ID: 961302066

View in Genome Browser
Species Human (GRCh38)
Location 3:125928493-125928515
Sequence AGGCCAGGCCAGGATCAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 2, 1: 0, 2: 4, 3: 27, 4: 283}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961302058_961302066 16 Left 961302058 3:125928454-125928476 CCAAACACTGCCATCCTGAAACA 0: 2
1: 1
2: 11
3: 19
4: 227
Right 961302066 3:125928493-125928515 AGGCCAGGCCAGGATCAGATGGG 0: 2
1: 0
2: 4
3: 27
4: 283
961302059_961302066 6 Left 961302059 3:125928464-125928486 CCATCCTGAAACACATGTGCTCT 0: 1
1: 4
2: 3
3: 24
4: 236
Right 961302066 3:125928493-125928515 AGGCCAGGCCAGGATCAGATGGG 0: 2
1: 0
2: 4
3: 27
4: 283
961302060_961302066 2 Left 961302060 3:125928468-125928490 CCTGAAACACATGTGCTCTGTTT 0: 1
1: 4
2: 1
3: 26
4: 223
Right 961302066 3:125928493-125928515 AGGCCAGGCCAGGATCAGATGGG 0: 2
1: 0
2: 4
3: 27
4: 283
961302056_961302066 18 Left 961302056 3:125928452-125928474 CCCCAAACACTGCCATCCTGAAA 0: 2
1: 1
2: 12
3: 23
4: 229
Right 961302066 3:125928493-125928515 AGGCCAGGCCAGGATCAGATGGG 0: 2
1: 0
2: 4
3: 27
4: 283
961302057_961302066 17 Left 961302057 3:125928453-125928475 CCCAAACACTGCCATCCTGAAAC 0: 2
1: 1
2: 13
3: 22
4: 217
Right 961302066 3:125928493-125928515 AGGCCAGGCCAGGATCAGATGGG 0: 2
1: 0
2: 4
3: 27
4: 283
961302055_961302066 23 Left 961302055 3:125928447-125928469 CCTGTCCCCAAACACTGCCATCC 0: 2
1: 12
2: 1
3: 40
4: 307
Right 961302066 3:125928493-125928515 AGGCCAGGCCAGGATCAGATGGG 0: 2
1: 0
2: 4
3: 27
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961302066 Original CRISPR AGGCCAGGCCAGGATCAGAT GGG Intergenic
900129210 1:1080502-1080524 AGGCCAGGCCAGACACAGACAGG - Intergenic
901034833 1:6330254-6330276 TGGCCAGGCCACCAGCAGATGGG + Intronic
902415202 1:16234490-16234512 TGTCCAGCCCAGGATCTGATGGG - Intronic
902736606 1:18405456-18405478 AGGCCTGGCCAGTCTCAGAGGGG - Intergenic
904086827 1:27915191-27915213 AGGCCAAGCCTGGATGAGACTGG - Intergenic
904473310 1:30748866-30748888 TGGCCAGGCCAGGATCCCACAGG - Intronic
904662468 1:32095508-32095530 TGGCCAGGGAAGGATGAGATGGG + Intronic
904840353 1:33368436-33368458 AGGAGAGGCCGGGATCAGCTAGG - Intronic
905631107 1:39519015-39519037 AAGCCAGGCCTGGCTCAGAGGGG + Intronic
905644774 1:39617456-39617478 AGGCCAGGCCGGGAGCAGCAAGG - Intergenic
905666652 1:39767156-39767178 AAGCCAGGCCTGGCTCAGAGGGG - Intronic
905869182 1:41393418-41393440 AGGCCAGGGCAGGAGCAGGCAGG + Intergenic
905881876 1:41469178-41469200 GGTCCAGGCCAGGGGCAGATGGG + Intergenic
905938097 1:41840720-41840742 TGGCACGGCCAGGATCTGATGGG - Intronic
906213477 1:44025254-44025276 AGGCCAGCCCAGGATCTTGTGGG + Intronic
906481012 1:46198722-46198744 AGGGCACGCCAGGGTCAGAGGGG + Intronic
906496816 1:46310560-46310582 AGGCCAAGGCAGGATCACTTAGG - Intronic
906850270 1:49241203-49241225 GGGGCAGGACATGATCAGATTGG - Intronic
907307162 1:53519849-53519871 AGTCAAGGCCAGGAGCAGAATGG + Intronic
907318328 1:53586905-53586927 AGGCCAGGCCAGGCACTGAAGGG + Intronic
