ID: 961278353

View in Genome Browser
Species Human (GRCh38)
Location 3:125745008-125745030
Sequence CCTTATATCCAGAGGGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961278353_961278357 -9 Left 961278353 3:125745008-125745030 CCTCTCTCCCTCTGGATATAAGG No data
Right 961278357 3:125745022-125745044 GATATAAGGAAGATTTTCACAGG No data
961278353_961278361 19 Left 961278353 3:125745008-125745030 CCTCTCTCCCTCTGGATATAAGG No data
Right 961278361 3:125745050-125745072 GTACACCCCCCTGCGATATTGGG No data
961278353_961278360 18 Left 961278353 3:125745008-125745030 CCTCTCTCCCTCTGGATATAAGG No data
Right 961278360 3:125745049-125745071 TGTACACCCCCCTGCGATATTGG No data
961278353_961278358 -8 Left 961278353 3:125745008-125745030 CCTCTCTCCCTCTGGATATAAGG No data
Right 961278358 3:125745023-125745045 ATATAAGGAAGATTTTCACAGGG No data
961278353_961278359 -7 Left 961278353 3:125745008-125745030 CCTCTCTCCCTCTGGATATAAGG No data
Right 961278359 3:125745024-125745046 TATAAGGAAGATTTTCACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961278353 Original CRISPR CCTTATATCCAGAGGGAGAG AGG (reversed) Intergenic
No off target data available for this crispr