ID: 961283583

View in Genome Browser
Species Human (GRCh38)
Location 3:125782124-125782146
Sequence GTGCTCTCAATTACTAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961283583_961283585 1 Left 961283583 3:125782124-125782146 CCTGCTCTAGTAATTGAGAGCAC No data
Right 961283585 3:125782148-125782170 GTCTCTAGAATATGATTCCCTGG No data
961283583_961283586 2 Left 961283583 3:125782124-125782146 CCTGCTCTAGTAATTGAGAGCAC No data
Right 961283586 3:125782149-125782171 TCTCTAGAATATGATTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961283583 Original CRISPR GTGCTCTCAATTACTAGAGC AGG (reversed) Intergenic
No off target data available for this crispr