ID: 961308241

View in Genome Browser
Species Human (GRCh38)
Location 3:125974761-125974783
Sequence CTGAAAATTTTGAGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 474
Summary {0: 2, 1: 0, 2: 0, 3: 45, 4: 427}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961308238_961308241 8 Left 961308238 3:125974730-125974752 CCACAAAACATTGAGGAGCAGGC 0: 2
1: 0
2: 2
3: 16
4: 221
Right 961308241 3:125974761-125974783 CTGAAAATTTTGAGGGAAGATGG 0: 2
1: 0
2: 0
3: 45
4: 427
961308233_961308241 25 Left 961308233 3:125974713-125974735 CCCAAACAAAGTCCACTCCACAA 0: 1
1: 2
2: 0
3: 15
4: 151
Right 961308241 3:125974761-125974783 CTGAAAATTTTGAGGGAAGATGG 0: 2
1: 0
2: 0
3: 45
4: 427
961308234_961308241 24 Left 961308234 3:125974714-125974736 CCAAACAAAGTCCACTCCACAAA 0: 1
1: 1
2: 1
3: 11
4: 174
Right 961308241 3:125974761-125974783 CTGAAAATTTTGAGGGAAGATGG 0: 2
1: 0
2: 0
3: 45
4: 427
961308236_961308241 13 Left 961308236 3:125974725-125974747 CCACTCCACAAAACATTGAGGAG 0: 2
1: 0
2: 0
3: 4
4: 134
Right 961308241 3:125974761-125974783 CTGAAAATTTTGAGGGAAGATGG 0: 2
1: 0
2: 0
3: 45
4: 427
961308232_961308241 26 Left 961308232 3:125974712-125974734 CCCCAAACAAAGTCCACTCCACA 0: 1
1: 1
2: 0
3: 8
4: 181
Right 961308241 3:125974761-125974783 CTGAAAATTTTGAGGGAAGATGG 0: 2
1: 0
2: 0
3: 45
4: 427
961308231_961308241 27 Left 961308231 3:125974711-125974733 CCCCCAAACAAAGTCCACTCCAC 0: 1
1: 1
2: 0
3: 8
4: 144
Right 961308241 3:125974761-125974783 CTGAAAATTTTGAGGGAAGATGG 0: 2
1: 0
2: 0
3: 45
4: 427

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961308241 Original CRISPR CTGAAAATTTTGAGGGAAGA TGG Intronic
901462459 1:9399870-9399892 CTGAATATTTTCAGGAAAGGTGG - Intergenic
904374945 1:30074790-30074812 CTTAAAAGTTAGAGGCAAGATGG - Intergenic
905718214 1:40172232-40172254 CTGGAAAGATTGAGGGCAGAAGG - Intronic
905907925 1:41631993-41632015 CTGAACCTCCTGAGGGAAGATGG - Intronic
907157129 1:52344879-52344901 CTGAAACTTCTGAAGGAAGATGG + Exonic
908620288 1:65971689-65971711 CTGAAAATATTCAGAGAGGATGG + Intronic
910038761 1:82821809-82821831 GTGAAAATCTTTAAGGAAGAAGG + Intergenic
910133578 1:83938964-83938986 TTGAAATTTTTGAAGCAAGAAGG + Intronic
910708959 1:90158785-90158807 CTGAAAATTGTGAGGGGATATGG + Intergenic
911713697 1:101106005-101106027 CAAAAAATTTTGAAAGAAGACGG + Intergenic
913723520 1:121626284-121626306 TTGAACATTTTGATGGAAAAGGG - Intergenic
913737534 1:121802272-121802294 TTGAACATTTTGATGGAAAAGGG - Intergenic
913758055 1:122099281-122099303 TTGAACATTTTGATGGAAAAGGG + Intergenic
913763490 1:122162003-122162025 TTGAACATTTTGATGGAAAAGGG + Intergenic
913768773 1:122223469-122223491 TTGAACATTTTGATGGAAAAGGG + Intergenic
914697311 1:150096698-150096720 GTGGAAATTTTGAAGGAAGAAGG + Intronic
914708078 1:150187840-150187862 CTGAAAATTGTAAGGGAAAAGGG + Intergenic
914930799 1:151931128-151931150 CTAAAAGTTTTGAGGGAATACGG + Intergenic
915105827 1:153534677-153534699 CTGAAAATAAATAGGGAAGATGG - Exonic
915163240 1:153933880-153933902 CAGAAAAGAATGAGGGAAGATGG + Intronic
915693170 1:157711026-157711048 TACAAAATTTTGAGGGGAGATGG - Intergenic
915912603 1:159924116-159924138 CTGAAAATTCTGGAGGGAGAAGG + Intronic
916061313 1:161100356-161100378 CTGAAATTTTTGGGGGGAGGGGG + Intergenic
916098114 1:161369280-161369302 ATGAGGATTTTGGGGGAAGAAGG - Exonic
916760614 1:167813310-167813332 CTGAAAATTTAGAGGTCAGAAGG + Intronic
917266161 1:173223068-173223090 CTGAAAAGCTTGAGGCAAGCTGG - Intergenic
918174748 1:182033524-182033546 TTTACATTTTTGAGGGAAGAAGG + Intergenic
918212765 1:182366215-182366237 AAAAAAATTTTGAGGAAAGATGG + Intergenic
918500152 1:185185786-185185808 CTTAAAATTTTGAAGAAAAAGGG + Intronic
918898706 1:190383462-190383484 CTGGAAATTTTTAGGGAACAAGG - Intronic
918935866 1:190920492-190920514 CTAAAAATGTTGAAGGAAAAAGG + Intergenic
919287782 1:195586362-195586384 CTGAAAATTTTGTTGCCAGATGG - Intergenic
919350022 1:196439609-196439631 CAGAAAATTTTGCAGGTAGAAGG + Intronic
919702229 1:200642667-200642689 CTGAAAATTGTGTGGCGAGAGGG + Intronic
919739179 1:200972214-200972236 CAGAAAATTATCAAGGAAGAGGG - Intronic
920654194 1:207863372-207863394 GTGACAAATTTGGGGGAAGATGG - Intergenic
921538712 1:216385658-216385680 ATGAAAGTTTTGAGCAAAGAAGG - Intronic
921568838 1:216754163-216754185 CAGAATATTTGGAAGGAAGAAGG - Intronic
921840269 1:219820825-219820847 CTAAAACTCTTGAGGGATGAGGG - Intronic