910869278 1:91817639-91817661 AGGCCAGGGCAGTTTAAGATAGG - Intronic
912657872 1:111503892-111503914 AGGACAGTGCAGGATCAGGTGGG + Intronic
912921168 1:113868719-113868741 AGGACAGGACAGGGGCAGATGGG + Intronic
913481934 1:119296944-119296966 AGGACAGGATAGGATCGGATCGG - Intergenic
913481935 1:119296949-119296971 AGGACAGGACAGGATAGGATCGG - Intergenic
913481979 1:119297144-119297166 AGGACAGGGTAGGATAAGATAGG - Intergenic
914885623 1:151582033-151582055 AAGCCAGGCCTTCATCAGATTGG + Exonic
915086810 1:153394700-153394722 AGGCCAGGCCCGGAGCAGCAGGG + Intergenic
915108615 1:153549246-153549268 AGGGGAGGCCAGTCTCAGATTGG - Exonic
915283121 1:154836312-154836334 AGGCCAGTCGAGTATCAGGTGGG - Intronic
916059688 1:161089810-161089832 AGGCCAGGCCAGGATGAAAGGGG + Intergenic
917509503 1:175658525-175658547 AGGCCTGGCCAGGAACACACAGG + Intronic
918758025 1:188361446-188361468 ATGCCAGGACATGATCTGATTGG - Intergenic
922215465 1:223516385-223516407 AGGGCAGGCCAGGGTGGGATTGG - Intergenic
922751593 1:228072697-228072719 AGGCCAGTCCAGGGTCAGGAAGG + Intergenic
923329506 1:232909578-232909600 AGACCACGGCAGGATTAGATGGG + Intergenic
923788800 1:237093515-237093537 AGCCCAGGCCAGGGTCAGCCTGG - Intronic
1065856801 10:29837869-29837891 AGGCAAGGCCAGGGTCACAGCGG + Intergenic
1067213306 10:44279710-44279732 AGGGCATGGCAGGATCAGAGAGG - Intergenic
1067472113 10:46545008-46545030 AGGCCAGGCCAGAATGAAAAAGG + Intergenic
1068753771 10:60626897-60626919 AGACCAGGACAGGAACAGAATGG + Intronic
1069375269 10:67786948-67786970 AGGCCAGGGCTTGATCTGATTGG - Intergenic
1069561640 10:69435103-69435125 AGGGCAAGCCAGGAACAGAGCGG + Intergenic
1069771726 10:70904770-70904792 AGGAATGGCCAGGTTCAGATTGG + Intergenic
1070579952 10:77711564-77711586 AGGCCAGGCCGGGCTCAGCGTGG - Intergenic
1071301988 10:84262637-84262659 AGGCCAGGGCAGGAGAAGTTAGG - Intergenic
1071928563 10:90439505-90439527 TGGCCAGGTCAGGATCAGTAGGG - Intergenic
1073499609 10:103923993-103924015 AGGCCAGGCCAGGAGGAACTTGG - Intergenic
1074730164 10:116363328-116363350 AGTCCAGGCCAAGAGCAGATAGG - Intronic
1074848670 10:117421151-117421173 AGAGCAGGCTAGGATCTGATGGG + Intergenic
1075699070 10:124456869-124456891 GGGCCAGGCCAGGCTCAGTGTGG - Intergenic
1076408474 10:130229791-130229813 AGGCCAGGCCAGAGTCAGGTTGG + Intergenic
1076599827 10:131650351-131650373 AGGCCGGGCCAGGAACTGACTGG + Intergenic
1077324402 11:1957512-1957534 AGGCCAGGCCAGGCTAGGAGAGG - Intronic
1077579917 11:3410429-3410451 AGGCCGGGCCGGGATCAGATGGG - Intergenic
1078856057 11:15207060-15207082 GGGCCAGGCCAGGATGGGGTTGG + Intronic
1079028803 11:16969797-16969819 AGGCCAGGTCAGGATTACACTGG + Intronic
1079671753 11:23179500-23179522 ATGCCAGAACAGGAACAGATTGG - Intergenic
1080823253 11:35826747-35826769 AGGGCAGGCCAGGCTAAGAGTGG - Intergenic
1081569031 11:44278321-44278343 AGGGCAGGCCAGGAGCTGAGAGG - Intronic
1083638223 11:64131733-64131755 ATGCCAGGCCCTGTTCAGATGGG + Intronic
1083816721 11:65136802-65136824 AGGCCAGGGCAAGATCGCATTGG + Intergenic
