ID: 961311354

View in Genome Browser
Species Human (GRCh38)
Location 3:126004003-126004025
Sequence CCTTTGGGAGGGAGGCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1428
Summary {0: 1, 1: 0, 2: 7, 3: 96, 4: 1324}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961311329_961311354 30 Left 961311329 3:126003950-126003972 CCCACCACTGCCTCACCCCTCTC 0: 1
1: 0
2: 6
3: 75
4: 677
Right 961311354 3:126004003-126004025 CCTTTGGGAGGGAGGCTGGGAGG 0: 1
1: 0
2: 7
3: 96
4: 1324
961311338_961311354 14 Left 961311338 3:126003966-126003988 CCCTCTCTGGGCTTTGGGTGCCA 0: 1
1: 3
2: 30
3: 85
4: 421
Right 961311354 3:126004003-126004025 CCTTTGGGAGGGAGGCTGGGAGG 0: 1
1: 0
2: 7
3: 96
4: 1324
961311330_961311354 29 Left 961311330 3:126003951-126003973 CCACCACTGCCTCACCCCTCTCT 0: 1
1: 0
2: 11
3: 123
4: 887
Right 961311354 3:126004003-126004025 CCTTTGGGAGGGAGGCTGGGAGG 0: 1
1: 0
2: 7
3: 96
4: 1324
961311337_961311354 15 Left 961311337 3:126003965-126003987 CCCCTCTCTGGGCTTTGGGTGCC 0: 1
1: 2
2: 2
3: 55
4: 415
Right 961311354 3:126004003-126004025 CCTTTGGGAGGGAGGCTGGGAGG 0: 1
1: 0
2: 7
3: 96
4: 1324
961311342_961311354 -6 Left 961311342 3:126003986-126004008 CCAACTTTGGGTCCCCTCCTTTG 0: 1
1: 1
2: 25
3: 267
4: 445
Right 961311354 3:126004003-126004025 CCTTTGGGAGGGAGGCTGGGAGG 0: 1
1: 0
2: 7
3: 96
4: 1324
961311334_961311354 20 Left 961311334 3:126003960-126003982 CCTCACCCCTCTCTGGGCTTTGG 0: 1
1: 0
2: 10
3: 123
4: 595
Right 961311354 3:126004003-126004025 CCTTTGGGAGGGAGGCTGGGAGG 0: 1
1: 0
2: 7
3: 96
4: 1324
961311332_961311354 26 Left 961311332 3:126003954-126003976 CCACTGCCTCACCCCTCTCTGGG 0: 1
1: 0
2: 7
3: 75
4: 647
Right 961311354 3:126004003-126004025 CCTTTGGGAGGGAGGCTGGGAGG 0: 1
1: 0
2: 7
3: 96
4: 1324
961311339_961311354 13 Left 961311339 3:126003967-126003989 CCTCTCTGGGCTTTGGGTGCCAA 0: 2
1: 15
2: 49
3: 118
4: 374
Right 961311354 3:126004003-126004025 CCTTTGGGAGGGAGGCTGGGAGG 0: 1
1: 0
2: 7
3: 96
4: 1324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961311354 Original CRISPR CCTTTGGGAGGGAGGCTGGG AGG Intergenic
900115114 1:1025022-1025044 CCTTTGTGAGGTGGGCTGGGAGG - Intronic
900139492 1:1133609-1133631 CCTGTGGAAGGGAGGCTGGGAGG - Intergenic
900482991 1:2908340-2908362 CGTTTGGGAGAGACGCTGGCCGG + Intergenic
900711925 1:4119828-4119850 CCTTGGGGATGAAGGCTTGGTGG + Intergenic
900740797 1:4329587-4329609 CGTTTGGGGAGGAAGCTGGGAGG - Intergenic
900823875 1:4910926-4910948 CCTGTGGGTGAGAGGCTGGAAGG + Intergenic
901027303 1:6285409-6285431 CCTTTTGCAGGGAGGAAGGGAGG - Intronic
901030548 1:6305028-6305050 CATCTGGGAGGGAGGCGGGGGGG - Intronic
901030700 1:6305380-6305402 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
901051802 1:6429090-6429112 TCTTGGGGAGGGAGGGAGGGAGG + Intronic
901106705 1:6762046-6762068 ACTTTGGAAGGGGGGGTGGGTGG - Intergenic
901152323 1:7112100-7112122 CCTTTGTAGGGGAGGCTGTGTGG + Intronic
901249553 1:7765781-7765803 ACTTTGGGAGGCTGGGTGGGCGG + Intronic
901271009 1:7952922-7952944 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
901290523 1:8120623-8120645 CCGTTGGGAAGGAGGCCGGAGGG - Intergenic
901368918 1:8779416-8779438 ACTTTGGGAGGCAAGGTGGGTGG + Intronic
901727057 1:11250276-11250298 CATCTGGGAGGGAGGTGGGGGGG - Intronic