921879846 1:220243572-220243594 CTGAAAAAGTAGATGGAAGATGG - Intronic
922865443 1:228857295-228857317 CAGAAAACTTTGAGGCCAGAAGG - Intergenic
923192168 1:231629809-231629831 CTAAAAATTTTGATTGGAGAAGG + Intronic
923276011 1:232396986-232397008 CTGGAGATTTTCAGGGAATAAGG - Intergenic
923515121 1:234690704-234690726 CTGAAAATTGATATGGAAGAAGG + Intergenic
923859418 1:237878053-237878075 CTGAATATTCTGAGTGAAGATGG + Exonic
1063446648 10:6122307-6122329 CTCAAAATTCTGAGGGAAAATGG - Intergenic
1064489596 10:15838385-15838407 CTGAGAATTTTAAGGGAGTAAGG - Intronic
1064499446 10:15953549-15953571 CTGTTAATTTTGAGGGATGGGGG + Intergenic
1065790318 10:29254481-29254503 CAGAAATTTTTAAGGAAAGAAGG - Intergenic
1068074166 10:52233252-52233274 CTGAAAACTATGTGGGAAAAAGG + Intronic
1069112668 10:64466050-64466072 CTGAATATTTAGAGGCAAGAAGG + Intergenic
1069481431 10:68785760-68785782 CTGAAGAGGTTCAGGGAAGATGG - Intronic
1071508715 10:86248076-86248098 CTGAACATTCTGGGGGAAGTGGG - Intronic
1071734800 10:88286401-88286423 CTCAAAATTTGGATGGATGATGG + Intronic
1072038863 10:91589203-91589225 CTGAGAATTCTAAGGGAAGAGGG + Intergenic
1072850912 10:98891070-98891092 CTGAAAATTTTGAAGGGAGCAGG - Intronic
1073413433 10:103361644-103361666 CTGTAAATTATAAGAGAAGAAGG + Intergenic
1073884007 10:108016920-108016942 CAGAAATTTTTGAGGGGAGAAGG + Intergenic
1074294917 10:112176654-112176676 CTGAAAATGTTGACTGAAGGAGG - Intronic
1075026255 10:118985723-118985745 CTGAAACTTTGGAGGCCAGAAGG + Intergenic
1075123432 10:119681024-119681046 CTGAAAAGTGTGAGTGCAGAGGG + Intergenic
1078727512 11:13944849-13944871 CAGAAGAGTTAGAGGGAAGAAGG + Intergenic
1078811280 11:14767767-14767789 CAGAATATTTAGAGGGAAAAAGG - Intronic
1078849276 11:15149322-15149344 CAGAAAATTGCGTGGGAAGATGG - Intronic
1078910115 11:15723225-15723247 CTGAAAGTTTTGCTGGCAGAAGG - Intergenic
1078921999 11:15839407-15839429 ATGAAGAATTTTAGGGAAGATGG + Intergenic
1079706591 11:23628324-23628346 TTGAAAAGTTTGAGGAAAGGGGG - Intergenic
1079870169 11:25787898-25787920 TTTAAAGTTTTGAAGGAAGAAGG - Intergenic
1080204206 11:29710555-29710577 GTGAGAATTTTAAGGGTAGAGGG + Intergenic
1080348525 11:31355041-31355063 GTAGAAATTTTGAGGGAACAAGG + Intronic
1080572684 11:33570350-33570372 CTGGAAAGTCTGAGGGAAGCGGG + Intronic
1080885933 11:36368225-36368247 CTGAAAATTTCAAGGCAAGAGGG + Intronic
1081458724 11:43251208-43251230 CTGAAAATATTGAGGAATGGTGG + Intergenic
1081685037 11:45036380-45036402 CTGTGAATTTTGAGGGGATAAGG - Intergenic
1084230477 11:67749086-67749108 CTGAAGGTTCTGAGGAAAGATGG - Intergenic
1085002556 11:73053983-73054005 CTACAAATTTTAAGGGAAAAGGG + Intronic
1085822636 11:79809340-79809362 CTGATAATTTTGAGATAATATGG + Intergenic
1087060515 11:93972627-93972649 ATGAAAAGGTTGAGGGAAGGGGG - Intergenic
1087267844 11:96080347-96080369 CTGAAAAGAGTGAGGGAAAAGGG + Intronic
1087586694 11:100130902-100130924 TTGAAAATTTTTATGGGAGATGG - Intronic
1087693463 11:101348593-101348615 CTGAGAAAGTTGAGGGAGGAAGG + Intergenic
1087969767 11:104465288-104465310 CAGAAAATTAGGAGGGAGGAGGG - Intergenic
1088525996 11:110755809-110755831 CTGAATATTTTGAGTAAATAAGG + Intergenic
1088745688 11:112802091-112802113 CTGAAAATGTAGAGAGGAGATGG - Intergenic
1088757224 11:112895442-112895464 CTGAGAATTTTTAGGGAATTTGG + Intergenic
1090115979 11:123974263-123974285 CTTGAAATTTAAAGGGAAGAGGG - Intergenic
1090304960 11:125683411-125683433 CTGAAAATCTTCAGGGTGGAGGG + Intergenic
1091276344 11:134354695-134354717 CAGAAAATTTTCAGGCCAGAAGG - Intronic
1091707458 12:2706252-2706274 CTGAAACTTTTGAGGCCAGAAGG + Intergenic
1091755064 12:3045982-3046004 CTGAAGATTTGGAGAGATGAAGG - Intergenic
1092214146 12:6668755-6668777 CTTGAAATTTTGAGGGGAGCTGG - Intronic
1092589677 12:9940360-9940382 CTAAAAATTAGGAGGGAAAATGG - Intergenic
1092847627 12:12598626-12598648 ATTAAAATTTTGATTGAAGAAGG + Intergenic
1093618789 12:21262621-21262643 CAGAAACTTTGGAGGCAAGAAGG - Intergenic
1093908478 12:24719468-24719490 CTGGAGACTGTGAGGGAAGAGGG - Intergenic
1095514778 12:42993825-42993847 CTAAAAGTTATGAGGGAACAAGG + Intergenic
1096846306 12:54408948-54408970 CTGAAATCTGTGAGGGGAGAAGG + Exonic
1097152591 12:56990595-56990617 GTGAAAACTTGGAAGGAAGAGGG + Intergenic
1097229185 12:57498766-57498788 CAGGCATTTTTGAGGGAAGATGG + Intronic
1097765359 12:63520375-63520397 CTGAAGATTTTATAGGAAGAAGG + Intergenic
