ID: 961302134

View in Genome Browser
Species Human (GRCh38)
Location 3:125929120-125929142
Sequence TTATCCTGCGTTTGGTCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 2, 1: 4, 2: 7, 3: 10, 4: 122}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961302134_961302140 29 Left 961302134 3:125929120-125929142 CCTGGAGACCAAACGCAGGATAA 0: 2
1: 4
2: 7
3: 10
4: 122
Right 961302140 3:125929172-125929194 CAGAACAGTAATACGCTAGCAGG 0: 9
1: 4
2: 1
3: 1
4: 37
961302134_961302137 -8 Left 961302134 3:125929120-125929142 CCTGGAGACCAAACGCAGGATAA 0: 2
1: 4
2: 7
3: 10
4: 122
Right 961302137 3:125929135-125929157 CAGGATAAGGAGTACTGCAGAGG 0: 1
1: 11
2: 2
3: 17
4: 157
961302134_961302139 0 Left 961302134 3:125929120-125929142 CCTGGAGACCAAACGCAGGATAA 0: 2
1: 4
2: 7
3: 10
4: 122
Right 961302139 3:125929143-125929165 GGAGTACTGCAGAGGTCACAGGG 0: 12
1: 1
2: 1
3: 7
4: 183
961302134_961302138 -1 Left 961302134 3:125929120-125929142 CCTGGAGACCAAACGCAGGATAA 0: 2
1: 4
2: 7
3: 10
4: 122
Right 961302138 3:125929142-125929164 AGGAGTACTGCAGAGGTCACAGG 0: 11
1: 1
2: 0
3: 13
4: 171
961302134_961302141 30 Left 961302134 3:125929120-125929142 CCTGGAGACCAAACGCAGGATAA 0: 2
1: 4
2: 7
3: 10
4: 122
Right 961302141 3:125929173-125929195 AGAACAGTAATACGCTAGCAGGG 0: 9
1: 4
2: 0
3: 0
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961302134 Original CRISPR TTATCCTGCGTTTGGTCTCC AGG (reversed) Intergenic
903666692 1:25012281-25012303 TTGTCCTACCTTTTGTCTCCAGG + Intergenic
905453007 1:38069004-38069026 GTAACCTGCCTTTGGCCTCCAGG - Intergenic
917360874 1:174174678-174174700 TTCTCCAGCCTTTGGACTCCAGG - Intronic
922113986 1:222591254-222591276 TTATTTTGTGTGTGGTCTCCTGG - Intergenic
924153314 1:241150922-241150944 TTTTCCCGCCTTTGGACTCCAGG - Intronic
1062845582 10:701730-701752 TTATCCTGCGTAGGGTTTGCTGG + Intergenic
1065350685 10:24793237-24793259 TGATCCTGCCCTTGTTCTCCTGG - Intergenic
1066271812 10:33831368-33831390 TTGTCCTGAGTTTTGTCTTCTGG + Intergenic
1069213703 10:65793320-65793342 TTTTCATGAGTTTTGTCTCCAGG + Intergenic
1073633165 10:105169293-105169315 TTATCTTGAGTATAGTCTCCTGG - Intronic
1076244638 10:128937210-128937232 CTCTCCTGCCTTTGGACTCCAGG - Intergenic
1076244644 10:128937263-128937285 CTCTCCTGCCTTTGGACTCCAGG - Intergenic
1077203251 11:1324982-1325004 TTCTGCCGCGTTTGGTCTGCTGG - Intergenic
1077203256 11:1325011-1325033 TTCTCCCGCGTTTGGTCTGCTGG - Intergenic
1077579738 11:3409111-3409133 TCATCCTGCGTTTGGTCTCCAGG + Intergenic
1080304977 11:30826249-30826271 TTATCTTCCGAGTGGTCTCCAGG - Intergenic
1080686096 11:34516040-34516062 CTATCCTGCTTCTGGTGTCCTGG + Intergenic
1080752546 11:35164254-35164276 TTATCCTGGGGTTTGACTCCTGG + Intronic
1081776320 11:45678196-45678218 TTTGCCTGAGTTTGGTCTTCTGG - Intergenic
1082730039 11:56784988-56785010 CTCTCCAGCGTTTGGACTCCAGG - Intergenic
1084236753 11:67792632-67792654 TCATCCTGCGTTTGCTCTCCAGG + Intergenic