1084236829 11:67793273-67793295 AGGCCGGGCTGGGATCAGATGGG - Intergenic
1084973308 11:72782813-72782835 AGGCCAGGCCAGGGTGAGTGTGG + Intronic
1085745706 11:79112560-79112582 AGGTCAGGCCAGGGTCAGGCTGG + Intronic
1088113328 11:106287115-106287137 AGGCTAGGCAAGGAGCAGATGGG - Intergenic
1088159815 11:106855336-106855358 TGGCCTGGCCAGGATCGGTTTGG - Intronic
1089367802 11:117931779-117931801 GGGCCAGGCCAGGGTCAGTGGGG - Intergenic
1089582165 11:119488405-119488427 AGTTGGGGCCAGGATCAGATGGG - Intergenic
1091305027 11:134531331-134531353 AGGCCAGGGCAGGACCAGGCAGG - Intergenic
1202807383 11_KI270721v1_random:12689-12711 AGGCCAGGCCAGGCTAGGAGAGG - Intergenic
1092407716 12:8232587-8232609 AGGCTGGGCCGGGATCAGATGGG - Intergenic
1096193689 12:49635502-49635524 AGGAAAGTCCAGGATGAGATGGG - Intronic
1096653223 12:53072452-53072474 AGGCCAGGCCAGGAGCAAGGGGG + Intronic
1101608284 12:106267073-106267095 AGGCAAGGGCAGGATGAAATAGG - Intronic
1102119502 12:110429485-110429507 AGGGCGTGCCAGGATGAGATGGG + Intergenic
1102894532 12:116588134-116588156 TAGCCAGGCCTGGAGCAGATGGG - Intergenic
1103215141 12:119195887-119195909 AGGCGAGGCCTCGATCAGACAGG - Intronic
1105278145 13:18948162-18948184 AGGCCAGGGCTGGATCCCATGGG - Intergenic
1105284967 13:18996129-18996151 AGGCCAGGTCAGGTGCAGAAGGG + Intergenic
1108458850 13:50644789-50644811 AGGCCTGGGCAGGACCAGACTGG - Intronic
1109521201 13:63512302-63512324 AGGGCAAGCCAGGCTCAGAGGGG - Intergenic
1110367356 13:74701792-74701814 AGGGCAGGGCAGGATAGGATAGG - Intergenic
1111800190 13:92971731-92971753 ATTCCAGGCCCGGCTCAGATGGG + Intergenic
1114646491 14:24259251-24259273 TGCCCAGGACAGGATGAGATAGG + Intronic
1114777097 14:25496534-25496556 AGTCAAAGCCAGGACCAGATAGG + Intergenic
1117474867 14:56084007-56084029 AGGCTAGGCCAGCAGCAGGTAGG - Intergenic
1118347555 14:64950999-64951021 AGGCAAGGCGAGGGCCAGATGGG - Exonic
1118753625 14:68823143-68823165 GGGTCAGCCCAGGGTCAGATGGG + Intergenic
1119390753 14:74289633-74289655 ACGCCTGGCCTGGGTCAGATGGG + Intronic
1119553610 14:75536347-75536369 AGGCCAGGCAAAGGTCAGAAAGG + Intronic
1119844985 14:77822536-77822558 AGTCCTGGCCTGGCTCAGATGGG - Intronic
1119849795 14:77859046-77859068 AAGACAGGCCAGGACCAGAGAGG - Intronic
1120131311 14:80810751-80810773 AGAAAAGCCCAGGATCAGATGGG - Intronic
1120151886 14:81045358-81045380 AGAAAAGCCCAGGATCAGATGGG - Intronic
1122145142 14:99684379-99684401 AGGCCAGGCCAGGGTCGGGCCGG - Exonic
1122930980 14:104933010-104933032 AGCCCAGGCCGGGGTCAGAGGGG - Exonic
1124629703 15:31329282-31329304 GGGCCAGGCTAGGCTCAGCTCGG + Intronic
1125867861 15:43070456-43070478 AGTCCAGGCCAGGATCAAAGTGG + Intronic
1126061754 15:44789608-44789630 AGGCCATGCTAGGATAAGAAAGG - Intergenic
1128345356 15:66849586-66849608 AGGCCTGGCCTGGGTCAGGTCGG + Intergenic
1128780906 15:70358111-70358133 TGGGCAGGGCAGGATAAGATGGG - Intergenic
1128913397 15:71537403-71537425 GAGCCAGCCCAGTATCAGATGGG - Intronic