902018735 1:13328616-13328638 CGTCCGGGAGGGAGGCGGGGGGG + Intergenic
902052716 1:13577007-13577029 CCCATTGGAGGGAGGCAGGGTGG + Intergenic
902694377 1:18130316-18130338 CCTGTGGGAAGAAGACTGGGAGG + Intronic
902754657 1:18541114-18541136 CCAGAGGCAGGGAGGCTGGGGGG - Intergenic
902908973 1:19581026-19581048 CCCTTGGGTGGGAGGCTGTTTGG - Intergenic
903081679 1:20816308-20816330 CGTCCGGGAGGGAGGCGGGGGGG + Intronic
903174975 1:21575379-21575401 CCTTTGGGAGGTAGGGAAGGGGG - Intronic
903526169 1:23994034-23994056 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
903579020 1:24357351-24357373 GCTCTGGGAGGGGAGCTGGGTGG - Exonic
903637902 1:24833838-24833860 CGTCCGGGAGGGAGGCGGGGGGG - Intronic
903663009 1:24990102-24990124 ACTGTGGGAGGCAGGCTCGGGGG + Intergenic
903921370 1:26803514-26803536 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
903923728 1:26818329-26818351 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
903924044 1:26819024-26819046 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
903962287 1:27064613-27064635 CGTCCGGGAGGGAGGCGGGGGGG + Intergenic
904050612 1:27635792-27635814 ACTTTGGGAGGTTGGGTGGGAGG + Intergenic
904077357 1:27852953-27852975 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
904111619 1:28130652-28130674 CTTTTTGTGGGGAGGCTGGGTGG - Intergenic
904197491 1:28796641-28796663 CATGAGGGTGGGAGGCTGGGGGG + Intergenic
904201665 1:28823771-28823793 ACTTTGGGAGGCCGGGTGGGTGG - Intronic
904248800 1:29207494-29207516 ACTTTGGGAGGCAAGGTGGGAGG + Intronic
904266982 1:29323801-29323823 CCTGTGGGAGGGCGGGTGGAGGG + Intronic
904532144 1:31176720-31176742 CATCTGGGAGGGAGGTGGGGGGG + Intergenic
904784434 1:32974273-32974295 CGTCCGGGAGGGAGGCGGGGGGG - Intergenic
904828932 1:33294527-33294549 TCTTAGGGAAGGAGGCTGGGTGG + Intronic
905182226 1:36174728-36174750 CCTGGGAGAGGGAGGGTGGGGGG - Intronic
905192148 1:36243879-36243901 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
905253314 1:36664181-36664203 CCATGGGGAGGGTGGCTGGAAGG + Intergenic
905599135 1:39234648-39234670 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
905803197 1:40858974-40858996 CCTTTTGGAGGGATGCAGGAGGG + Intergenic
906035973 1:42750634-42750656 CGTCCGGGAGGGAGGCCGGGGGG + Intronic
906064248 1:42968784-42968806 CATTTGGGGCTGAGGCTGGGAGG + Intergenic
906136184 1:43502098-43502120 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
906487185 1:46241887-46241909 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
906742001 1:48192634-48192656 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
906761512 1:48382636-48382658 CGTCCGGGAGGGAGGCGGGGGGG - Intronic
907172617 1:52483564-52483586 ACTTTGGGAGGCAGAGTGGGTGG + Intronic
907321150 1:53603162-53603184 GCTTTGGGAGGGAGGGAAGGGGG + Intronic
907402591 1:54233698-54233720 CGTCTGGGAGGGAGGTGGGGGGG + Intronic
907453577 1:54562096-54562118 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
907640910 1:56189457-56189479 TGTTTGGGAAGGAGGGTGGGAGG + Intergenic
908518033 1:64913614-64913636 CATTTGGGAGGGAGGGAGGGAGG + Intronic
909293044 1:73908900-73908922 CCTTTTTGGGGCAGGCTGGGGGG - Intergenic
910262091 1:85302713-85302735 TCTTTGAGGGGGAGGCTAGGAGG + Intergenic