1084835668 11:71800356-71800378 TTACCCTGCATTTGGTCTCCAGG - Exonic
1087744135 11:101923682-101923704 TTCTCCTACCTTTGGGCTCCTGG + Intronic
1091370024 11:135049986-135050008 TTTTCCTGCGTGAAGTCTCCTGG + Intergenic
1092407659 12:8232050-8232072 TCATCCTGCATTTGGTATCCAGG + Intergenic
1092501145 12:9049346-9049368 TGATCCTGTATTTGGTCACCAGG + Intergenic
1092857414 12:12687617-12687639 TATTCCTGTGTTTGGTCCCCAGG - Intronic
1093318961 12:17688776-17688798 TTCTCCTGCCTTTGGACTCTAGG + Intergenic
1094842508 12:34348004-34348026 TGATCCTGGGTTTGGGCCCCTGG - Intergenic
1099059183 12:77884506-77884528 TTCTCCAGCTTTTGGGCTCCAGG - Intronic
1104700315 12:130898172-130898194 TTCTCCTGCCTTTGGACTCTGGG - Intergenic
1104998879 12:132675766-132675788 TGATGGTGGGTTTGGTCTCCTGG + Exonic
1108906634 13:55483336-55483358 TTCTCCTGCGTATGCTCTCTTGG + Intergenic
1110319276 13:74141793-74141815 CTTTCCTGTGTTTGGTCTCCAGG - Intergenic
1114209546 14:20603424-20603446 TTATCTTGCGTTAGGACTGCAGG - Intronic
1115131797 14:30062741-30062763 TTCTGCTGCATTTGATCTCCTGG + Intronic
1118256498 14:64210161-64210183 GTATCGTGCGTTATGTCTCCTGG - Intronic
1118968183 14:70607765-70607787 TTCCCCTGGGTTTGGTCACCTGG + Intergenic
1123821652 15:24036447-24036469 TTATCCTGAGTTTGGTTCTCTGG + Intergenic
1127109393 15:55651307-55651329 TTATTCTGCTTTTGTTCTACTGG - Intronic
1128799282 15:70487245-70487267 TTTTCCTGCTTGTGGTTTCCTGG - Intergenic
1131567354 15:93498499-93498521 TTCTCCTGTGCTTTGTCTCCAGG + Intergenic
1133348365 16:5085175-5085197 TCATCCTGCGTTTGGTCTCCAGG + Exonic
1134144353 16:11748057-11748079 TTAACCTGCCTTCTGTCTCCAGG - Intergenic
1135359702 16:21802009-21802031 TCATCCTGCCTTTGGTCACTAGG - Intergenic
1137050983 16:35713011-35713033 TTACTCTGCGTGTGGTCTGCCGG + Intergenic
1138431676 16:56972944-56972966 TTTTCCTGATTTTGGCCTCCAGG + Intronic
1139561211 16:67743577-67743599 TTCTCCTGGGTTTCTTCTCCTGG + Intronic
1142809712 17:2389752-2389774 TTCTCCTGCCTCTGGGCTCCAGG - Intronic
1144146980 17:12408125-12408147 GTATCTTAGGTTTGGTCTCCTGG + Intergenic
1156482334 18:37444218-37444240 TTACCCTGCATTTGGTATCCAGG + Intronic
1157583249 18:48785603-48785625 TTCCCCTGGGTTTGGTCTCTGGG - Intronic
1160303798 18:77712027-77712049 TTTTCCTGTGTGTGTTCTCCTGG - Intergenic
1161297380 19:3526741-3526763 TGATCCTGCCTTTGAGCTCCCGG - Intronic
1161725337 19:5925267-5925289 TTATTCTGGGTTTGGGCACCTGG - Intronic
1165112263 19:33509301-33509323 TTCTCCTGGGGGTGGTCTCCTGG - Intronic
1165485669 19:36094077-36094099 TCATCCTCTGTTTGCTCTCCAGG - Exonic
1166117567 19:40665081-40665103 TTAACCTGCTTGTGGACTCCAGG - Intergenic
924985524 2:265642-265664 TTATTTTCCGTTTGGTCTTCAGG + Intronic
925618297 2:5765497-5765519 TTCTCCTGCCTTTGGACTCTGGG - Intergenic
925768269 2:7258793-7258815 GTATCCTGCACTTGGTTTCCGGG - Intergenic
926170220 2:10548492-10548514 TTAGCCTGGGTCTGCTCTCCAGG - Intergenic