1129177288 15:73849144-73849166 AGGCCAGGCATTGTTCAGATCGG + Intergenic
1131943393 15:97592436-97592458 AGGGCAGGCCAGGAGCAGGCAGG - Intergenic
1132515645 16:364551-364573 AGGCCAGGCCAGACTGAGGTGGG - Intergenic
1133348429 16:5085712-5085734 AGGCCGGGCCGGGATCAGATGGG - Exonic
1133758530 16:8780218-8780240 AGGCCAGGCCCGGGTCGCATGGG + Intronic
1134247660 16:12552021-12552043 TGGCAAGTCCAGGCTCAGATGGG + Intronic
1134792006 16:16997555-16997577 ATTCCAGGAAAGGATCAGATGGG + Intergenic
1136125345 16:28175398-28175420 AGGCCAGGCCAGGAAGGGTTGGG - Intronic
1136862987 16:33713757-33713779 AGGCCAGGCCAGGATAGAACAGG - Intergenic
1137725424 16:50653552-50653574 AGGCCAGGCCCGGCTCACCTTGG + Intergenic
1139367776 16:66444269-66444291 AGGAAAGGGAAGGATCAGATTGG - Intronic
1139592687 16:67942299-67942321 AGGCAGGCCCAGGATCAGCTTGG + Intronic
1140476850 16:75243273-75243295 AAGAAAGGCCAGGATCAGCTGGG - Intronic
1140994512 16:80244325-80244347 AGGGCAGGCCAGGATGACAATGG + Intergenic
1141226055 16:82116455-82116477 GAGACAGGCCAGGATCACATAGG + Intergenic
1141626031 16:85261558-85261580 AGGCCAGGACAGGCTCAGAGTGG + Intergenic
1141962946 16:87421513-87421535 AGGCCTGCCCAGGATCAGGCTGG + Intronic
1142348664 16:89570007-89570029 GGGCCAGGGCAGGAGCAGAGAGG - Intergenic
1142509618 17:385699-385721 AGGCGAGGCCAGGTGCAGAGGGG + Intronic
1142624895 17:1185754-1185776 AGGCCACCCCAGGATCTGACAGG - Intronic
1143352432 17:6298518-6298540 AGGCGTGGCCATGATCAGATGGG + Intergenic
1144062920 17:11599165-11599187 AGGCCAGGCCAGAATGAGAATGG + Intronic
1144396520 17:14849199-14849221 AGGCCAGGCAAGGAACAGAGAGG + Intergenic
1146622743 17:34412308-34412330 AGGCCAGCCAAGGAGCATATTGG + Intergenic
1147586898 17:41658081-41658103 AGGGCAGGTCTGGATCAGACTGG - Intergenic
1150833083 17:68541051-68541073 AGCCCAGGGCAGGATCAGGGAGG - Intronic
1151236646 17:72725036-72725058 AAGCCAGACCAGGATCAAACAGG - Intronic
1151349308 17:73522308-73522330 CAGCCAGGCCAGGATGAGGTGGG - Intronic
1152131130 17:78477087-78477109 AAGCCAGGACTGGACCAGATAGG - Intronic
1152930931 17:83109549-83109571 AGGCCAGGCCAGGCCCGGAGAGG - Intergenic
1153946611 18:10023580-10023602 AGGCCAGGGCAGGAGCAAAAAGG + Intergenic
1154501902 18:15001431-15001453 AGGCCAGGCCAGAATCCGGCTGG + Intergenic
1157471222 18:47990655-47990677 AGAGGAGGCCAGGATCAGACTGG + Intergenic
1157859561 18:51128634-51128656 AGTCCAGGGGAGGATCTGATTGG + Intergenic
1158126878 18:54109851-54109873 AGGCCAGTACAGGTTCAGTTTGG + Intergenic
1158705292 18:59787094-59787116 TGGCCTGGCAAGGATCACATGGG - Intergenic
1158706545 18:59797456-59797478 AGGCCAGTGTAGGATCAAATGGG + Intergenic
1160463915 18:79059677-79059699 AGGCCAGCCCAGGGTCAGCCTGG + Intergenic
1160702507 19:514790-514812 AGGCCTGGCCGGGAACTGATGGG + Intronic
1161005149 19:1931946-1931968 AAGCCAGACAAGGCTCAGATGGG + Intergenic
1163572353 19:18089979-18090001 GGCCCAGGCCAGGGTCAGCTGGG + Intronic
1163618374 19:18342791-18342813 CGGCCAGGCCAGGGGCAGACTGG + Intronic
1164966761 19:32491426-32491448 AGGCCAAGGCAGGATCGGTTGGG + Intergenic