1098847010 12:75550186-75550208 CTTAGAATTTAGATGGAAGAGGG - Intergenic
1099072264 12:78060111-78060133 GTCAAAATTCTGAGTGAAGAGGG - Intronic
1099089765 12:78291413-78291435 CTGAAAATTATTTAGGAAGAGGG - Intergenic
1099188164 12:79538366-79538388 ATGAAAATTTTGGGGGGAAATGG + Intergenic
1099887801 12:88553292-88553314 CTGGAAACTCTGAGGGAATAGGG + Intronic
1099980549 12:89596747-89596769 TTTAAAATTTTGAGGGAAGGGGG + Intronic
1101293914 12:103401237-103401259 CTGTAAATTTTTATGGATGATGG + Intronic
1102741506 12:115211421-115211443 CTGAAGAATTTGAGGCAATATGG + Intergenic
1103039257 12:117681411-117681433 TTGAAAGATTTGAAGGAAGAAGG + Intronic
1104311816 12:127660176-127660198 CTGAAATTGCTGAGGGGAGAAGG - Intergenic
1106489085 13:30200499-30200521 CTAGAAATCGTGAGGGAAGATGG - Intergenic
1107187453 13:37540774-37540796 CTAAAATTTTTTAGGAAAGATGG + Intergenic
1107770511 13:43785009-43785031 CGGAATATTGTGAGGGAAGACGG - Intronic
1107834406 13:44401896-44401918 CTTAAATTTGTGAGGGAGGAAGG - Intergenic
1108852599 13:54752098-54752120 CTGAACTTTTTCAGGGAAAAAGG - Intergenic
1108875406 13:55042533-55042555 CTGAAAATTTTATGGAAATATGG + Intergenic
1109391654 13:61703022-61703044 CTGGAAATTTTGGGTAAAGAAGG + Intergenic
1110570877 13:77001895-77001917 CTGACAGCTTTGTGGGAAGAGGG - Exonic
1111254997 13:85655496-85655518 TTAAAATTTTTGAAGGAAGATGG + Intergenic
1111807954 13:93061614-93061636 CTGATGATTTTGAGGGAGAAGGG + Intergenic
1112099667 13:96174372-96174394 TAAAAAATTTGGAGGGAAGAGGG - Intronic
1112682828 13:101786732-101786754 CTCAAAAATTTGGGGGAAGGAGG + Intronic
1113405142 13:110031931-110031953 CTGGAAATTAAGAGGGAGGAAGG + Intergenic
1113871259 13:113561262-113561284 ATTAAAGTGTTGAGGGAAGATGG - Intergenic
1114251674 14:20967144-20967166 CTGGGAATGTTGGGGGAAGAAGG + Intergenic
1114367644 14:22046938-22046960 CTGAAAGTTTTGAAATAAGATGG + Intergenic
1116819162 14:49610964-49610986 CTGAACTTTTTTAGGGGAGAGGG + Intronic
1118488510 14:66236245-66236267 CCCAAAATCTTGAGGGAGGAGGG - Intergenic
1118504433 14:66395407-66395429 CTGAAAATGTTGAGTGCAGCAGG + Intergenic
1118982601 14:70728859-70728881 CAGAGAGTCTTGAGGGAAGAGGG + Intronic
1119110016 14:71963267-71963289 ATGGAAGTTTTGAGTGAAGAAGG - Intronic
1119658151 14:76432103-76432125 CTTAGAAGTATGAGGGAAGAGGG - Intronic
1120242603 14:81966647-81966669 GTGAAGATTTTGAGGGTAGAGGG + Intergenic
1123335453 15:18913266-18913288 TTGAAAATTTCGTTGGAAGAGGG + Intergenic
1123347815 15:19118460-19118482 TTGAAAATTTTGTTGGAAGCGGG + Intergenic
1123371279 15:19507262-19507284 TTGAAAATTTTGTTGGAAGCGGG + Intergenic
1123374531 15:19561307-19561329 TTGAAAATTTTGTTGGAAGCGGG + Intergenic
1123915722 15:25024457-25024479 CTGAAAATTCTGAAAGAATAAGG + Intergenic
1125115916 15:36091530-36091552 TTAAAGATTTTAAGGGAAGAAGG + Intergenic
1126928485 15:53619402-53619424 CTGAAAATTTTGTTTAAAGAGGG - Intronic
1127044548 15:55011856-55011878 CTGGAGATTTCTAGGGAAGAGGG - Intergenic
1127362484 15:58256868-58256890 TTCAAAATTCTAAGGGAAGATGG + Intronic
1127631189 15:60828990-60829012 CTGAAAGTTTTAGGGGGAGAGGG - Intronic
1127680819 15:61296184-61296206 CTAAAGATGTTGAGGGAAGAAGG - Intergenic
1128299983 15:66560577-66560599 CTGGGAATTTTGAAGGAGGAAGG - Intronic
1128378810 15:67096192-67096214 TTGAAAATGATGACGGAAGAAGG + Intronic
1129368963 15:75076022-75076044 CAGAAAAAATGGAGGGAAGAAGG + Intronic
1129828759 15:78653237-78653259 CTGAAAGTTCTGAGGGAGGCAGG + Intronic
1129988247 15:79937573-79937595 TTAAAAATTGTGAGGTAAGATGG + Intergenic
1131239595 15:90727553-90727575 CTGAAATTTTGGTGGGAGGAAGG + Intronic
1131696099 15:94879743-94879765 CTGACAATTTTGAGTTATGATGG - Intergenic
1132060279 15:98687006-98687028 CTGAAGGTTTTGAGAGGAGAGGG + Intronic
1133435419 16:5775313-5775335 CAGAAAACTTGAAGGGAAGAGGG - Intergenic
1133555145 16:6899383-6899405 ATGAAAATTTTGAGCCAAGAGGG - Intronic
1135572888 16:23562899-23562921 CTGAAAACAATGAGGGAAAACGG - Intronic
1137875747 16:51995065-51995087 CTGAAAATTTTTACTGAGGATGG - Intergenic
1138027091 16:53530551-53530573 CTGAGAATTTTCCTGGAAGAGGG + Intergenic
1139139687 16:64246198-64246220 CTGAAAGTGTGGAGGGAGGAAGG + Intergenic
1139266013 16:65639138-65639160 TTGAAATTTCTGGGGGAAGATGG - Intergenic
1141362379 16:83407953-83407975 CTGGGAATGTTGTGGGAAGAGGG - Intronic
1142889680 17:2934962-2934984 CAGAAAAGCTTTAGGGAAGACGG + Intronic
1143529118 17:7491024-7491046 CACAAAATTTTGGGGAAAGAGGG + Intronic
