ID: 961285428

View in Genome Browser
Species Human (GRCh38)
Location 3:125798554-125798576
Sequence CTGTGTTTAAGGTGAGAAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961285422_961285428 11 Left 961285422 3:125798520-125798542 CCCAAGGTTTAGAATGATGGGAA No data
Right 961285428 3:125798554-125798576 CTGTGTTTAAGGTGAGAAGCGGG No data
961285423_961285428 10 Left 961285423 3:125798521-125798543 CCAAGGTTTAGAATGATGGGAAG No data
Right 961285428 3:125798554-125798576 CTGTGTTTAAGGTGAGAAGCGGG No data
961285421_961285428 12 Left 961285421 3:125798519-125798541 CCCCAAGGTTTAGAATGATGGGA No data
Right 961285428 3:125798554-125798576 CTGTGTTTAAGGTGAGAAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961285428 Original CRISPR CTGTGTTTAAGGTGAGAAGC GGG Intergenic
No off target data available for this crispr