1166007899 19:39919698-39919720 AGTCAAGGCCAGGATCAGAAAGG + Intronic
1166256140 19:41606276-41606298 AGTCCTGGCCAGGACCACATGGG - Intronic
1166779538 19:45333910-45333932 AATCCAGGCCGGGCTCAGATGGG + Intronic
1167291152 19:48625891-48625913 AGGCCAGACCAGGAGCTGACCGG + Exonic
1167493119 19:49803050-49803072 AGCCCAGGCCAGGTGCAGACAGG + Intronic
1167870956 19:52369875-52369897 AGGCCAGGCCCGGGTGGGATTGG - Intergenic
1168240746 19:55087712-55087734 AGACCAGGGCCGGAGCAGATTGG - Exonic
925067142 2:937469-937491 AGTCCAGGCCTGGCTCAGCTAGG + Intergenic
925165781 2:1714801-1714823 AAACCAGGCCTGGGTCAGATGGG + Intronic
925988132 2:9232212-9232234 AGGACAGGCATGGATGAGATGGG - Intronic
927940967 2:27102526-27102548 CAGCCAGGCCAGGAGCAGCTCGG - Exonic
928377745 2:30789846-30789868 AGGACAGGCTAGGCTCAGAGGGG + Intronic
930015558 2:46968170-46968192 AGGCTGTGCCAGGATCAGCTTGG + Intronic
933536806 2:83585578-83585600 AGTTCAGGCCATGATCAGAAGGG + Intergenic
934476831 2:94599256-94599278 AGGAGAGGACAGGAACAGATGGG - Intronic
934735043 2:96685808-96685830 GGGCCAGGCTAGCAGCAGATGGG + Intergenic
935586192 2:104802068-104802090 AGGCCAAGCCAGGGTCGGAATGG - Intergenic
936249945 2:110860535-110860557 AGCCCAGGCCAGGCTCAGAGTGG - Intronic
937237915 2:120441899-120441921 AGGGCAGGCAGGGGTCAGATGGG - Intergenic
937315028 2:120926673-120926695 AGGGCAGGCCAAGTTCAGACAGG + Intronic
937871254 2:126787885-126787907 GAGGCAGGCCAGGAGCAGATGGG - Intergenic
938530942 2:132185330-132185352 AGGCCAGGCGATGGTCAGGTAGG - Intronic
940901593 2:159131091-159131113 AGGCCACGGCAGGAAGAGATGGG - Intronic
945159249 2:206872393-206872415 AGGACAGGACTGGATCACATGGG - Intergenic
946202381 2:218078051-218078073 AGGACAGGCCTGGCTCAGAGTGG - Intronic
947701592 2:232239065-232239087 TGGGCAGGTCAGGACCAGATTGG - Intronic
947810930 2:233003540-233003562 AGGCCAGCCCAGGAACAAATGGG - Intronic
947964464 2:234267770-234267792 AGTCAAGGCCAGGTTCAGAAAGG + Intergenic
948421917 2:237865098-237865120 AGGCCAGGCAAGGATAGGAGTGG + Intronic
948882061 2:240864059-240864081 AGGCCAGGCCATTGTCTGATTGG - Intergenic
1168765867 20:381347-381369 AGCCCAGGCCCGGATCAAAAGGG - Intronic
1169171283 20:3467914-3467936 AGGCCAGGCTAGATTCAGAGTGG + Intergenic
1172442531 20:34976345-34976367 AGGCCAGACCAGGCTCACACGGG - Intronic
1174134019 20:48366490-48366512 AAGCCAGGCCTGGCTCAGATGGG - Intergenic
1174387008 20:50193287-50193309 AGGCCAGGCCAGGTGGAGAGAGG + Intergenic
1175740693 20:61417857-61417879 GGGCCAGGCCAGGAGCAGCAGGG + Intronic
1176025203 20:62982143-62982165 AGGCCTCGCCAGCCTCAGATGGG - Intergenic
1176106416 20:63391710-63391732 AGGCCAGGCCAGGATCCATAGGG - Intergenic
1176182054 20:63754225-63754247 AGGACAGGCCAGGAAGAGCTTGG - Intronic
1176892641 21:14336844-14336866 AGTCTAGGCCAGGATGAGAAGGG + Intergenic
1179807051 21:43846086-43846108 AGGCCAACCAAGGATCAGATTGG + Intergenic
1182053079 22:27328091-27328113 AGGACAGGTCAGGAGCAGGTTGG + Intergenic