1144071186 17:11672504-11672526 CTGGTGATTTTGAGGGAAGATGG - Intronic
1144148970 17:12424850-12424872 ATGAACATTTTGAGTGAGGAGGG + Intergenic
1145121305 17:20262674-20262696 CTGAAGCTTTTGAGGGAGGTGGG + Intronic
1147455974 17:40538396-40538418 CTGAAATGTTTGGGGGAAGAAGG + Intergenic
1148102991 17:45104036-45104058 CTCAAAACTTGGAGGGAACAAGG + Intronic
1148430720 17:47641390-47641412 ATGCAAATTTTGTGGGCAGATGG + Intergenic
1148577601 17:48722779-48722801 CTAAAAGTTTTATGGGAAGAGGG - Intergenic
1149087979 17:52742458-52742480 CAGAAAAGTTGGAGGGAACAGGG - Intergenic
1149400072 17:56286954-56286976 AGGAAAATTTTGATAGAAGAGGG - Intronic
1149620323 17:58039952-58039974 AGGAAAATTTTGAGGCAAGGAGG + Intergenic
1150942666 17:69710025-69710047 CTGTAATTTTTATGGGAAGAGGG + Intergenic
1151617584 17:75224425-75224447 CTGGACATTTTGTGAGAAGATGG + Intronic
1151932453 17:77241263-77241285 TTGAACATGTTGTGGGAAGATGG + Intergenic
1152088115 17:78232377-78232399 CTGTCAGTTTTGGGGGAAGACGG - Intronic
1154039624 18:10841504-10841526 CAGAAAATTTGGAGGCCAGAAGG + Intronic
1154507205 18:15053466-15053488 TTGAAAATTTTATTGGAAGAGGG + Intergenic
1154508527 18:15068067-15068089 CTGGAAACTTCCAGGGAAGATGG + Intergenic
1155317051 18:24582288-24582310 CTGAGAATAGTGAGAGAAGATGG - Intergenic
1155886053 18:31209773-31209795 AAGCAAATTTTGAGGGATGATGG - Intergenic
1156693754 18:39740781-39740803 ATGAACATTTTGATGGAAAATGG + Intergenic
1156907657 18:42373497-42373519 CTTATAATCATGAGGGAAGAAGG + Intergenic
1157873369 18:51250089-51250111 ATGTGAATTTTGAGGGGAGAGGG + Intergenic
1159196129 18:65117907-65117929 GAGAAAATTTTGAGTGAAGAAGG + Intergenic
1159594291 18:70367921-70367943 CAGAACAATTTGAGGGAAGTGGG - Intergenic
1159637417 18:70821840-70821862 CAGAAAATTATCAGGAAAGAAGG - Intergenic
1159973099 18:74677436-74677458 AAGAATATTTTGAGGGCAGAAGG - Intronic
1160027982 18:75234358-75234380 CTGAAAATTGCCAGAGAAGATGG - Intronic
1160089920 18:75817258-75817280 CTGAGAATTTAGAGAGTAGATGG - Intergenic
1162494452 19:11015632-11015654 CTGAAATTATTGAGGAAAGTAGG - Intronic
1163877212 19:19882354-19882376 CTGTGAATTTTTAGTGAAGAGGG + Intronic
1165840803 19:38788274-38788296 CTGCAAAATTGGTGGGAAGATGG + Intergenic
1165891911 19:39117728-39117750 CTGAAGATCTGGAGGGAGGAAGG - Intergenic
1165935091 19:39384260-39384282 CTGAACTTTATGAGGGGAGAGGG + Exonic
1168283337 19:55317992-55318014 CTTAAAATTTCATGGGAAGAGGG + Intronic
926256940 2:11212266-11212288 CTAAAAGGTTTGAGTGAAGACGG - Intronic
926390918 2:12391908-12391930 CACAAAATTTTGAGGGACCAAGG + Intergenic
926470958 2:13257410-13257432 CAGAAAATTTTTAGGGCAGTGGG - Intergenic
926813759 2:16780070-16780092 CTGAGAGTTCTGAGTGAAGAGGG - Intergenic
926858659 2:17284676-17284698 CTGAAGCTTCTGAAGGAAGATGG + Intergenic
926902760 2:17773544-17773566 ATGGATATTTTGGGGGAAGAGGG + Intronic
927935651 2:27074682-27074704 CTGAATATTGGGAGGGAAAAAGG - Intergenic
928321616 2:30287915-30287937 CTGAAAATGGAGATGGAAGATGG - Intronic
928380599 2:30814441-30814463 CTCAGAAATTTGAGGCAAGAGGG + Intronic
928823171 2:35387712-35387734 CTTAAAATTTTGCAGAAAGAGGG + Intergenic
929491529 2:42400829-42400851 CTGAAATTTTTAAAGGAAGTTGG + Intronic
930055905 2:47251814-47251836 CCCAAAAAGTTGAGGGAAGATGG - Intergenic
930112656 2:47692139-47692161 CTGAAAAAAATGAGGGGAGAGGG - Intergenic
930241931 2:48944696-48944718 CCTAAACATTTGAGGGAAGACGG - Intergenic
931322602 2:61185768-61185790 CTGAATAATTGGAGGGGAGATGG + Intronic
932956232 2:76354256-76354278 AACAAAATTTTGAGGGAAGGGGG + Intergenic
934656974 2:96121504-96121526 CTGGAAGGTTTGAAGGAAGATGG - Intergenic
935009787 2:99123086-99123108 CTGAAAAACTGGAGGTAAGAAGG - Intronic
935069486 2:99681475-99681497 ATGTGAATTTTGAGGGAACACGG - Intronic
937006159 2:118517551-118517573 TTGAAAATTTAAAGGTAAGATGG + Intergenic
937319784 2:120954273-120954295 CGGAAGGTTTTGAGGGAAGGTGG + Intronic
938150446 2:128878008-128878030 CTGACAATTTTGATGGACAATGG + Intergenic
939261130 2:139810821-139810843 CTGAAAACTTTCAGGGAGTAAGG + Intergenic
939481346 2:142751534-142751556 CTGGAAACTTTTAGGGAGGATGG - Intergenic
939763477 2:146214716-146214738 CTAAAGATTTAGAAGGAAGATGG + Intergenic
940012823 2:149072873-149072895 CTGAGACATTTGAGTGAAGATGG + Intronic
940614471 2:156033367-156033389 TTAAGCATTTTGAGGGAAGAAGG - Intergenic
940717968 2:157249346-157249368 CTCAAAACATTGAGGGAGGAAGG - Intergenic
