ID: 961300238

View in Genome Browser
Species Human (GRCh38)
Location 3:125917248-125917270
Sequence GGACCTACCATTCTCAGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961300235_961300238 -7 Left 961300235 3:125917232-125917254 CCTCTCGTCTCCCTGGGGACCTA No data
Right 961300238 3:125917248-125917270 GGACCTACCATTCTCAGCACAGG No data
961300226_961300238 24 Left 961300226 3:125917201-125917223 CCTGTGATGGAAGAGACAGAGAA No data
Right 961300238 3:125917248-125917270 GGACCTACCATTCTCAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961300238 Original CRISPR GGACCTACCATTCTCAGCAC AGG Intergenic
No off target data available for this crispr