ID: 961301322

View in Genome Browser
Species Human (GRCh38)
Location 3:125923975-125923997
Sequence CTCGGAGCTGTTTGAGGACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 7, 3: 18, 4: 159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961301322_961301327 -4 Left 961301322 3:125923975-125923997 CCGGGTCCTCAAACAGCTCCGAG 0: 1
1: 0
2: 7
3: 18
4: 159
Right 961301327 3:125923994-125924016 CGAGGGAATGTCCTTCTCAATGG No data
961301322_961301329 10 Left 961301322 3:125923975-125923997 CCGGGTCCTCAAACAGCTCCGAG 0: 1
1: 0
2: 7
3: 18
4: 159
Right 961301329 3:125924008-125924030 TCTCAATGGCCTCTCATTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961301322 Original CRISPR CTCGGAGCTGTTTGAGGACC CGG (reversed) Intergenic
903811040 1:26035281-26035303 CCCGGTGCTGTTTAAGGACCCGG + Exonic
905683629 1:39892828-39892850 CTGGGAGATGATTGATGACCGGG - Intergenic
907123949 1:52033005-52033027 CTCTGCCCTGTTTGAGAACCGGG - Exonic
907480812 1:54744581-54744603 CTGTGAGCTCCTTGAGGACCAGG - Intergenic
907480951 1:54745215-54745237 CTGTGAGCTCCTTGAGGACCAGG + Intergenic
908021984 1:59907558-59907580 CTCTGAGCTTCTTGAGGACAAGG + Intronic
912445501 1:109732991-109733013 CTGGGAGCTGATTGAGAACTGGG + Intronic
912488386 1:110047139-110047161 CTGGGAGCTCTTTGAGGGCAGGG - Intronic
914960369 1:152200694-152200716 ATCCGAGCTGTTGGATGACCAGG + Intergenic
918581128 1:186130950-186130972 CTCAGATCTGTTTTAGGACAAGG + Intronic
921872952 1:220160845-220160867 CTGTGAGCTCTTTGAGGGCCAGG + Intronic
922273927 1:224059009-224059031 CTCGGAGCTCCTTGAGGGCAGGG - Intergenic
922604470 1:226880905-226880927 CTGGGAGGTGTCTGAGGACCAGG - Intronic
922742619 1:228022736-228022758 AGCGGAGCTGCTTGGGGACCAGG - Exonic
923503491 1:234585749-234585771 CTGGGAGCTTCTTGAGGGCCTGG + Intergenic
923542635 1:234899453-234899475 CTAGGAACTGTTTGAGGCCCTGG - Intergenic
1062793809 10:327071-327093 CTCAAAGCTGTTTAAGGACCTGG - Exonic
1063639892 10:7818865-7818887 CTCTGAGCTCTGTGAGTACCGGG + Exonic
1065352146 10:24805231-24805253 CTCAGAGCTGTTTTAGTACAGGG + Intergenic
1065439602 10:25737607-25737629 ATCAGAGCTGTTGGATGACCAGG - Intergenic
1069515046 10:69070622-69070644 GGCAGAGCTGTGTGAGGACCAGG + Intergenic
1072769605 10:98126487-98126509 CTCGGTGCTGTTTGGGGAGGGGG - Intergenic
1075654135 10:124150359-124150381 CTCTGAGCTGTGTGAGGACAGGG - Intergenic
1076291244 10:129347559-129347581 CTGGGAGATGTTTCAGGACATGG + Intergenic
1076521801 10:131085829-131085851 CTCTGAGCTGCTTGAAGACCAGG + Intergenic
1077196805 11:1285111-1285133 CTCGGGGCTGCATGAGGCCCCGG - Intronic
1077333418 11:1993239-1993261 CTGGGAGCTGTATGGGGACAGGG - Intergenic
1077580637 11:3414978-3415000 CTCGGAGCTTCTCGAGGACCTGG + Intergenic
1078405357 11:11065977-11065999 CTGGGAGCTGTCTGAGGCCAGGG + Intergenic
