ID: 961284478

View in Genome Browser
Species Human (GRCh38)
Location 3:125790089-125790111
Sequence CCCTTTGATGCCCACTTCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961284478_961284486 -1 Left 961284478 3:125790089-125790111 CCACCGAAGTGGGCATCAAAGGG No data
Right 961284486 3:125790111-125790133 GATGCACTGGGGACATGGGTTGG No data
961284478_961284484 -6 Left 961284478 3:125790089-125790111 CCACCGAAGTGGGCATCAAAGGG No data
Right 961284484 3:125790106-125790128 AAAGGGATGCACTGGGGACATGG No data
961284478_961284488 3 Left 961284478 3:125790089-125790111 CCACCGAAGTGGGCATCAAAGGG No data
Right 961284488 3:125790115-125790137 CACTGGGGACATGGGTTGGAGGG No data
961284478_961284485 -5 Left 961284478 3:125790089-125790111 CCACCGAAGTGGGCATCAAAGGG No data
Right 961284485 3:125790107-125790129 AAGGGATGCACTGGGGACATGGG No data
961284478_961284487 2 Left 961284478 3:125790089-125790111 CCACCGAAGTGGGCATCAAAGGG No data
Right 961284487 3:125790114-125790136 GCACTGGGGACATGGGTTGGAGG No data
961284478_961284491 25 Left 961284478 3:125790089-125790111 CCACCGAAGTGGGCATCAAAGGG No data
Right 961284491 3:125790137-125790159 GTAGTTGAGGCCATATCTGGAGG No data
961284478_961284489 12 Left 961284478 3:125790089-125790111 CCACCGAAGTGGGCATCAAAGGG No data
Right 961284489 3:125790124-125790146 CATGGGTTGGAGGGTAGTTGAGG No data
961284478_961284490 22 Left 961284478 3:125790089-125790111 CCACCGAAGTGGGCATCAAAGGG No data
Right 961284490 3:125790134-125790156 AGGGTAGTTGAGGCCATATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961284478 Original CRISPR CCCTTTGATGCCCACTTCGG TGG (reversed) Intergenic
No off target data available for this crispr