1182112031 22:27730877-27730899 TGGCCAGGCCAGTGTCACATGGG - Intergenic
1182687648 22:32133273-32133295 AGGCCAGGCAAGGCTGAGGTGGG - Intergenic
1182713459 22:32336778-32336800 AAGCCAGGGCAGGGTCAGAATGG + Intergenic
1182766272 22:32760290-32760312 AGGGCAGGGCAGGAGCAGAATGG - Intronic
1184400713 22:44272347-44272369 AAGCCAGGGCAGGGTCAGAATGG + Intronic
1185065822 22:48631226-48631248 AGGCCAGGCCAGGGTGAAGTGGG + Intronic
1185227592 22:49661665-49661687 ATGCCAGGCCAGGAGCTGCTGGG + Intergenic
1185233786 22:49699588-49699610 AGCCCAGGCCAGGCTCAGCGGGG + Intergenic
1185397864 22:50601583-50601605 CGGGCAGGCCTGGCTCAGATGGG + Intronic
949897180 3:8776611-8776633 AGTTCAGGCTAGGTTCAGATAGG + Intronic
950175849 3:10873619-10873641 AGGACAGGACAGGATAGGATAGG - Intronic
950872539 3:16242187-16242209 AGGCCAGCCCAGGCTCAGGGAGG + Intergenic
951848630 3:27113219-27113241 AGGCCAGGTCAAGATCAGCCTGG + Intronic
951982478 3:28580915-28580937 AGACAAAGCCAGGATCAAATTGG - Intergenic
953931099 3:47006090-47006112 GGGCCAGGACAAGATCAGGTCGG + Intronic
954440310 3:50518163-50518185 AGGCCACACCAGGATGAGCTGGG - Intergenic
955317851 3:57953633-57953655 AGGCCAGGCCAGGCCCTGAGTGG + Intergenic
957052786 3:75423041-75423063 AGGCCGGGCTGGGATCATATGGG - Intergenic
960940287 3:122928871-122928893 AGGCCTGGCCAGGATGAGCTGGG - Intronic
961302066 3:125928493-125928515 AGGCCAGGCCAGGATCAGATGGG + Intergenic
961886409 3:130099338-130099360 AGGCTGGGCTGGGATCAGATGGG - Intronic
962278200 3:134031044-134031066 AGGCCAGACCAGGCCCAGAAAGG - Intronic
962468967 3:135688290-135688312 AGTCCATGCCAGGTTCAGAGTGG + Intergenic
963158718 3:142127986-142128008 AGGCCAGTTCAGGATCAGCCTGG + Intronic
963193023 3:142494722-142494744 AGGCCAGGACTTGATCAGAAAGG + Intronic
966268863 3:178081083-178081105 TGGCCAGGCCAAAATCATATGGG + Intergenic
966882425 3:184357893-184357915 AGGCCAGGCCAAGGTCAGGGCGG - Intronic
967887447 3:194342649-194342671 AGGCCTGGCCAGGAGCAGGAGGG + Exonic
968995577 4:3943352-3943374 AGGCCAGGCCAGGATCAGATGGG - Intergenic
969348032 4:6581427-6581449 AGCCCAGGCCAGGCACACATGGG - Intronic
969818377 4:9702894-9702916 AGGCCGGGCCAGGATCACATGGG + Intergenic
971847883 4:31944413-31944435 AGGCCAGACCAGGTTAACATAGG - Intergenic
975329685 4:73099594-73099616 AGGGCATGCCAGGATGAGATGGG - Intronic
979700475 4:123660773-123660795 AGGACAGGACAGGATAGGATAGG - Intergenic
980132170 4:128826991-128827013 AAGACAGGCCAGGATAAGATAGG - Intronic
980798170 4:137711997-137712019 ACTCCAGACCAGGATCAGCTGGG - Intergenic
981078654 4:140616689-140616711 AGGCCAGGTCAGACTCAGAAAGG - Intergenic
981079840 4:140628484-140628506 AGGCCTGGCCAGGACCTGTTTGG + Intronic
982289539 4:153765983-153766005 AGTCCATGCCAGCATCTGATTGG + Intergenic
982713858 4:158786011-158786033 AGTCCAGGCAAAGGTCAGATTGG - Intronic
983379984 4:166980568-166980590 AGGGCAAGCCAGGAGCAGAGTGG + Intronic
983779475 4:171650687-171650709 GGGCCTGGCCAGGAGCAGCTGGG + Intergenic
984871917 4:184333108-184333130 AGGCCATGTCAGTATCAGATGGG - Intergenic