1082606918 11:55248946-55248968 CTTGGAGCACTTTGAGGACTAGG - Intergenic
1082767958 11:57183628-57183650 CTTGGAGCTGCATGAGGTCCTGG - Intronic
1083811329 11:65108437-65108459 CCAGGAGCTGTTTGCGGCCCAGG + Exonic
1088751143 11:112843152-112843174 TTTGGAGATGTTTGAGGATCTGG - Intergenic
1089513680 11:119018079-119018101 TTTGGCGCTATTTGAGGACCTGG - Intronic
1089601017 11:119615185-119615207 CAAGGAGCTCTTTGAGGACAAGG - Intergenic
1089877776 11:121742227-121742249 CTGGGAGCTGATTTAGGAACAGG + Intergenic
1090983244 11:131742083-131742105 CTGGGAGGTGGGTGAGGACCAGG + Intronic
1202816396 11_KI270721v1_random:48420-48442 CTGGGAGCTGTATGGGGACAGGG - Intergenic
1092408230 12:8235400-8235422 CTTGGAGCTGCTCGAGGACCCGG + Intergenic
1092872812 12:12821350-12821372 CTCAGAGCAGTTTGAAGCCCTGG + Exonic
1094440043 12:30465115-30465137 GTCAGAGCTGTTGGATGACCAGG + Intergenic
1095887846 12:47207401-47207423 CCCAGAGCTGTGTGAGGCCCAGG + Intronic
1096013317 12:48242668-48242690 CTCAGAGCTCTTGGATGACCAGG - Intergenic
1096492902 12:52022878-52022900 CTGGGAGCTGTTAGAGGGCAGGG + Exonic
1098033527 12:66279152-66279174 CTGGGAGCTTCTTGAGGACATGG + Intergenic
1103285054 12:119793946-119793968 CTAGGGGCTGTTCGAGAACCTGG - Intronic
1104015073 12:124956695-124956717 GCGGGAGCTGTTTGAGGAGCTGG - Exonic
1104031753 12:125069797-125069819 CCCGGAGCTATTTGAGAACAGGG - Intronic
1104035430 12:125094003-125094025 GTCGGAGCTGAGTAAGGACCTGG + Intronic
1108081804 13:46745058-46745080 CTGTAAGCTTTTTGAGGACCAGG - Intronic
1108481681 13:50878684-50878706 CTAAGGGCTGTTTCAGGACCTGG + Intergenic
1113387346 13:109860974-109860996 CTCTGAGCTCTTTGAGGGCATGG + Intergenic
1114471815 14:22968335-22968357 CTTGGAGCTCTCTCAGGACCAGG - Intronic
1114866911 14:26606705-26606727 CCCAGAGCTGTGTGAGCACCAGG + Intergenic
1117156833 14:52950664-52950686 CTGGGAGGTGGTGGAGGACCCGG + Intronic
1118450996 14:65902026-65902048 CTTGGAGCTGTCTGAGGGCTTGG + Intergenic
1118615496 14:67572141-67572163 CTCGGAGCTCAGTGAGGACATGG - Exonic
1118706350 14:68484000-68484022 CTCAGAGAGGTTTGTGGACCTGG + Intronic
1118758673 14:68864304-68864326 TCCAGTGCTGTTTGAGGACCTGG + Intergenic
1118993329 14:70815205-70815227 ATTGGATCTGTTTGAGGTCCTGG - Intergenic
1121125784 14:91405976-91405998 CTGGGAGCTCTTGGAGGACTGGG - Intronic
1122300836 14:100730239-100730261 CTCTGAGTCGTTTGAGGATCTGG + Intronic
1125967814 15:43888341-43888363 CCCAGAGCTGTTAGAGGCCCTGG + Intronic
1130294660 15:82637009-82637031 CTCAGAGCTGTTCTTGGACCTGG + Intronic
1132525488 16:412098-412120 CACGCAGGTGTCTGAGGACCAGG + Exonic
1133349187 16:5090231-5090253 CTCGGAGCTGCTCAAGGACCCGG + Exonic
1133751253 16:8727381-8727403 CTCGGAGGTGTATGATGACACGG - Intronic