932460571 2:71879484-71879506 TTAACCAGCCTTTGGGCTCCTGG + Intergenic
938943842 2:136192862-136192884 TTCTCCAGCCTTTGGACTCCAGG - Intergenic
940173893 2:150857963-150857985 TTCTCCAGCCTTTGGACTCCAGG + Intergenic
941966816 2:171308927-171308949 TTCTCCTGCCTTTGGACTCCAGG - Intergenic
942225193 2:173808731-173808753 TTGTCCAGCTTTTGGTCTCTGGG - Intergenic
945928032 2:215826143-215826165 TTATTCTGGGTTTGGTCTCTAGG - Intergenic
947642338 2:231714069-231714091 TCATCCAACCTTTGGTCTCCAGG + Intergenic
1168812103 20:710767-710789 TTATCCTGCCTTTGGGCCTCTGG - Intergenic
1177837889 21:26205540-26205562 TTTTCCAGCATTTGGGCTCCAGG + Intergenic
1179512874 21:41885483-41885505 TTAACCTGAGTTTGCTCTGCAGG + Exonic
1183790476 22:40064301-40064323 TTATCTTGTTTTTGGTCTCAGGG + Intronic
949805669 3:7953022-7953044 TTCTCCAGCCTTTGGGCTCCAGG - Intergenic
950658984 3:14454910-14454932 CTTTCCTGCATTTTGTCTCCAGG + Intronic
952887608 3:38021221-38021243 GTAGCCTGTGTTTGGTCTGCTGG + Intronic
954374081 3:50185170-50185192 TTCTCCTGTGTTTGGGCTGCTGG - Intronic
955327379 3:58019855-58019877 TTTCCCTGCCTTTGGTTTCCAGG + Intronic
956625769 3:71265293-71265315 ATATCCTGTGCTTTGTCTCCTGG - Intronic
957052710 3:75422418-75422440 TCATCCTGCATTTGGTCTCCAGG + Intergenic
958190388 3:90176878-90176900 TTTTCTTACCTTTGGTCTCCTGG - Intergenic
958412063 3:93830475-93830497 TTTTCTTACCTTTGGTCTCCTGG - Intergenic
960055895 3:113276165-113276187 TCATGCTGGGTTTTGTCTCCTGG - Intronic
961302134 3:125929120-125929142 TTATCCTGCGTTTGGTCTCCAGG - Intergenic
961886322 3:130098645-130098667 TCATCCTGCATTTGGTCTCCAGG + Intronic
963362868 3:144298772-144298794 TTATTCTGCTTTTGGTATCAGGG + Intergenic
965730514 3:171767292-171767314 ATATCCTGCCATTGGTCACCAGG + Intronic
966893688 3:184426694-184426716 ATGGGCTGCGTTTGGTCTCCAGG - Exonic
967958053 3:194893467-194893489 TTCTCCAGCCTTTGGACTCCAGG + Intergenic
968995515 4:3942815-3942837 TCATCCTGCGTTTGGTCTCCAGG + Intergenic
969255872 4:6001415-6001437 TTATCCAGCGTTTGTTCAGCGGG + Intergenic
969758476 4:9165994-9166016 TCATCCTGCATTTGGTCTCCAGG - Intergenic
969818439 4:9703431-9703453 TTAGCCTGCGTTTGGTCTCCAGG - Intergenic
970148970 4:13069070-13069092 TGATGCTGCGTTGGGTCTCTTGG - Intergenic
976854047 4:89581968-89581990 TTCTTCAGCGTTTGGACTCCTGG + Intergenic
981567281 4:146114432-146114454 TCCTCCTGCGGTTGGACTCCAGG - Intergenic
984053076 4:174891503-174891525 TTCTCCTGCCTTCGGACTCCTGG + Intronic
986568778 5:9143935-9143957 TTGTCCTGGTTTTGGTCCCCTGG - Intronic
987694438 5:21309989-21310011 TTTTCCTGCATTAAGTCTCCTGG + Intergenic
990900596 5:60744731-60744753 TTCTCCTGGGTGTGGTCTCCTGG + Intergenic
996403089 5:123084249-123084271 ATCTCCTGGGCTTGGTCTCCCGG + Intergenic
998159044 5:139802879-139802901 TTATCCTGCATGTGCTCTGCTGG - Intronic
1000760984 5:165224142-165224164 TTATCCTTCATTTAGTCTTCTGG + Intergenic
1002400541 5:178989355-178989377 TGTTCCTGCGGTTGTTCTCCAGG + Exonic