941124823 2:161571999-161572021 AAGAAAAAATTGAGGGAAGATGG - Intronic
942684118 2:178512777-178512799 CTTAAAATTCTGAGAGAACAGGG + Exonic
942702625 2:178730858-178730880 TTTTAAATTTTAAGGGAAGAAGG + Intronic
943007672 2:182405588-182405610 CTTAAAATTTTTAGGGCACAAGG - Intronic
943344997 2:186727938-186727960 CTGAATATTTTGTGTGAAAATGG + Intronic
943513463 2:188855191-188855213 CTTTACATTTTGAAGGAAGATGG + Intergenic
943793811 2:191966596-191966618 TTGAAAATTTTCAGGGCAGAAGG + Intronic
944981045 2:205120398-205120420 CTGCAAATTGTTAGGGGAGAAGG - Intronic
947807125 2:232976671-232976693 CTGACAATTTACAGGGAAGGTGG - Intronic
947946638 2:234109344-234109366 CGGGAGATTTTGAGGGCAGAGGG + Intergenic
947979339 2:234395799-234395821 CTGACAATGCTGGGGGAAGAGGG + Intergenic
948148390 2:235725717-235725739 CTGAAAATCATCAGTGAAGATGG - Intronic
1169182619 20:3583227-3583249 TTGCAATTTTGGAGGGAAGAAGG - Intronic
1169595041 20:7188852-7188874 GTGAAAATTTTTAGAGGAGATGG + Intergenic
1169998139 20:11582615-11582637 CTGACAACTGAGAGGGAAGAAGG - Intergenic
1170010096 20:11713349-11713371 CTGAAGGTTTTGAGAGAAAAGGG + Intergenic
1170010666 20:11719128-11719150 CAGAAAATTCTGGGGGAAGATGG + Intergenic
1170101319 20:12702661-12702683 ATGGAAATTGTGAGGAAAGAGGG - Intergenic
1170803096 20:19606679-19606701 CTGAGAATGCAGAGGGAAGAAGG + Intronic
1172629015 20:36365965-36365987 CTGTAAAATTGGAGGGGAGAGGG + Intronic
1175604741 20:60303480-60303502 CTGCATATTTTAAGGGATGAAGG - Intergenic
1176959616 21:15144469-15144491 TTGACAATTTTGAGGGATGCTGG - Intergenic
1177441501 21:21132445-21132467 GGGAATACTTTGAGGGAAGAGGG + Intronic
1177904500 21:26959084-26959106 CTGACAAATGTGAGGTAAGAAGG + Intronic
1177988720 21:28011871-28011893 CTGGAAACTTCCAGGGAAGATGG - Intergenic
1178554556 21:33577040-33577062 TACAAAATTTTGAGGGGAGATGG - Exonic
1178818738 21:35955526-35955548 CTGAAACTCCAGAGGGAAGAGGG + Intronic
1181379362 22:22488074-22488096 TTGAAAATTTTGAGACAAAAGGG + Exonic
1181913745 22:26262381-26262403 CAGAAATCTTTGAGGGAAAAAGG + Intronic
1182930023 22:34164585-34164607 CTGAAATCTATGAAGGAAGAGGG - Intergenic
1183914091 22:41102724-41102746 TGGAAAGATTTGAGGGAAGATGG + Intronic
1184665442 22:45986651-45986673 CTGAAGATTTTGAGAGAGGGGGG + Intergenic
1185089844 22:48760040-48760062 CTGAGACGTTCGAGGGAAGATGG - Intronic
949528432 3:4929243-4929265 CTGATAAATATGAGGGGAGAGGG - Intergenic
950801508 3:15555351-15555373 CTGCAAATATGGAGGGACGAGGG + Intergenic
951623104 3:24627952-24627974 CGGAAAATTTTCCAGGAAGAGGG + Intergenic
952095936 3:29954121-29954143 ATGAGAATCTTGAGGCAAGAAGG - Intronic
953361917 3:42304939-42304961 CAGAAAACTTTGAGGGGAGATGG - Intergenic
953900535 3:46839115-46839137 ATGAAAATTGAGAGGGAAAATGG + Intergenic
955655475 3:61240564-61240586 CTGTAAATTTTGAGGTATTATGG + Intronic
955839344 3:63095944-63095966 TAGAAAACTTTCAGGGAAGAAGG - Intergenic
956121033 3:65966115-65966137 CAAAATATTTTGTGGGAAGAAGG - Intronic
956336507 3:68170273-68170295 GTAAAAATTTTCTGGGAAGAGGG - Intronic
956515997 3:70048817-70048839 CTAAGAAATTTGAGAGAAGACGG + Intergenic
956531102 3:70220156-70220178 ATTAAAATTTTGAGAGAATAAGG + Intergenic
956561537 3:70582060-70582082 CTGGAAGTTTTGAGGGAAACTGG - Intergenic
957641279 3:82856512-82856534 CTGAAAATTTTATGGGAGGTAGG - Intergenic
958061851 3:88493972-88493994 CTTAAAATTTGCAAGGAAGATGG - Intergenic
958838501 3:99173468-99173490 ATGAAATTTTGGAGGAAAGAAGG - Intergenic
958885338 3:99720334-99720356 TGGAAAATTTTCAGGGAAGGAGG + Intronic
959147215 3:102563620-102563642 CTGAAATTTTTCAGGCTAGAGGG - Intergenic
960291953 3:115896805-115896827 CTTTCAAATTTGAGGGAAGAGGG + Intronic
960307572 3:116080590-116080612 CTGAAACTTTTTAGTTAAGATGG - Intronic
960847800 3:122021125-122021147 CTGACAACTTAGAGGTAAGAGGG + Intronic
960854861 3:122092499-122092521 GTTAAAATTTTGAGGGGAGGTGG - Intronic
960929003 3:122825097-122825119 CTAAAAATGTTAAGGGTAGAAGG - Intronic
961075445 3:123977755-123977777 CTGAAAATTTTGAGGGAAGATGG - Intronic
961308241 3:125974761-125974783 CTGAAAATTTTGAGGGAAGATGG + Intronic
961500392 3:127328464-127328486 CTGGAAAATTGGAGGAAAGAGGG + Intergenic
961973670 3:130997983-130998005 ATGAAAATTTAGAGAGAAGTTGG + Intronic
962137744 3:132755258-132755280 CTGAGAACTTTGATAGAAGAGGG + Intergenic
963079035 3:141374354-141374376 CTGAAACCTTTGAGGAATGATGG + Intronic