985966598 5:3342822-3342844 GGGCCAGGCCAGGTCCAGAGAGG - Intergenic
988399867 5:30749410-30749432 ATGCCAAGACAGGATTAGATGGG + Intergenic
993056532 5:82987352-82987374 AGGACAGGACAGGATAGGATAGG - Intergenic
994150544 5:96442674-96442696 AGGCCATTCCAGAATCAGAATGG - Intergenic
995884272 5:116876223-116876245 AGGACATTCCAGCATCAGATGGG + Intergenic
997348857 5:133215556-133215578 AGGCAAGGCAGGGAGCAGATTGG - Intronic
997569343 5:134914121-134914143 AGGAGAGGACAGGATCAGATGGG + Intronic
998082092 5:139284390-139284412 AGGCCAGGACAGGACCAGCATGG + Intronic
999238820 5:150115692-150115714 AGGCCAGGCCAGGAGATGCTGGG + Exonic
999383273 5:151136736-151136758 AGGACAGGGCAGGATCACACAGG - Intronic
999440087 5:151594265-151594287 ACGCCAGGCCAGGGTCACACAGG - Intergenic
1001238709 5:170051482-170051504 ACGCCAAGCTAGGATCTGATGGG - Intronic
1004180785 6:13378946-13378968 AGGCCACACCAGCAGCAGATGGG - Intronic
1004323008 6:14647733-14647755 AGGACACGCCAGGAACAGACGGG + Intergenic
1005423371 6:25675770-25675792 AGCCCAGACGAGCATCAGATTGG - Intronic
1005910155 6:30302557-30302579 GGGTCAGGCCAAGATCAGAAGGG + Intergenic
1006438817 6:34040853-34040875 AGGCCTGGCCATGCACAGATGGG - Intronic
1006474417 6:34245339-34245361 AGGGCGTGCCAGGATGAGATGGG - Exonic
1007758830 6:44119792-44119814 AGGACCTGCCAGCATCAGATGGG - Intronic
1011161217 6:84392548-84392570 AGCCTAGACCAGGAACAGATAGG - Intergenic
1011382135 6:86753600-86753622 AGGCCAGACCATGATCAGTAAGG - Intergenic
1013535297 6:111058285-111058307 AGTCCAGGCCATGATAGGATGGG - Intergenic
1016356873 6:143227797-143227819 AGGACAGGCCAGGAGGAGCTGGG + Intronic
1017024885 6:150172957-150172979 AGGCCAGGCAAGCAGCAGTTTGG - Intronic
1018040313 6:159915940-159915962 AGGGCAGGCCAGGAAGAGCTGGG - Exonic
1018237194 6:161738004-161738026 AAGGCAGGCCAGGTTCAAATAGG - Intronic
1019542133 7:1556225-1556247 CGGCAAGGCCAGGATCTGAAGGG + Exonic
1020025831 7:4899294-4899316 AGGCTAGGACAGGATAGGATAGG + Intergenic
1020319857 7:6931762-6931784 CAGGCAGGCCAGGATCAGATGGG - Intergenic
1021259040 7:18431009-18431031 AGGACAGGACAGGACAAGATAGG - Intronic
1021880943 7:25094695-25094717 AGGCAAGGCCAGGAGTAGGTTGG - Intergenic
1022394022 7:29969630-29969652 AAGCCAGTCCAGGAGCAGCTGGG - Intronic
1022472019 7:30687869-30687891 AGGCCATGCCAGCATCAGACAGG - Intronic
1024275001 7:47670375-47670397 ACACCAGGCCAGGCCCAGATTGG + Intergenic
1026504286 7:70969054-70969076 ATGCCAGGCCTGGATCTGATTGG + Intergenic
1029507830 7:100973141-100973163 AGGGCAGACCAGCATCAGAGAGG + Intronic
1029643171 7:101833978-101834000 AGGGTAGGACAGGATCAGAGGGG - Intronic
1032127702 7:129206596-129206618 AGACCAGGCCAGGACCAGTTGGG + Intronic
1034547535 7:151798921-151798943 GGGCCAGGGGAGGAGCAGATGGG - Intronic
1034594908 7:152180864-152180886 AGCCAAGGCCTGGATCAGAGGGG - Exonic
1036848126 8:12183686-12183708 AGGCCGGGATGGGATCAGATGGG - Exonic
1036869488 8:12425969-12425991 AGGCCGGGATGGGATCAGATGGG - Exonic
1037508896 8:19561877-19561899 AGCCCAAGCCAGGCCCAGATGGG + Intronic
