360960-34360982 CTCCGGGAACAGGGGACCCGGGG - Intergenic
1102026014 12:109714646-109714668 CGCCCCGGACGGGGGCCGCGCGG - Exonic
1103914627 12:124369927-124369949 GGCCCCGGACTGGGGAGCCGGGG - Intronic
1113675285 13:112202705-112202727 CGCCACTCACACGGGACACGCGG + Intergenic
1113868438 13:113543675-113543697 CGCCACGGCCAGGGCAGCCTGGG - Intronic
1119033115 14:71207852-71207874 CGCCACGGTCTGAGGACCCCTGG + Intergenic
1122972497 14:105158118-105158140 GGCCACAGACAGGGGCCCCATGG + Intronic
1125736412 15:41929404-41929426 CGCCACAGACATGGGAACAGAGG + Intronic
1128939583 15:71777456-71777478 CGCCTGGGCCAGGGGGCCCGTGG - Exonic
1129172729 15:73817862-73817884 CGCCAAGGGCAGGGGAGCAGAGG - Intergenic
1129847100 15:78772998-78773020 GGCCAAGGACAGGGGCCCAGGGG + Intronic
1130254802 15:82320892-82320914 GGCCAAGGACAGGGGCCCGGGGG - Intergenic
1130600171 15:85269114-85269136 GGCCAAGGACAGGGGCCCGGGGG + Intergenic
1141714907 16:85721276-85721298 CGCCAAGGCTAGGGGACCCTGGG - Intronic
1143103969 17:4519341-4519363 CACCATGGACAGGGGTCCTGGGG + Intronic
1143346160 17:6250707-6250729 CGCCATGGACAGAGAACCCACGG + Intergenic
1151679490 17:75615987-75616009 GGCCCAGGACTGGGGACCCGAGG + Intergenic
1155050168 18:22139781-22139803 CCCCATGGAAAGGGGCCCCGTGG + Intergenic
1160357956 18:78244534-78244556 CACCAGGGAGAGGGGACCCTTGG + Intergenic
1160941239 19:1621375-1621397 GGCCACTGGCAGGGGACCCTGGG + Intronic
1160969008 19:1759233-1759255 TGCCAGGGACTGGGGACCTGAGG + Intronic
1162473864 19:10888278-10888300 GGCCACGCTCAGGGGACCCCAGG - Intronic
1163364875 19:16870261-16870283 TGCCACGGCCAGGGGAGCCTGGG - Intronic
1166386870 19:42387314-42387336 CGCGCCGGGCTGGGGACCCGCGG - Intronic
925435899 2:3837429-3837451 CGCCAGGCACAGGGGACACTCGG + Intronic
926190095 2:10721741-10721763 CACCGCGGAGCGGGGACCCGAGG + Intronic
929808534 2:45169440-45169462 CGCCACGGACTGGGGAACCGGGG + Intergenic
942413788 2:175737446-175737468 CGCCAGATTCAGGGGACCCGAGG - Intergenic
946767429 2:223053347-223053369 AGCCACCGGCAGGGGTCCCGGGG - Exonic
947117936 2:226791646-226791668 CACCACCGCCAGGGGACCCGCGG + Intronic
947592891 2:231395458-231395480 CGCCAGGGACAGGCGTCCCCGGG + Intergenic
948582271 2:238996531-238996553 CCCCAGGGACAGGGGAGCCAGGG - Intergenic
948914403 2:241025045-241025067 CCCCAGGGACTGGGGACCCCTGG - Intronic
1173750359 20:45470812-45470834 CCCCGCGGCCTGGGGACCCGGGG + Intronic
1177166661 21:17612248-17612270 CGCCGGGGACAGCGGACCCGCGG - Intronic
1179707960 21:43193546-43193568 CTCCATGGCCAGGGGACCTGGGG + Intergenic
1180216304 21:46325274-46325296 CACGGCGGACAGGGGACGCGGGG + Intronic
1183831064 22:40418572-40418594 CACCACGGACGGGGGCCCCGGGG + Exonic
953774460 3:45803603-45803625 GGCCAGAGACAGGGGACCAGTGG - Intergenic
