ID: 961265052

View in Genome Browser
Species Human (GRCh38)
Location 3:125634927-125634949
Sequence GGGGAGAAGGAAGATGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961265040_961265052 23 Left 961265040 3:125634881-125634903 CCCTGGCTTATGGGTGGGTTTAG No data
Right 961265052 3:125634927-125634949 GGGGAGAAGGAAGATGGGGCAGG No data
961265039_961265052 24 Left 961265039 3:125634880-125634902 CCCCTGGCTTATGGGTGGGTTTA No data
Right 961265052 3:125634927-125634949 GGGGAGAAGGAAGATGGGGCAGG No data
961265041_961265052 22 Left 961265041 3:125634882-125634904 CCTGGCTTATGGGTGGGTTTAGA No data
Right 961265052 3:125634927-125634949 GGGGAGAAGGAAGATGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961265052 Original CRISPR GGGGAGAAGGAAGATGGGGC AGG Intergenic
No off target data available for this crispr