ID: 961300109

View in Genome Browser
Species Human (GRCh38)
Location 3:125916625-125916647
Sequence TGGCGCCCGAGGAGAACGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 6, 2: 3, 3: 1, 4: 40}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961300100_961300109 6 Left 961300100 3:125916596-125916618 CCGGCAACACTGCGGCCCCGCCC No data
Right 961300109 3:125916625-125916647 TGGCGCCCGAGGAGAACGCTGGG 0: 1
1: 6
2: 3
3: 1
4: 40
961300099_961300109 7 Left 961300099 3:125916595-125916617 CCCGGCAACACTGCGGCCCCGCC No data
Right 961300109 3:125916625-125916647 TGGCGCCCGAGGAGAACGCTGGG 0: 1
1: 6
2: 3
3: 1
4: 40
961300102_961300109 -9 Left 961300102 3:125916611-125916633 CCCCGCCCACGTCATGGCGCCCG No data
Right 961300109 3:125916625-125916647 TGGCGCCCGAGGAGAACGCTGGG 0: 1
1: 6
2: 3
3: 1
4: 40
961300103_961300109 -10 Left 961300103 3:125916612-125916634 CCCGCCCACGTCATGGCGCCCGA No data
Right 961300109 3:125916625-125916647 TGGCGCCCGAGGAGAACGCTGGG 0: 1
1: 6
2: 3
3: 1
4: 40
961300097_961300109 18 Left 961300097 3:125916584-125916606 CCGCACGGTCTCCCGGCAACACT No data
Right 961300109 3:125916625-125916647 TGGCGCCCGAGGAGAACGCTGGG 0: 1
1: 6
2: 3
3: 1
4: 40
961300095_961300109 25 Left 961300095 3:125916577-125916599 CCGGCTTCCGCACGGTCTCCCGG No data
Right 961300109 3:125916625-125916647 TGGCGCCCGAGGAGAACGCTGGG 0: 1
1: 6
2: 3
3: 1
4: 40
961300094_961300109 26 Left 961300094 3:125916576-125916598 CCCGGCTTCCGCACGGTCTCCCG No data
Right 961300109 3:125916625-125916647 TGGCGCCCGAGGAGAACGCTGGG 0: 1
1: 6
2: 3
3: 1
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961300109 Original CRISPR TGGCGCCCGAGGAGAACGCT GGG Intergenic