963337190 3:143988638-143988660 CTTATGATTTTGAGGTAAGAGGG - Intronic
963399543 3:144780223-144780245 TTGAAAATTTTTAAGAAAGAAGG - Intergenic
963470827 3:145739832-145739854 CTGAAATTCTGAAGGGAAGAAGG + Intergenic
963586565 3:147197844-147197866 CTGAAAATTATGAAGGATGCTGG + Intergenic
964142851 3:153422916-153422938 ATGGAACTTTGGAGGGAAGAAGG - Intergenic
964373961 3:156031336-156031358 CTGAAAATCTTGACAGAGGAGGG + Intergenic
965125682 3:164626585-164626607 ATGAAGGTTTTCAGGGAAGAAGG - Intergenic
965186439 3:165471367-165471389 GTGAAAATTCTGAGGGAGGAAGG + Intergenic
965545482 3:169911292-169911314 CTGAAACATTTGATGAAAGATGG - Intergenic
965680918 3:171250392-171250414 CTGAATATTTTGGGGGACTAGGG - Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967448997 3:189601219-189601241 CTGAGAATTTCGCGGGGAGAGGG + Intergenic
968277884 3:197454853-197454875 CTGAATATTCTGGGGAAAGAAGG + Intergenic
968444788 4:646379-646401 CTGAAAACCTCGAGGGAAGCTGG - Intronic
969193715 4:5544088-5544110 CTGAAATCTATGAGAGAAGAGGG + Intronic
969409499 4:7018761-7018783 CTGAAAACTCTGTAGGAAGACGG - Intronic
969922046 4:10549681-10549703 ATGAAAAATTAGAGGGAAAACGG + Intronic
972256437 4:37360804-37360826 CTGCATATTTATAGGGAAGAGGG + Intronic
972977536 4:44655508-44655530 CTGAAAATATTTGGGGTAGAGGG - Intronic
973073988 4:45900081-45900103 CAGATAATTTTGTAGGAAGAGGG + Intergenic
973110030 4:46387521-46387543 CAGAAACTTTTGAGGCTAGAGGG - Intronic
974448733 4:62022159-62022181 CTAAAACTTTTGAGGCAATAAGG - Intronic
974974764 4:68876902-68876924 TTGAAAATTATGAGGCAACATGG - Intergenic
974977166 4:68905658-68905680 CTGCAAAATTTAAGGGAAGGCGG - Intergenic
974988512 4:69058507-69058529 CTGCAAAGTTTAAGGGAAGGCGG + Intronic
975766947 4:77678441-77678463 ATGAAAATATTGGGGGAGGAGGG + Intergenic
975911673 4:79274352-79274374 CTGAAATTTATGAAGCAAGAAGG + Intronic
976036288 4:80825558-80825580 CAGAAACTTTTGAGGTCAGAAGG + Intronic
976077090 4:81312144-81312166 CTGAGGATTTGGAGGCAAGAAGG + Intergenic
976535585 4:86211392-86211414 CAGAAACTTTGGAGGGCAGAAGG + Intronic
977149282 4:93489234-93489256 CTGAAAAAATTGAAGGAAGACGG + Intronic
978214691 4:106185358-106185380 CTTAAAATTTCGTGGTAAGAGGG - Intronic
978534993 4:109751287-109751309 CTTACACTTTTGAAGGAAGAGGG + Intronic
978999696 4:115200930-115200952 ATGAAATTTTTCAGGGAAGTGGG + Intergenic
979976596 4:127204300-127204322 ATGAAAAGATTGTGGGAAGAGGG + Intergenic
979994407 4:127413149-127413171 AAGAAAATTTAGAGGAAAGAAGG - Intergenic
980315904 4:131199961-131199983 CTTAATATTTTGAGAGAACAAGG - Intergenic
981057640 4:140381868-140381890 TAGAAAATTTTGAGGAAAAATGG + Exonic
981409377 4:144410835-144410857 CTGAAGTTTTGGAGGGAAGAGGG - Intergenic
981908185 4:149947430-149947452 TTTATAATTTTGAGGTAAGAAGG + Intergenic
981923239 4:150109952-150109974 CTGAAAAGTGTGAAGAAAGAAGG + Intronic
982688245 4:158518475-158518497 CTTAAGGTTGTGAGGGAAGATGG + Intronic
982819147 4:159924789-159924811 CTGATGATTTTGAGCAAAGAAGG + Intergenic
984240679 4:177215796-177215818 CTGAGAATTTTAAGGGGACATGG + Intergenic
984725699 4:183018468-183018490 CTGATTATTTTGACAGAAGATGG + Intergenic
986345238 5:6828719-6828741 CTGAAATTTTAGAGGGACAAAGG + Intergenic
986425730 5:7629492-7629514 TATAAGATTTTGAGGGAAGAAGG + Intronic
986888480 5:12270268-12270290 CTGAAAGTATTGAGGAAAAAGGG + Intergenic
987573801 5:19701553-19701575 TTCTAAATTTTGAGGGAATATGG - Intronic
987639328 5:20592059-20592081 CTAAAAATTTTGAATGATGATGG + Intergenic
987825456 5:23025108-23025130 TTGAAAGTTTTGGTGGAAGACGG - Intergenic
988720830 5:33877604-33877626 GTGAAAATGTTGATGGGAGAAGG + Intronic
989502484 5:42184589-42184611 CTGAACATTTTGAGAGGAGAGGG - Intergenic
989658189 5:43768066-43768088 CTGAAGATTTCTGGGGAAGAGGG + Intergenic
990196133 5:53318528-53318550 ATGAGAGTTTTTAGGGAAGAAGG + Intergenic
990292985 5:54373667-54373689 CAGAAACTTTGGAGGTAAGAAGG - Intergenic
991521540 5:67503605-67503627 TTGAAAATGATGGGGGAAGATGG + Intergenic
991593661 5:68280101-68280123 CAGAATGTGTTGAGGGAAGATGG + Intronic
992367829 5:76111480-76111502 CTGAAAATATTCAGGGTGGAGGG - Intronic
995277689 5:110295496-110295518 TTGAAAAATTAGAGGGAAAAGGG - Intronic
995282811 5:110354876-110354898 CTTAGAATTTTGTGGGGAGAAGG + Intronic
995648466 5:114340488-114340510 TTGATAATTTTAATGGAAGATGG - Intergenic
995768375 5:115643494-115643516 CTGAGAATCTTGGGGGAAGGTGG + Intergenic
996770211 5:127077774-127077796 CTGACACTGTTGAGGAAAGATGG + Intergenic
