ID: 961262845

View in Genome Browser
Species Human (GRCh38)
Location 3:125616393-125616415
Sequence AGTTATCTGCAGAAGATGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961262845_961262848 22 Left 961262845 3:125616393-125616415 CCTACCATCTTCTGCAGATAACT No data
Right 961262848 3:125616438-125616460 CTTGGCCTGTTACTGTGCCTTGG No data
961262845_961262847 4 Left 961262845 3:125616393-125616415 CCTACCATCTTCTGCAGATAACT No data
Right 961262847 3:125616420-125616442 TCTTTTTGAGAGACAGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961262845 Original CRISPR AGTTATCTGCAGAAGATGGT AGG (reversed) Intergenic
No off target data available for this crispr