ID: 961305156

View in Genome Browser
Species Human (GRCh38)
Location 3:125953783-125953805
Sequence TCCCTCTGCTGAAGGAGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961305151_961305156 -5 Left 961305151 3:125953765-125953787 CCAAAACTGGATGACTTCTCCCT No data
Right 961305156 3:125953783-125953805 TCCCTCTGCTGAAGGAGGGCGGG No data
961305150_961305156 1 Left 961305150 3:125953759-125953781 CCTTCACCAAAACTGGATGACTT No data
Right 961305156 3:125953783-125953805 TCCCTCTGCTGAAGGAGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961305156 Original CRISPR TCCCTCTGCTGAAGGAGGGC GGG Intergenic
No off target data available for this crispr