1004841742 6:19594906-19594928 TTGTCCTGCCTTTTGTCTCTTGG - Intergenic
1005507910 6:26485765-26485787 TTATCATGAGTTTGTTCTCCTGG - Intergenic
1005556467 6:26989946-26989968 TTTTCCTGCATTAAGTCTCCTGG - Intergenic
1007484314 6:42170306-42170328 TTCTCCTGCCCTTGGACTCCAGG - Intronic
1011071608 6:83391737-83391759 CCATCCTGCTTCTGGTCTCCAGG + Intronic
1014024664 6:116631514-116631536 TCATCCTCCTCTTGGTCTCCAGG - Intronic
1014102860 6:117530754-117530776 TTATCATCAGTTTGGACTCCTGG - Intronic
1015825608 6:137308035-137308057 TTATGCTGCGTTAGGTCTAAAGG + Intergenic
1017339046 6:153299137-153299159 TTTTTCTGTGTTTGGTCTGCTGG + Intergenic
1018743442 6:166747192-166747214 TAATCCTGCCTGTGGTCTCTGGG + Intronic
1020319783 7:6931121-6931143 TTATCCTGCGTTTGGTCTCCAGG + Intergenic
1023738303 7:43254228-43254250 ATCTTCTGTGTTTGGTCTCCTGG - Intronic
1024301375 7:47889978-47890000 GTATCCTGTGTTTGGTGTCCGGG + Intronic
1024561146 7:50646542-50646564 TTCTCCTTTTTTTGGTCTCCTGG + Intronic
1024779372 7:52829207-52829229 TCATCCTGTGTTTGCTTTCCTGG - Intergenic
1026759407 7:73115203-73115225 TTCTCTTACGTTTGGTCACCTGG + Intergenic
1027088003 7:75278270-75278292 TTCTCTTACGTTTGGTCACCTGG - Intergenic
1027348337 7:77285099-77285121 TTATCATGAGTCTGTTCTCCTGG + Intronic
1029040265 7:97565885-97565907 TTCTCCAGCCTTTGGACTCCTGG - Intergenic
1029174964 7:98658072-98658094 TTATCCTGAGCTTGGCCTGCAGG - Intergenic
1031201750 7:118697268-118697290 TTCCCCAGCGTTTGGACTCCAGG + Intergenic
1035056103 7:156037854-156037876 TTATCCTGCGTTTTTTTTCAGGG - Intergenic
1036052473 8:5216039-5216061 TGATCCTGCGCTGGGGCTCCAGG - Intergenic
1036848039 8:12182994-12183016 TCATCCTGCATTTGGTCTCCAGG + Exonic
1036869402 8:12425277-12425299 TCATCCTGCATTTGGTCTCCAGG + Intergenic
1038315441 8:26480815-26480837 TAATCCAGAGCTTGGTCTCCTGG + Intronic
1042363177 8:67905834-67905856 TTTTCCTGCCTTTGGACTCTAGG + Intergenic
1048888437 8:138927422-138927444 TTATCCTGCTAATGGTCACCTGG + Intergenic
1049714609 8:144083917-144083939 TGATCCTGCTTCTGGCCTCCAGG + Exonic
1052481793 9:29038705-29038727 TTATCCTGCATTTGGTCTTTAGG + Intergenic
1055090182 9:72356456-72356478 TTATCCTGCGTTGCATCTACAGG - Intronic
1055491837 9:76813320-76813342 ATATCCTCAGTTTGGGCTCCTGG + Intronic
1057060448 9:91999312-91999334 TTTTCCTGCCTTTGGACTCTGGG + Intergenic
1058101049 9:100917861-100917883 TTATCCACCATTTGGCCTCCTGG - Intergenic
1059192724 9:112342163-112342185 TTCTCCAGCCTTTGGACTCCAGG + Intergenic
1062475920 9:136727427-136727449 TTTTGCTGCATCTGGTCTCCAGG + Intergenic
1187102068 X:16203648-16203670 TTATTCATTGTTTGGTCTCCTGG - Intergenic
1188081579 X:25848658-25848680 TTATCCTGCTTTGGGTTTTCTGG + Intergenic
1189742198 X:44131004-44131026 TTATCCTGAGTATTTTCTCCTGG + Intergenic
1190496761 X:51033996-51034018 TCATCCTGCTTGGGGTCTCCAGG + Intergenic
1190509209 X:51159941-51159963 TCATCCTGCCTGGGGTCTCCAGG - Intergenic