ID: 961278227

View in Genome Browser
Species Human (GRCh38)
Location 3:125744215-125744237
Sequence GTGTACACACACTTCGATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961278218_961278227 17 Left 961278218 3:125744175-125744197 CCTCCCGCCCACTGATATTAAAA No data
Right 961278227 3:125744215-125744237 GTGTACACACACTTCGATATTGG No data
961278219_961278227 14 Left 961278219 3:125744178-125744200 CCCGCCCACTGATATTAAAAACC No data
Right 961278227 3:125744215-125744237 GTGTACACACACTTCGATATTGG No data
961278222_961278227 9 Left 961278222 3:125744183-125744205 CCACTGATATTAAAAACCATATC No data
Right 961278227 3:125744215-125744237 GTGTACACACACTTCGATATTGG No data
961278221_961278227 10 Left 961278221 3:125744182-125744204 CCCACTGATATTAAAAACCATAT No data
Right 961278227 3:125744215-125744237 GTGTACACACACTTCGATATTGG No data
961278226_961278227 -7 Left 961278226 3:125744199-125744221 CCATATCACAAGGGGCGTGTACA No data
Right 961278227 3:125744215-125744237 GTGTACACACACTTCGATATTGG No data
961278220_961278227 13 Left 961278220 3:125744179-125744201 CCGCCCACTGATATTAAAAACCA No data
Right 961278227 3:125744215-125744237 GTGTACACACACTTCGATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961278227 Original CRISPR GTGTACACACACTTCGATAT TGG Intergenic
No off target data available for this crispr