1037743937 8:21628652-21628674 TGGCCAGGCCAGGGTCACACTGG + Intergenic
1037850366 8:22322608-22322630 AGGACAGGACAGGACAAGATGGG - Intronic
1037960635 8:23095341-23095363 TGGTCAGGCCAATATCAGATGGG - Intronic
1037971496 8:23174795-23174817 TGGTCAGGCCAACATCAGATGGG + Intergenic
1039395012 8:37218150-37218172 CAGCCAGGCCATGATCAGAGAGG + Intergenic
1040464248 8:47679459-47679481 AGGCCAGCACAGGAGCGGATGGG - Intronic
1040686768 8:49881607-49881629 AGGGAAGCCCAGGTTCAGATGGG - Intergenic
1042805979 8:72771641-72771663 AGGCCAGGCAAGGAGCAAGTAGG + Intronic
1043865887 8:85375340-85375362 AGGACAGGCCAGCATGCGATAGG - Intronic
1044553514 8:93537429-93537451 GAGCCAGGCCAGCATCAGAAGGG - Intergenic
1044878794 8:96700830-96700852 AGGTCAGGCCTGGAGCAGACAGG - Intronic
1045348606 8:101317268-101317290 TGGCCAGGGCAGGAGCAGGTAGG - Intergenic
1048743470 8:137587786-137587808 TGACCAGACCAGGATCAGCTGGG - Intergenic
1049542895 8:143216419-143216441 AGGGCAGGCCAGGATGAGGCTGG - Intergenic
1052853195 9:33390653-33390675 AGGAGAGGACAGGAACAGATGGG + Intronic
1053206074 9:36187730-36187752 TGGCCAGGCCTGGGTCACATGGG + Intergenic
1053289094 9:36868336-36868358 AGGCAGGGCCAGGATCTGAGAGG + Intronic
1053681234 9:40486821-40486843 AGGAGAGGACAGGAACAGATGGG + Intergenic
1053709550 9:40791852-40791874 AGGCCAGGCGATGGTCAGGTAGG - Intergenic
1053931221 9:43115153-43115175 AGGAGAGGACAGGAACAGATGGG + Intergenic
1054282480 9:63138113-63138135 AGGAGAGGACAGGAACAGATGGG - Intergenic
1054294321 9:63322337-63322359 AGGAGAGGACAGGAACAGATGGG + Intergenic
1054392343 9:64626825-64626847 AGGAGAGGACAGGAACAGATGGG + Intergenic
1054419454 9:64912640-64912662 AGGCCAGGCGATGGTCAGGTAGG - Intergenic
1054426991 9:65132035-65132057 AGGAGAGGACAGGAACAGATGGG + Intergenic
1054503384 9:65889505-65889527 AGGAGAGGACAGGAACAGATGGG - Intronic
1055043426 9:71899973-71899995 AAGCCAGAACAGTATCAGATAGG + Intronic
1055792047 9:79933022-79933044 AGGCCCAGGCAGGCTCAGATGGG - Intergenic
1055967243 9:81877282-81877304 AGGCCAGCCCAGGAGCAGTCTGG - Intergenic
1057267749 9:93630325-93630347 AGGCCAGGCCAGCCTGAGTTAGG + Intronic
1059443514 9:114324130-114324152 AGGGCAGGCCAGCATAAGGTGGG + Intronic
1059444705 9:114330904-114330926 AGGGCAGGCCAGCATAAGGTGGG + Intronic
1062169733 9:135128377-135128399 AGGCCAGGCCAGGAGCCGACGGG - Intergenic
1062387172 9:136317323-136317345 AGGCCAGACTCTGATCAGATGGG + Intergenic
1186654043 X:11593842-11593864 AGCCTTGGCCAGGATCAGCTAGG + Intronic
1187429250 X:19206617-19206639 AGGCCAGGCCAGGCCCAGCCTGG - Intergenic
1188156526 X:26748810-26748832 AGGGCAGGCCAGGATGAGATGGG - Intergenic
1189152208 X:38720242-38720264 AGGCAAGGCAAGAATAAGATGGG + Intergenic
1189412360 X:40783941-40783963 GGGCCAGGCCAGGATCTGTGTGG - Intergenic
1192172015 X:68861600-68861622 AGGCCAGGCCAGGAGCAGTAGGG + Intergenic
1195102972 X:101574037-101574059 AGGGCAGCCCAGAACCAGATTGG - Intergenic
1195540485 X:106057170-106057192 AGGCAAGGGCAGGACCAGGTGGG + Intergenic