997546647 5:134713600-134713622 CTTAAGATTTTAATGGAAGAAGG - Intronic
998735222 5:145130406-145130428 CTCAAAATTATTAGGAAAGAGGG + Intergenic
1000111562 5:158113019-158113041 CTGAAAATTATGGGTGAAGTGGG - Intergenic
1000716656 5:164652783-164652805 AAGAAAATTTTAAGGGATGATGG - Intergenic
1000718203 5:164673629-164673651 CTTAAACTTTTGTGGGAATAAGG + Intergenic
1001804448 5:174571241-174571263 CTGCAAATCCTGAGGCAAGAAGG - Intergenic
1003256162 6:4476741-4476763 AAGAAAATTTAGAGGGAAGAAGG - Intergenic
1003391673 6:5718665-5718687 CTGCAAATTGGGAGGGAAAAGGG - Intronic
1003396095 6:5753220-5753242 CTGCAAACTTTGAAGAAAGATGG + Intronic
1003605393 6:7555452-7555474 CTGAAATATTTGGGGGTAGAAGG + Intronic
1003770264 6:9291353-9291375 CTGAATTTATTGAGGGAAGGGGG - Intergenic
1004841463 6:19590676-19590698 CTAAAAATTTTAATGCAAGAGGG - Intergenic
1004917487 6:20345561-20345583 CTGCAAATTGTGGGAGAAGACGG + Intergenic
1005287594 6:24345413-24345435 CTGAAAAGTTTGTGGGAACCCGG - Intronic
1005410179 6:25536747-25536769 TTGAAATTTATGGGGGAAGAAGG + Intronic
1005467248 6:26127119-26127141 CTGAAGAATTTAAGGGAAGGAGG + Intronic
1005479591 6:26242561-26242583 CTGAAAATATCTTGGGAAGAGGG - Intergenic
1006374509 6:33664403-33664425 CTGAAACTCTTGGGGGTAGATGG + Intronic
1006871325 6:37254854-37254876 ATGAAAATTTTGGGGGAGGGGGG + Intronic
1007527896 6:42512718-42512740 CTGAAGATTCTAAGGGAAGTAGG - Intergenic
1007868725 6:45007429-45007451 ATGAAAATTATGAGGGAAAAAGG - Intronic
1007895584 6:45354036-45354058 TTAAAAATTGTCAGGGAAGATGG + Intronic
1008026325 6:46640218-46640240 CTGTAGATTTTGAGGGAGAAGGG - Intronic
1008353356 6:50519936-50519958 CTCAAAATTTTGAGTTAGGAAGG - Intergenic
1008427336 6:51374658-51374680 TTAAAAATTTGGAGGGAAGAAGG + Intergenic
1008904482 6:56661438-56661460 CTGTAAAGCTTGAGGGAAGATGG - Intronic
1009397229 6:63213543-63213565 ATGAGAATTTCCAGGGAAGAAGG - Intergenic
1009860103 6:69317704-69317726 CAGAAGATTCTGAGGAAAGAAGG - Intronic
1010116845 6:72322844-72322866 CTGGAAATTGTGAGGGTGGAAGG + Intronic
1012066916 6:94559665-94559687 ACGAAAATGTGGAGGGAAGAAGG + Intergenic
1013088110 6:106874026-106874048 CTGAAAAGAGTGTGGGAAGAAGG - Intergenic
1013868751 6:114729782-114729804 ATGAAAATTTTGGGGGGAGATGG - Intergenic
1014573291 6:123038208-123038230 TTGAAAAGTTGGAGGGATGAGGG - Intronic
1014661155 6:124174010-124174032 CTGGCCATTTTGAGGCAAGAAGG + Intronic
1015236522 6:130977629-130977651 CTTAGAATTTTGGGGGAGGAGGG - Intronic
1015843710 6:137497132-137497154 CTGAAAACCCTTAGGGAAGAAGG - Intergenic
1019029798 6:169000398-169000420 CTATAAATTCTGAAGGAAGAGGG - Intergenic
1020647257 7:10829956-10829978 TTAAAACTTTTGAGGGAATACGG - Intergenic
1020690951 7:11353877-11353899 CTGTAAGTTTTGAGGGAGCAAGG + Intergenic
1020801527 7:12738590-12738612 GAGCAAATTTTGAGGTAAGAAGG - Intergenic
1020876017 7:13694654-13694676 TTGAAAATTTTGAGGTAATGGGG + Intergenic
1021066965 7:16187716-16187738 TTGGTAATTTTGAGGGAATATGG + Intronic
1022403844 7:30067746-30067768 CTGAAAATACTGAGTGAAGAAGG - Intronic
1023090014 7:36608827-36608849 CTGGACACTTTGAGAGAAGAGGG - Intronic
1023203918 7:37727854-37727876 CTGAAAATTATGAGGGATGCAGG - Intronic
1024426246 7:49229580-49229602 CTGAAGGTTTTCAGGGAAAATGG + Intergenic
1024785381 7:52901499-52901521 TTGACAATTTTGAGGGATGTGGG + Intergenic
1025789096 7:64671217-64671239 CTGAAAACTTAGAGGAAAGGAGG + Intronic
1027724840 7:81791036-81791058 CTGGGAATCTTCAGGGAAGAGGG - Intergenic
1028918116 7:96282091-96282113 CTGAAAATTGCAAGGGAGGAAGG - Intronic
1029950002 7:104573767-104573789 ATGATAATGTTGAGAGAAGAGGG - Intronic
1032878331 7:136062064-136062086 GTGAAAAGCTTGAGGGAAGTAGG - Intergenic
1033003901 7:137539134-137539156 CCTAAAATTAGGAGGGAAGAGGG + Intronic
1033379419 7:140799326-140799348 CAGAAAATTTAGGGTGAAGAAGG - Intronic
1033425070 7:141236534-141236556 CTGCAATATTTGAGGGAAGATGG - Intronic
1033832667 7:145272325-145272347 GTGAGAATCTTCAGGGAAGAGGG + Intergenic
1034617239 7:152429026-152429048 ATGAAATTATTGAGGGAAGGAGG - Intronic
1034694262 7:153039982-153040004 GCAAAAATTTTGTGGGAAGAAGG - Intergenic
1034878089 7:154742903-154742925 CTAAACATTTTGGGGGAGGAGGG - Intronic
1035170193 7:157013073-157013095 CTGAAAGCTTTGAGGGCAGCAGG - Intergenic
1035861728 8:3036291-3036313 CTGAAATTTTTGAGAGAGAAGGG - Intronic
1037274025 8:17157934-17157956 CGCAACATTTTGAGGTAAGATGG - Intronic