1135738723 16:24955303-24955325 TTCGGAGCTGTTTGGGGATGCGG - Intronic
1136741392 16:32532374-32532396 TTCGGAGCTCTTTGAGGCCAAGG - Intergenic
1139492872 16:67296068-67296090 CTGGAAGCTGTGTGAGGGCCAGG + Intronic
1203028211 16_KI270728v1_random:542860-542882 TTCGGAGCTCTTTGAGGCCAAGG + Intergenic
1203043510 16_KI270728v1_random:791571-791593 TTCGGAGCTCTTTGAGGCCAAGG - Intergenic
1145062630 17:19742586-19742608 CTCGGAGCTGAGTGAGAACATGG - Exonic
1146143421 17:30388822-30388844 CCCGGAGCTGATTGCGGGCCTGG + Intronic
1147796025 17:43043559-43043581 CTCTGAGCAGTGTGAGGACCAGG + Intergenic
1148241268 17:46000799-46000821 GTCTGAGCTGACTGAGGACCAGG - Intronic
1149517902 17:57294292-57294314 CTGGGTGCTGTTTGAGCATCTGG + Intronic
1153615412 18:6929431-6929453 CGGGGACCTGGTTGAGGACCTGG - Intergenic
1158978232 18:62732499-62732521 CTCAGAGCTCTTGGATGACCAGG - Intronic
1160020105 18:75173719-75173741 CTCCGAGCTCTTTGAGGGGCTGG + Intergenic
1160703723 19:519570-519592 CGCGGCGCTGTGTGGGGACCGGG - Exonic
1160817613 19:1043344-1043366 CTCGGAGCTGATTGGAGCCCTGG + Exonic
1163159435 19:15456159-15456181 CTCGGAGCTGCCAGAGCACCAGG - Exonic
1163346963 19:16749467-16749489 CACGGAGGCGTGTGAGGACCTGG - Exonic
1164435052 19:28221820-28221842 CTGGGTGCTGTTTGAGCTCCTGG + Intergenic
1166917377 19:46204561-46204583 CCTAGAGCTGTTTGAGGACAGGG - Intergenic
925609398 2:5691587-5691609 CTCGGTGGTGTTTGGGGACGCGG - Intergenic
926219950 2:10928783-10928805 CTGGCAGCTCTTTGAGGACAGGG + Intergenic
926631947 2:15144551-15144573 ATGGGAGCTGCTTGAGGGCCAGG - Intergenic
928083713 2:28332600-28332622 AGGAGAGCTGTTTGAGGACCAGG + Intronic
930847213 2:55918909-55918931 CTTTGAGCTGCTTGAGGACAGGG - Intronic
931416094 2:62082394-62082416 GTAGGAGCTGCTGGAGGACCTGG + Intronic
931970235 2:67577683-67577705 TTGGGAGATGTTTGAGGACAGGG - Intergenic
932619909 2:73259195-73259217 CCAGAAGCTGTTTGAGGACATGG - Exonic
933906343 2:86897492-86897514 CTCAGAGCTCTTAGATGACCAGG - Intergenic
934852628 2:97711179-97711201 CTCAGAGCTGTCTGAGCACTGGG + Intergenic
935199338 2:100842697-100842719 CTGGGATGTGTTTGAGGAACTGG + Intronic
935776204 2:106474265-106474287 CTCAGAGCTCTTAGATGACCAGG + Intergenic
936365827 2:111854190-111854212 CTCAGAGCTCTTAGATGACCAGG + Intronic
937081462 2:119143166-119143188 CTGGGAACTGTGTGAGGCCCCGG + Intergenic
943590051 2:189785566-189785588 CTCAGAGTTCTTTGAGGACAGGG - Intronic
947413305 2:229866712-229866734 CTCTGACCTCTTTGAGGACAGGG - Intronic
947733847 2:232444903-232444925 CTCGGGGCTGCTGCAGGACCTGG + Intergenic
948701932 2:239766010-239766032 CCTGGAGCTGTTTGAGGGCAGGG + Intronic
948754109 2:240149313-240149335 CTCAGGGCTCTTGGAGGACCAGG - Intergenic
948972783 2:241442068-241442090 CTCGGAGCTATTTGAGGTGAAGG + Intronic