910406869 1:86899595-86899617 CGTCTGGGAGGGAGGTTGGGGGG - Intronic
911179336 1:94847351-94847373 CCTTGAGGAGGGTGGCAGGGAGG + Intronic
911486640 1:98512769-98512791 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
912298272 1:108489433-108489455 CATCTGGGAGGGAGGTGGGGGGG - Intergenic
912845306 1:113070442-113070464 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
912921399 1:113870773-113870795 ACTTTGGGAGGCAAGATGGGAGG + Intronic
913222027 1:116667556-116667578 CCCCGGGGAGGGAGGCGGGGAGG - Intronic
913305781 1:117429438-117429460 CCTCCGGGAGGGAGGTGGGGGGG - Intronic
913305986 1:117429861-117429883 CATCTGGGAGGGAGGTGGGGGGG - Intronic
913338715 1:117734641-117734663 CCTCTGAGAGAGAGGCAGGGAGG - Intergenic
914426282 1:147580084-147580106 CCTATGGCATGGAGGCAGGGAGG - Intronic
914888253 1:151600962-151600984 CGTCCGGGAGGGAGGCGGGGGGG + Intergenic
914893747 1:151651235-151651257 CGTCTGGGAGGGAGGTCGGGGGG - Intronic
914893767 1:151651284-151651306 CATCTGGGAGGGAGGTAGGGGGG - Intronic
915411041 1:155701036-155701058 CCTCCGGGAGGGAGGTGGGGGGG + Intronic
915487831 1:156234341-156234363 CCTGTGGGAGAAAGGGTGGGTGG + Intronic
915602398 1:156930460-156930482 CTCTGGGGAGGGAGCCTGGGTGG + Intronic
915946435 1:160155746-160155768 GGATTGTGAGGGAGGCTGGGAGG - Intronic
915952034 1:160195875-160195897 CCTTTGGGAGAGGGGGTAGGAGG - Exonic
915972641 1:160365441-160365463 GCTTGAGGAGGGGGGCTGGGGGG - Intergenic
916212850 1:162372769-162372791 ACTTTGGGATGCAGGCTGGGTGG + Intronic
916739120 1:167632620-167632642 GGTTTGGGAGGGACGCAGGGAGG + Intronic
916824547 1:168431066-168431088 TCCTTGGGAGGGAGGATTGGTGG + Intergenic
916869829 1:168901609-168901631 CTTTTGAGAGGGAGGATGGAGGG - Intergenic
917375853 1:174349737-174349759 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
917423414 1:174888739-174888761 ACTTTGGGAGGCAAGGTGGGTGG - Intronic
917500771 1:175583163-175583185 CCTTAGGGAGGCAGTCTAGGGGG - Intronic
917553347 1:176058115-176058137 CCGTCGGGAGGGAGGTGGGGTGG + Intronic
917582834 1:176396081-176396103 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
917582959 1:176396384-176396406 CGTTCGGGAGGGAGGTGGGGGGG - Intergenic
917583104 1:176396736-176396758 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
917870961 1:179241405-179241427 ACTTTGGGAGGTAAGGTGGGAGG - Intergenic
917925748 1:179787876-179787898 TCTATGGGTGGGAGGCTGGGGGG - Intronic
918255319 1:182741884-182741906 CCTCCGGGAGGGAGGTGGGGGGG - Intergenic
918686125 1:187418112-187418134 GCTTTGGGAGAGATGGTGGGAGG - Intergenic
920268215 1:204742901-204742923 CCATGGGGAGGAAGACTGGGAGG + Intergenic
920504034 1:206504117-206504139 ACTTGGGGAGGGAGGCTGGGCGG + Intergenic
920717667 1:208356001-208356023 GCTTGGGGTGGGAGGCTGGATGG + Intergenic
920738765 1:208560233-208560255 GCTGTGGGAAGGAGGCAGGGAGG - Intergenic
920870879 1:209793715-209793737 CCTTGAGGACGGAGGGTGGGAGG - Intronic
921030317 1:211330482-211330504 TCTGTGGGAGGGAGGCAGGGAGG - Intronic
921044085 1:211460846-211460868 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
921072030 1:211668536-211668558 ACTTTGGGAGGTAAGATGGGAGG + Intronic
921140274 1:212299053-212299075 CGTCCGGGAGGGAGGCGGGGGGG - Intronic
921142342 1:212320579-212320601 CGTCCGGGAGGGAGGCGGGGGGG - Intronic