1037517998 8:19652938-19652960 CTGGAAAATTTGAGGGTAGAGGG - Intronic
1038495356 8:27998181-27998203 CTCATAATTTTGAGGGGAGAGGG - Intergenic
1038552772 8:28484248-28484270 CTGGAAATTAAGAGGGGAGAAGG - Intronic
1039591714 8:38755594-38755616 CTGAAAAGGCTGAGGCAAGAGGG + Intronic
1041556667 8:59164954-59164976 GGGAAAATTTTGAGGAAAAAAGG + Intergenic
1041576347 8:59400207-59400229 CAGAAATTTTTGAGGCCAGAAGG + Intergenic
1041746199 8:61211512-61211534 CTGAAATGTTTGTGGGATGAAGG + Intronic
1042737886 8:72009297-72009319 CTAAGAATTTTGGGGGAAGGAGG - Intronic
1043991362 8:86759608-86759630 CAGAAAATTATTAGAGAAGAAGG - Intergenic
1045833299 8:106490534-106490556 GTGCATATTTTTAGGGAAGATGG + Intronic
1046344732 8:112907939-112907961 CTGAAAATTTTGAATGATGCTGG - Intronic
1047205417 8:122799256-122799278 CTGCAAGGTTTGAGGGAAGTGGG + Intronic
1047265998 8:123309798-123309820 CTGTAAAGTTTCTGGGAAGATGG - Intergenic
1048518950 8:135136414-135136436 CTGAATGATGTGAGGGAAGAGGG + Intergenic
1050286520 9:4108401-4108423 ATGGAAACTCTGAGGGAAGAAGG + Intronic
1050343672 9:4665337-4665359 CTAAAAATTGTGCAGGAAGAAGG - Intronic
1050651382 9:7780623-7780645 CTGGAAGTTTTTAGGAAAGAGGG + Intergenic
1051653712 9:19356652-19356674 AAGAAAACTGTGAGGGAAGAGGG - Intronic
1051786917 9:20755117-20755139 CTGAAAAGCTTGAGGGAAAAGGG - Intronic
1053458144 9:38247099-38247121 CGCAAAATTTGGAAGGAAGAAGG - Intergenic
1053559928 9:39181415-39181437 CTGAAAACTTTGAGGAACGTTGG - Intronic
1053824037 9:42001636-42001658 CTGAAAACTTTGAGGAACGTTGG - Intronic
1054137188 9:61437540-61437562 CTGAAAACTTTGAGGAACGTTGG + Intergenic
1054606537 9:67185728-67185750 CTGAAAACTTTGAGGAACGTTGG + Intergenic
1055266998 9:74505353-74505375 CTGAAATATTTTGGGGAAGATGG - Intronic
1055770393 9:79710636-79710658 CAGAAAGTTTTGCAGGAAGAAGG - Intronic
1055780968 9:79821214-79821236 CACAAAATTTTAAAGGAAGAGGG - Intergenic
1055836397 9:80447839-80447861 ATGAAAATTTTCAGGGAAAAAGG - Intergenic
1057865685 9:98678683-98678705 CTGAAAATTTGGAGGTGGGATGG - Intronic
1059153897 9:111973124-111973146 CTGAAAACTTGGAGAGATGAAGG - Intergenic
1059441579 9:114310454-114310476 TTAAAAATTGTGAGGAAAGATGG + Intronic
1060991673 9:127853335-127853357 CTGACAGATTTGGGGGAAGAGGG - Intronic
1203340125 Un_KI270320v1:4008-4030 CTGAAGACTTTGATGGAAAAGGG + Intergenic
1203403695 Un_KI270522v1:4008-4030 TTGAAAATTTTGTTGGAAGCGGG - Intergenic
1186046144 X:5538442-5538464 CTGCAGATTCTGAGAGAAGAGGG - Intergenic
1186357562 X:8803160-8803182 TTTAAAATGTTGAGGGAAGAAGG - Intergenic
1186617931 X:11208981-11209003 TTTAAAATGTTGAGGGAAGAAGG + Intronic
1187973746 X:24684349-24684371 GTGAAAATCTTGAAGGAAGTTGG + Intergenic
1188036463 X:25322954-25322976 GTGAAAATTTTGAGAGAAAAAGG - Intergenic
1189378081 X:40481220-40481242 ATGAAGAATTTGTGGGAAGATGG - Intergenic
1190407268 X:50100687-50100709 GTGAAAACATTGAGGAAAGAAGG + Intergenic
1192252725 X:69426227-69426249 CTGAAAATTTGGAGTGATGGAGG - Intergenic
1193028117 X:76867409-76867431 ATGAAGATTTTGAAGGAATAAGG + Intergenic
1193126188 X:77872713-77872735 CTGTAAAATTTCAGGAAAGAAGG - Intronic
1193249651 X:79274572-79274594 CTGAAAATATGAAGGGAATAAGG - Intergenic
1193500457 X:82267616-82267638 TTGTAATTTTTGAGGAAAGAAGG + Intergenic
1194007256 X:88510399-88510421 CTGAAGATTTTAAGGGACAATGG - Intergenic
1194014424 X:88601564-88601586 CTGAAAACTTTAAGGAGAGAAGG - Intergenic
1194155763 X:90386763-90386785 CAGAAACTTTGGAGGGAAAAAGG + Intergenic
1194183807 X:90746315-90746337 ATGCAAGTTTTGAGGGGAGAGGG + Intergenic
1194636687 X:96353254-96353276 CAGAAAATTTGGAGGCCAGAAGG + Intergenic
1194803049 X:98294928-98294950 CTGTAAGTTGTGAGGGCAGAGGG + Intergenic
1195835258 X:109107687-109107709 CTGAAAACTTCCAGAGAAGATGG - Intergenic
1196120361 X:112043733-112043755 CTGAAAACTTAGAGAGAAAATGG + Intronic
1196715232 X:118804630-118804652 CTGAAAATTTTAAAGCAAGGTGG + Intergenic
1197556900 X:127967012-127967034 CTGAAAATTATAAGGAAACAAGG + Intergenic
1197922368 X:131609016-131609038 CTGTAAGCTTTGAGGGAAGCAGG - Intergenic
1198543168 X:137662042-137662064 CTGAAGCTTCTGAAGGAAGATGG + Intergenic
1200502110 Y:3963706-3963728 CAGAAACTTTGGAGGGAAAAAGG + Intergenic
1200530403 Y:4328265-4328287 ATGCAAGTTTTGAGGGGAGAGGG + Intergenic
1200666985 Y:6037063-6037085 ATGAAAAGTTAGAGGGAACATGG - Intergenic
1201349650 Y:13025569-13025591 CAGAAAACTTGGAGGCAAGAAGG - Intergenic