1170916265 20:20628958-20628980 CACGGAGCTCTCTGAGGAGCTGG - Intronic
1173147015 20:40533767-40533789 CTGTGAGCTCTTTGAGGACAAGG + Intergenic
1175412312 20:58778361-58778383 CTCTGAGCAGTTTGAGGAGTAGG + Intergenic
1176524782 21:7857884-7857906 CTCAGAGCTGAGTGAGGCCCAGG - Intergenic
1178658802 21:34487897-34487919 CTCAGAGCTGAGTGAGGCCCAGG - Intergenic
1179319032 21:40272105-40272127 CCAGGAACTGTTTGAGGCCCAGG - Intronic
1182443662 22:30378083-30378105 CTAGGAGCCGTGAGAGGACCTGG - Intronic
1183084028 22:35475466-35475488 CTGGGAGCAATTTGAGGCCCAGG - Intergenic
1183541147 22:38430099-38430121 CAGGGAGCTCTTTGAGAACCAGG - Intronic
1184679886 22:46064836-46064858 CTGGGGGCTGATTGAGGGCCTGG - Intronic
951694159 3:25428342-25428364 ATGCGAGCTGTTTGAGGACTGGG + Exonic
952476664 3:33717867-33717889 CTCGGACCTGGAGGAGGACCTGG - Intronic
952976691 3:38702558-38702580 CAATGAGCTGTTTGAGGACAAGG + Intronic
953741333 3:45541714-45541736 CTTGGAGCTGTGTGAGGAGCCGG - Intronic
957053513 3:75427574-75427596 CTCGGAGCTGCTCGAGGACCCGG + Intergenic
959781026 3:110233576-110233598 CTCTAAGCTGTTTGAAGACAAGG - Intergenic
959918679 3:111847351-111847373 TTCTAAGCTGTATGAGGACCGGG - Intronic
961301322 3:125923975-125923997 CTCGGAGCTGTTTGAGGACCCGG - Intergenic
961540400 3:127595516-127595538 CTAGGAGCTGTTAGTGGCCCTGG - Intronic
961887166 3:130103888-130103910 CTCGGAGCTGCTCGAGGACCCGG + Intronic
962351326 3:134658455-134658477 CTTGAAGCTCTTTGAGGGCCAGG + Intronic
968667815 4:1830747-1830769 CTGGTGGCTGTTTGAGGCCCAGG + Intronic
968706586 4:2081148-2081170 CTCTGAGCTGTCTGAGTGCCAGG + Intronic
968996304 4:3947889-3947911 CTCGGAGCTGCTCGAGGACCCGG + Intergenic
969757679 4:9160802-9160824 CTCGGAGCTGCTCGAGGACCCGG - Intergenic
969817656 4:9698317-9698339 CTCGGAGCTGCTCGAGGACCCGG - Intergenic
975166699 4:71186541-71186563 CCCGGAGCTGGCGGAGGACCCGG - Intergenic
978393283 4:108250370-108250392 CTGGGAGCAGTTTGGGAACCAGG + Intergenic
982098984 4:151950044-151950066 CTCAGAGCTCCTTCAGGACCTGG + Intergenic
985646374 5:1086583-1086605 GTCGGAGCTGTTTTAGGAGCAGG - Intronic
992462858 5:76978580-76978602 CTCAGAGCTCTTGGATGACCAGG - Intronic
998079256 5:139261053-139261075 CTGGGAGCTCCTTGAGGACAAGG + Intronic
998352785 5:141512198-141512220 CTCGAAGCAGGTTTAGGACCAGG + Exonic
999127297 5:149255017-149255039 CTCTGAGCTCCTTGAGGACAGGG - Intronic
999226249 5:150027137-150027159 GTGGGAGCTGTTTGAGGGTCTGG + Intronic
999729834 5:154468366-154468388 CTAGAAGCGTTTTGAGGACCTGG - Intergenic
999795824 5:154988974-154988996 CTAGGTCCTGTTTGAGGTCCTGG + Intergenic
1001704204 5:173730091-173730113 CTCTGAGCTCCTTGAGGACAGGG - Intergenic
1002109090 5:176896067-176896089 CTCTGAGCTGTCTGAGGGCCCGG + Exonic
1002123357 5:177022804-177022826 CTCGGAGTTGCTGGAGGGCCAGG + Exonic