921142371 1:212320640-212320662 CATCCGGGAGGGAGGCGGGGAGG - Intronic
921142498 1:212320943-212320965 CGTCCGGGAGGGAGGCGGGGGGG - Intronic
921142551 1:212321070-212321092 CGTCCGGGAGGGAGGCGGGGGGG - Intronic
921414262 1:214869814-214869836 CATCTGGGAGGGAGGTGGGGGGG - Intergenic
921603932 1:217135299-217135321 CCTTTACGTGGGAGGCGGGGTGG - Intronic
921638428 1:217524081-217524103 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
922096571 1:222447949-222447971 CCTTTGGAAGGGAGAGTGGTTGG - Intergenic
922391124 1:225142682-225142704 TCTTTGGGAGGGAGGCCGGGTGG + Intronic
922424566 1:225481024-225481046 GCTGTGGGAGGCAGGCTTGGTGG - Intergenic
922547736 1:226471245-226471267 CCTGTGGGAGTGAGGCTATGGGG - Intergenic
922632924 1:227133197-227133219 CGTCTGGGAGGGAGGTGGGGGGG + Intronic
923267999 1:232332078-232332100 CGTCTGGGAGGGAGGCGGGGGGG + Intergenic
923711076 1:236387357-236387379 CCTCCGGGAGGGAGGTGGGGGGG + Intronic
923792930 1:237127418-237127440 CTTCTGGGAGGGAGGTGGGGGGG - Intronic
923903205 1:238352626-238352648 ACTTGGGCATGGAGGCTGGGAGG - Intergenic
924143318 1:241048472-241048494 CCTGTGGGTGAGAGGCTGGAAGG - Intronic
924448364 1:244155410-244155432 GCTTTAGGAGGGAGGGAGGGAGG + Intergenic
924883879 1:248190914-248190936 CCCTTGGGAGGCAGGCCTGGTGG - Intergenic
1062774618 10:135258-135280 CCTGAGCGAGGGAGGCTAGGCGG - Intronic
1062810240 10:458008-458030 CTTTCGGGCGGGTGGCTGGGCGG - Intronic
1062932281 10:1361189-1361211 CCTGGGGGAGGGGGGATGGGGGG - Intronic
1063664006 10:8051143-8051165 CCCCTGGGAGGGCGGGTGGGAGG + Intergenic
1063842996 10:10092658-10092680 CCTTTTTGAGGGAGGGTGTGTGG + Intergenic
1063938864 10:11107224-11107246 GTTTTGGGAAGGGGGCTGGGGGG + Intronic
1064108336 10:12519399-12519421 CGTCCGGGAGGGAGGCGGGGGGG - Intronic
1064220970 10:13440053-13440075 CCTTGGGGAGGGGGGTTTGGCGG + Intronic
1064555377 10:16542154-16542176 GCTTTGGGAGGCTAGCTGGGAGG - Intergenic
1064888925 10:20146527-20146549 CCTGAGGGAGGGAGGGAGGGAGG - Intronic
1064894381 10:20217555-20217577 CCTTCTGTAGGGAGGCTGGTGGG - Exonic
1065183044 10:23145909-23145931 CCTTTCGCCGGGCGGCTGGGTGG + Intergenic
1065336012 10:24656501-24656523 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
1065336429 10:24657411-24657433 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
1065592310 10:27276916-27276938 CCTTAAGGATGGAGGGTGGGAGG + Intergenic
1066085390 10:31970035-31970057 CGTCCGGGAGGGAGGCCGGGGGG + Intergenic
1066086958 10:31980477-31980499 ACTTGGGGAGGGAGGGTGGGAGG - Intergenic
1067129131 10:43545783-43545805 GATTTGGAAGGGAGGGTGGGTGG - Intergenic
1067446576 10:46352701-46352723 TTTTTGGGGGGGAGGGTGGGTGG - Intergenic
1067574458 10:47400428-47400450 ACAGTGGGAGGGAGGCTGTGGGG + Intergenic
1068005942 10:51392863-51392885 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
1068969826 10:62948285-62948307 CGTCCGGGAGGGAGGCGGGGGGG + Intergenic
1069578224 10:69545458-69545480 GCCTGGGGAGGGAGGCTGAGGGG + Intergenic
1069680907 10:70284266-70284288 GCTTCGGGAGGGAGGCAGGGGGG + Intergenic
1069698910 10:70407734-70407756 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
1069733029 10:70631359-70631381 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1069741287 10:70687691-70687713 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
