ID: 961272252

View in Genome Browser
Species Human (GRCh38)
Location 3:125698050-125698072
Sequence AAGGGCCTACTGAACTCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961272246_961272252 4 Left 961272246 3:125698023-125698045 CCTTCAAGTGCATGGAGCGTGAT No data
Right 961272252 3:125698050-125698072 AAGGGCCTACTGAACTCTGGGGG No data
961272245_961272252 5 Left 961272245 3:125698022-125698044 CCCTTCAAGTGCATGGAGCGTGA No data
Right 961272252 3:125698050-125698072 AAGGGCCTACTGAACTCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961272252 Original CRISPR AAGGGCCTACTGAACTCTGG GGG Intergenic
No off target data available for this crispr