ID: 961281740

View in Genome Browser
Species Human (GRCh38)
Location 3:125769837-125769859
Sequence GCTGTGGGTCAGACACACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961281740_961281748 10 Left 961281740 3:125769837-125769859 CCAGGGTGTGTCTGACCCACAGC No data
Right 961281748 3:125769870-125769892 GGGAGAGAAAAGTCTCTCCTAGG No data
961281740_961281743 -10 Left 961281740 3:125769837-125769859 CCAGGGTGTGTCTGACCCACAGC No data
Right 961281743 3:125769850-125769872 GACCCACAGCTCCTCCTGGAGGG No data
961281740_961281749 17 Left 961281740 3:125769837-125769859 CCAGGGTGTGTCTGACCCACAGC No data
Right 961281749 3:125769877-125769899 AAAAGTCTCTCCTAGGTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961281740 Original CRISPR GCTGTGGGTCAGACACACCC TGG (reversed) Intergenic
No off target data available for this crispr