1069834114 10:71297837-71297859 CCAAGGGGAGGGAGGCTGGAGGG + Intronic
1069846882 10:71378338-71378360 CCTTTGGCTGGGAGACAGGGTGG - Intergenic
1069928860 10:71869469-71869491 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
1069929983 10:71875780-71875802 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
1069930007 10:71875829-71875851 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
1070010339 10:72467425-72467447 ACTTTGGGAGGAAGAGTGGGTGG - Intronic
1070082467 10:73202636-73202658 CGGTTGGGAGGGAGGGAGGGAGG - Intronic
1070183935 10:74041646-74041668 ACTTTGGGAGGCAAGGTGGGTGG + Intronic
1070602171 10:77873587-77873609 TCTATGGGAGGGGGCCTGGGAGG - Intronic
1070777432 10:79118039-79118061 CCTCAGGGATGGAGGCTGTGTGG - Intronic
1070862140 10:79679595-79679617 CCTCTGGGAGGGTGGATGGTGGG - Intergenic
1070874997 10:79794861-79794883 CCTCTGGGAGGGTGGATGGTGGG + Intergenic
1070966648 10:80534601-80534623 CGTCCGGGAGGGAGGCGGGGAGG + Intergenic
1070966770 10:80534875-80534897 CATCCGGGAGGGAGGCGGGGAGG + Intergenic
1071641921 10:87317026-87317048 CCTCTGGGAGGGTGGATGGTGGG + Intergenic
1072013320 10:91323171-91323193 CCTCCGGGAGGGAGGTGGGGGGG - Intergenic
1072117128 10:92376354-92376376 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
1072117304 10:92376742-92376764 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
1072149680 10:92674694-92674716 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
1072149955 10:92675320-92675342 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
1072180419 10:92975599-92975621 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
1072602158 10:96941066-96941088 CGTCCGGGAGGGAGGCGGGGGGG - Intronic
1072684429 10:97528578-97528600 CGTTCGGGAGGGAGGTGGGGGGG - Intronic
1072949317 10:99838157-99838179 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
1073000075 10:100278144-100278166 CGTCTGGGAGGGAGGTGGGGGGG + Intronic
1073019583 10:100431851-100431873 ACTTTGGGAGGCCGGGTGGGGGG - Intergenic
1073374482 10:103021233-103021255 CCTTCGTCAGGGAGGCTGTGGGG - Intronic
1073410300 10:103336020-103336042 ACTTTGGGAGGCAAGGTGGGTGG + Intronic
1074073740 10:110100696-110100718 TCTTTGTGAGGCATGCTGGGAGG - Exonic
1074152021 10:110767168-110767190 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
1074202096 10:111246593-111246615 CCTTTAGGAGGGAAACTGGAGGG + Intergenic
1074445451 10:113517809-113517831 CCCATGGGAGGGAGTGTGGGTGG + Intergenic
1074766356 10:116702830-116702852 CATTTTGGAGGGAGGTTGGTTGG - Intronic
1074779902 10:116794567-116794589 ACTTTGGGAGGCAAGGTGGGTGG + Intergenic
1074815347 10:117137921-117137943 CCTTGAGGAAGGCGGCTGGGAGG + Exonic
1075137133 10:119795133-119795155 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
1075595191 10:123724079-123724101 CTCCTGGCAGGGAGGCTGGGTGG - Intronic
1075632707 10:124010841-124010863 CCATAGGGAGGAGGGCTGGGAGG + Intronic
1075764117 10:124879326-124879348 CCTTGAGGAGGGAGGGTGTGGGG - Intergenic
1075927313 10:126262838-126262860 CCTGTGGGTTGGAGGCAGGGTGG - Intronic
1075988843 10:126815208-126815230 ACTTTGGGAGGCAAGGTGGGTGG + Intergenic
1076633841 10:131870018-131870040 CCTTCGGCAGGGAGGTGGGGAGG + Intergenic