1002636773 5:180612535-180612557 CTCGGAGCTGGTGGAGATCCTGG - Exonic
1004162551 6:13227800-13227822 CTCAGAGCTGTTTAAAGACAAGG - Exonic
1005304790 6:24503388-24503410 CTATGGGCTGCTTGAGGACCAGG - Exonic
1007256943 6:40536179-40536201 CTGGGAGCTGCTGGAGCACCTGG - Intronic
1008763070 6:54877853-54877875 ATCGGAGGTGTTTGAAGACCTGG + Intronic
1013634718 6:112018224-112018246 CTTGGTGCTGATTGAGGAGCAGG + Intergenic
1019330993 7:460722-460744 CTCAGAGCGATGTGAGGACCTGG - Intergenic
1019933486 7:4239053-4239075 CTCTGAGCCGTCTGAGGGCCAGG + Intronic
1020320585 7:6936300-6936322 CTCGGAGCTTCTTGAGGACCCGG + Intergenic
1025595443 7:62918338-62918360 CTGGGAGCTCATTGAGGCCCAGG + Intergenic
1031964547 7:128018246-128018268 ATCGGAGCTGTATGGGGTCCAGG + Intronic
1033611220 7:142964580-142964602 CTGGGAGCTGTCTCAGGAGCAGG + Intergenic
1036380943 8:8236128-8236150 CTTGGAGCTGCTCGAGGACTCGG - Intergenic
1036848637 8:12186499-12186521 CTCGGAGCTGCTCGAGGACCCGG + Exonic
1036869999 8:12428780-12428802 CTCGGAGCTGCTCGAGGATCCGG + Exonic
1041201354 8:55453846-55453868 CACGGACCTGTTTGATGAGCTGG - Intronic
1042583040 8:70303633-70303655 CTGTGAGCTGTTTGAGGGCAAGG + Intronic
1046469752 8:114655482-114655504 CTAGGAGCTGTTGCAGGAGCGGG + Intergenic
1051813380 9:21076167-21076189 CTAGGAGCTCTTTGGGCACCTGG - Intergenic
1052543217 9:29837909-29837931 ATCAGAGCTCTTTGATGACCAGG + Intergenic
1055256663 9:74379904-74379926 CTCTGATCTCTTTGAGCACCAGG - Intergenic
1057767652 9:97936363-97936385 CTCCTAGCTTTTTGAGGACAAGG + Intronic
1060266053 9:122112011-122112033 CTCTGTGCTGTTTGGGCACCCGG - Intergenic
1060460514 9:123849531-123849553 ATCAGAGCTGTTGGATGACCAGG - Intronic
1061198617 9:129122955-129122977 CTCGGAGCTCTTTGGTAACCTGG + Intronic
1061568073 9:131457505-131457527 CTCTGAGCTGGTTGGTGACCTGG + Intronic
1062064006 9:134516416-134516438 CCTGGAGCTGTTTGAGGACTTGG - Intergenic
1062139065 9:134945475-134945497 CTCCATGCTCTTTGAGGACCAGG - Intergenic
1062354537 9:136155533-136155555 AACGGAGCAGTTTGAGGAGCAGG - Intergenic
1186283203 X:8016753-8016775 TTCAGAGCTGTTTCATGACCTGG + Intergenic
1188432002 X:30114123-30114145 CTGGGAGCTGTTTGTTGACCTGG + Intergenic
1189379464 X:40491540-40491562 CTTGGGGCTGTTTGATGACACGG - Intergenic
1194250527 X:91569419-91569441 CTAGGAGCTGTTTCAGGTGCTGG - Intergenic
1197976350 X:132169842-132169864 CCCGGAGCTGTTTGAGAAGGTGG + Intergenic
1198674082 X:139113299-139113321 CTTGGAGCTGTTGGAGAACCTGG - Intronic
1199890550 X:152074836-152074858 CTCTGAGGTGTTTGGGGATCCGG + Intergenic
1200569476 Y:4810668-4810690 CTAGGAGCTGTTTCAGGTGCTGG - Intergenic
1201440964 Y:14007822-14007844 TTTGGAGCTGTTTAATGACCTGG + Intergenic
1201443607 Y:14034886-14034908 TTTGGAGCTGTTTAATGACCTGG - Intergenic