ID: 961306750

View in Genome Browser
Species Human (GRCh38)
Location 3:125963230-125963252
Sequence CTGTGTGAGGAGAGGCAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961306740_961306750 28 Left 961306740 3:125963179-125963201 CCGGCAAGAAATGGACAAAGGCA No data
Right 961306750 3:125963230-125963252 CTGTGTGAGGAGAGGCAGAGGGG No data
961306744_961306750 0 Left 961306744 3:125963207-125963229 CCTGTAGGTGAGAAGCATATGGG No data
Right 961306750 3:125963230-125963252 CTGTGTGAGGAGAGGCAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961306750 Original CRISPR CTGTGTGAGGAGAGGCAGAG GGG Intergenic
No off target data available for this crispr