ID: 961271775

View in Genome Browser
Species Human (GRCh38)
Location 3:125694876-125694898
Sequence GCTCGTTTACGACCCAAAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961271768_961271775 0 Left 961271768 3:125694853-125694875 CCGGAGAAACCCCTCCCTTGGCA No data
Right 961271775 3:125694876-125694898 GCTCGTTTACGACCCAAAACGGG No data
961271770_961271775 -10 Left 961271770 3:125694863-125694885 CCCTCCCTTGGCAGCTCGTTTAC No data
Right 961271775 3:125694876-125694898 GCTCGTTTACGACCCAAAACGGG No data
961271765_961271775 30 Left 961271765 3:125694823-125694845 CCAGAGTAGACAAGAGAGGAGGT 0: 13
1: 12
2: 18
3: 32
4: 197
Right 961271775 3:125694876-125694898 GCTCGTTTACGACCCAAAACGGG No data
961271769_961271775 -9 Left 961271769 3:125694862-125694884 CCCCTCCCTTGGCAGCTCGTTTA No data
Right 961271775 3:125694876-125694898 GCTCGTTTACGACCCAAAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961271775 Original CRISPR GCTCGTTTACGACCCAAAAC GGG Intergenic
No off target data available for this crispr