ID: 961294686

View in Genome Browser
Species Human (GRCh38)
Location 3:125875286-125875308
Sequence CCTCCTGGTGTTATTCATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961294680_961294686 4 Left 961294680 3:125875259-125875281 CCTTTGCAATAGACCTTAATATT No data
Right 961294686 3:125875286-125875308 CCTCCTGGTGTTATTCATTGTGG No data
961294682_961294686 -9 Left 961294682 3:125875272-125875294 CCTTAATATTCCCACCTCCTGGT No data
Right 961294686 3:125875286-125875308 CCTCCTGGTGTTATTCATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961294686 Original CRISPR CCTCCTGGTGTTATTCATTG TGG Intergenic
No off target data available for this crispr