1076695319 10:132244524-132244546 CCCTGGGGAGCGAGGCTGGCGGG - Intronic
1076984713 11:226994-227016 ACTTTGGGAGGCCGGGTGGGTGG - Intronic
1077182779 11:1223982-1224004 TCTGTGGAAGGGAGGCTGGGTGG + Intronic
1077213204 11:1382970-1382992 CCTTGGTGAGGGAGACGGGGCGG + Intergenic
1077213524 11:1384360-1384382 CCTTTGGGTGGGTGGGTGGGTGG - Intergenic
1077231467 11:1459803-1459825 GATGTGGGAGGCAGGCTGGGGGG - Intronic
1077306730 11:1871915-1871937 CTTTTGGGAGGGGGGGTGTGTGG + Intronic
1077306924 11:1872666-1872688 CCTTTGGGAGGGGGTGTGTGTGG + Intronic
1077308859 11:1879727-1879749 ACTTAGGGAGGGAGGCAGGCTGG + Intronic
1077352032 11:2097515-2097537 CCGCTGCGGGGGAGGCTGGGAGG + Intergenic
1077531909 11:3101374-3101396 CCTTTTGTAGGGACGCTGTGGGG - Intronic
1077552100 11:3205018-3205040 CCTGAGGGAGGGTGGCTCGGGGG + Intergenic
1078175062 11:8964179-8964201 CCGTCAGGAGCGAGGCTGGGCGG + Intronic
1078986358 11:16603518-16603540 CCTTTGGGAGTGGGGGTGGGAGG + Intronic
1079020765 11:16907497-16907519 CGTCCGGGAGGGAGGCGGGGAGG + Intronic
1079020789 11:16907546-16907568 CGTCCGGGAGGGAGGCGGGGGGG + Intronic
1079444964 11:20548855-20548877 CGTCCGGGAGGGAGGCGGGGGGG + Intergenic
1079580640 11:22059571-22059593 CCTTTGGGAGGCACTTTGGGAGG - Intergenic
1080098181 11:28430709-28430731 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1080605866 11:33864554-33864576 CCCTCGGAAGGGAGGCTGGGTGG - Intronic
1080606856 11:33870596-33870618 CCAGAGGGAGGGTGGCTGGGAGG + Intronic
1080860232 11:36145091-36145113 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
1080860256 11:36145140-36145162 CATCTGGGAGGGAGGTGGGGGGG + Intronic
1080860357 11:36145366-36145388 CGTCTGGGAGGGAGGTGGGGGGG + Intronic
1080875653 11:36271969-36271991 CCTGTTGGTGGGTGGCTGGGTGG + Intergenic
1081288946 11:41304557-41304579 CGTCTGGGAGGGAGGTGGGGGGG + Intronic
1081288970 11:41304606-41304628 CGTCTGGGAGGGAGGTGGGGGGG + Intronic
1081288990 11:41304655-41304677 CATCCGGGAGGGAGGTTGGGGGG + Intronic
1081289038 11:41304753-41304775 CGTCTGGGAGGGAGGTGGGGGGG + Intronic
1081784623 11:45738211-45738233 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
1081934915 11:46898007-46898029 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
1081950202 11:47038157-47038179 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
1082010718 11:47448249-47448271 GCTTTGGGTGTGAGGCTGGGGGG - Intronic
1083030283 11:59585527-59585549 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
1083091073 11:60201022-60201044 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
1083208224 11:61166391-61166413 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
1083625741 11:64071204-64071226 TCTTAGGGAGGAAGGCTGGGAGG - Intronic
1083731196 11:64653613-64653635 ATTTAGGGAGGGAGGCTGGGAGG - Intronic
1083865652 11:65451607-65451629 CGTTCGGGAGGGAGGTGGGGGGG + Intergenic
1083865726 11:65451783-65451805 CGTTCGGGAGGGAGGTGGGGGGG + Intergenic
1083922865 11:65789893-65789915 CCTTGGGGAGAGAGGCTGATGGG - Intronic
1084049035 11:66588054-66588076 CATCTGGGAGGGAGGTGGGGGGG + Intergenic
1084049088 11:66588182-66588204 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1084510923 11:69603159-69603181 CCTTTGGGAGCGAGGCTGCTGGG + Intergenic