960884915 3:122384075-122384097 CGCCACGCGCTGGAGACCCGCGG - Intergenic
961259814 3:125593190-125593212 CGCCACGGACAGGGGACCCGCGG + Intronic
961260044 3:125595163-125595185 CGCCACGGACAGGGGACCCGCGG + Intergenic
961712028 3:128835132-128835154 CACCACCCACAGGGTACCCGAGG - Intergenic
972979531 4:44678702-44678724 CGGCGCGGACCGGGGCCCCGGGG - Exonic
985111993 4:186555517-186555539 CGCCACGGCCAGGTGACACCTGG + Exonic
992487396 5:77210294-77210316 TGCCGCGCACAGGGGCCCCGCGG + Intergenic
997395954 5:133560045-133560067 TGTCAGGGACAGGGGACCCTGGG + Intronic
998286791 5:140870408-140870430 GGCCACGGCCAGGGTATCCGTGG + Exonic
1002198148 5:177512267-177512289 GGCCACAGGCAGGGGACCCAGGG + Intronic
1003175677 6:3751146-3751168 CGCCCTGGACAGGGGACACTTGG - Intronic
1006092806 6:31637706-31637728 CCCCAGGGACAGGGGACCAGGGG - Exonic
1019407445 7:891135-891157 CGGCTCGGACAGGGGACAAGGGG - Intronic
1019410974 7:906669-906691 GGACATGGACAGGGGACACGGGG + Intronic
1019587347 7:1812763-1812785 GGGCAGGGACAGGGGACCGGTGG + Intergenic
1023642280 7:42271901-42271923 TGCCTGGGACAGGGGACCCTGGG - Intergenic
1023879184 7:44308871-44308893 GGCCATGGACAGAGGCCCCGGGG - Intronic
1025017178 7:55449192-55449214 CGACAGGAGCAGGGGACCCGCGG - Intronic
1025261137 7:57417921-57417943 CACCACGGACAGAGGACAGGTGG - Intergenic
1025607385 7:63049024-63049046 CGCACAGGACAGGGGACCAGGGG - Intergenic
1026067585 7:67089115-67089137 CCCCAGGGACAGGGGACCAGGGG + Intronic
1026709339 7:72723216-72723238 CCCCAGGGACAGGGGACCAGGGG - Intronic
1029570127 7:101363421-101363443 TGCCAGGGGCAGGGGACACGGGG + Intronic
1038488265 8:27951553-27951575 TGCCAGGGTCAGGAGACCCGAGG + Intronic
1049379476 8:142304920-142304942 CCCCACTGACTGGGGTCCCGTGG + Intronic
1049433383 8:142575459-142575481 CCCTGCGGACTGGGGACCCGGGG + Intergenic
1049620759 8:143597463-143597485 AGCCACGGGCCGGGGGCCCGGGG + Exonic
1053630030 9:39928033-39928055 TTCCACGGACAGGGGAGCAGAGG + Intergenic
1053775743 9:41535499-41535521 TTCCACGGACAGGGGAGCAGAGG - Intergenic
1054213857 9:62322669-62322691 TTCCACGGACAGGGGAGCAGAGG - Intergenic
1059135641 9:111803525-111803547 CCCCAGAGACAGGGGACCAGGGG - Intergenic
1061424691 9:130491607-130491629 CGGCACAGACAGGGGAACCCTGG + Intronic
1062520157 9:136954439-136954461 GGCCCAGGACAGGGGACCCGGGG - Intronic
1062520173 9:136954473-136954495 GGCCCGGGACAGGAGACCCGGGG - Intronic
1062520187 9:136954507-136954529 GGCCCGGGACAGGGGACCTGGGG - Intronic
1062520226 9:136954584-136954606 AGCCCAGGACAGGAGACCCGGGG - Intronic
1062520238 9:136954618-136954640 GGCCCGGGACAGGGGACCTGGGG - Intronic
1062712797 9:137985892-137985914 CACCAGGGACAAGGGACACGCGG - Intronic
1185647017 X:1623188-1623210 CGCCACGTCCAGGGGCCCTGGGG - Exonic
1192212573 X:69137174-69137196 AGCCGCGCACGGGGGACCCGGGG - Intergenic