ID: 961262847

View in Genome Browser
Species Human (GRCh38)
Location 3:125616420-125616442
Sequence TCTTTTTGAGAGACAGCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961262842_961262847 27 Left 961262842 3:125616370-125616392 CCTCCAGGACTTTGGAGCAAGGC No data
Right 961262847 3:125616420-125616442 TCTTTTTGAGAGACAGCTCTTGG No data
961262845_961262847 4 Left 961262845 3:125616393-125616415 CCTACCATCTTCTGCAGATAACT No data
Right 961262847 3:125616420-125616442 TCTTTTTGAGAGACAGCTCTTGG No data
961262846_961262847 0 Left 961262846 3:125616397-125616419 CCATCTTCTGCAGATAACTACTC 0: 178
1: 192
2: 102
3: 110
4: 247
Right 961262847 3:125616420-125616442 TCTTTTTGAGAGACAGCTCTTGG No data
961262844_961262847 5 Left 961262844 3:125616392-125616414 CCCTACCATCTTCTGCAGATAAC 0: 7
1: 193
2: 178
3: 130
4: 224
Right 961262847 3:125616420-125616442 TCTTTTTGAGAGACAGCTCTTGG No data
961262843_961262847 24 Left 961262843 3:125616373-125616395 CCAGGACTTTGGAGCAAGGCCCT No data
Right 961262847 3:125616420-125616442 TCTTTTTGAGAGACAGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961262847 Original CRISPR TCTTTTTGAGAGACAGCTCT TGG Intergenic
No off target data available for this crispr