1084624398 11:70295740-70295762 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
1084745486 11:71167419-71167441 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
1085043992 11:73343040-73343062 CCTTAGGGAGCGAGAGTGGGAGG + Intronic
1085116438 11:73936220-73936242 CGTCTGGGAGGGAGGTTGGGGGG - Intergenic
1085116608 11:73936621-73936643 CATCTGGGAGGGAGGTGGGGGGG - Intergenic
1085563284 11:77490441-77490463 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1085729443 11:78983781-78983803 CCTGTGGGGGTGGGGCTGGGTGG + Intronic
1086017280 11:82182176-82182198 CATCTGGGAGGGAGGTGGGGGGG + Intergenic
1086417742 11:86606075-86606097 CTTTGGGGAGGGAGGAGGGGTGG - Intronic
1087901739 11:103649106-103649128 GCTTGGGGAGGGAGGAAGGGGGG + Intergenic
1088257159 11:107912660-107912682 CGTTCGGGAGGGAGGTGGGGGGG + Intronic
1088363805 11:109018166-109018188 CATTGGGGAGGGAGGCATGGTGG + Intergenic
1088820660 11:113453924-113453946 CCTTTTGATGGGGGGCTGGGGGG + Intronic
1089203754 11:116741443-116741465 ACTTTGGGAGGCAAGGTGGGCGG + Intergenic
1089375859 11:117994173-117994195 GCATGGGGAGGGAGACTGGGAGG + Intronic
1089420849 11:118331319-118331341 CATCTGGGAGGGAGGTGGGGGGG - Intergenic
1089690673 11:120185035-120185057 CCTTTGGCATGGAGGCAGAGGGG + Intronic
1089795851 11:120980285-120980307 CCCTGTCGAGGGAGGCTGGGTGG - Intronic
1090745982 11:129705082-129705104 CCTGTGGTAGGGAGGCTCAGTGG + Intergenic
1090799342 11:130160625-130160647 CCTTTGGGAAGGCGGCTGTATGG + Intronic
1090847892 11:130546070-130546092 ACCTTGGGAGGCAGGCTTGGAGG + Intergenic
1091393813 12:141646-141668 CCTGGGGGAGGGGGGCTGAGGGG - Intronic
1091845822 12:3655724-3655746 CCTCCAGGAGGCAGGCTGGGTGG - Intronic
1092260339 12:6950272-6950294 CCCTAGGGAGGGAAACTGGGTGG - Intronic
1094238953 12:28200957-28200979 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
1095439953 12:42228772-42228794 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
1095724604 12:45437811-45437833 ACTTTGGGAGGCAAGGTGGGTGG - Intronic
1095999942 12:48120905-48120927 ACTTTGGGAGGCAAGGTGGGCGG + Intronic
1096167287 12:49436403-49436425 CCTCCGGGAGGGAGGTGGGGGGG - Intronic
1096441120 12:51645012-51645034 CGTCTGGGAGGGAGGTGGGGGGG + Intronic
1097028460 12:56075741-56075763 CGTCGGGGAGGGAGGTTGGGGGG - Intergenic
1097149219 12:56963884-56963906 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1097954851 12:65473556-65473578 CCTTTGGGAGGCAAGATGGGAGG - Intronic
1097996989 12:65898707-65898729 GATTTGGCAGGGAGGCTAGGAGG - Intronic
1098019233 12:66135419-66135441 CGTCTGGGAGGGAGGTGGGGGGG + Intronic
1098161092 12:67648817-67648839 CCTATGTGAGGGAGACGGGGAGG + Exonic
1098335317 12:69398567-69398589 ACTTTGGGAGACAGGGTGGGTGG + Intergenic
1098412684 12:70202109-70202131 CATCCGGGAGGGAGGCGGGGGGG + Intergenic
1098413008 12:70202824-70202846 CGTCCGGGAGGGAGGCGGGGGGG + Intergenic
1098438289 12:70492065-70492087 ACTTTGGGAGGCCGGGTGGGTGG - Intergenic
1098555609 12:71815618-71815640 ACTTTGGGAGGCAAGGTGGGTGG - Intergenic
1099397289 12:82156877-82156899 ACTTTGGGAGGCAAGGTGGGTGG - Intergenic
1100121488 12:91373854-91373876 AGCTTGGGAGGGAGGCTTGGGGG + Intergenic
1100302293 12:93319142-93319164 TATTTGGGAGGGTTGCTGGGGGG - Intergenic
1100570679 12:95841393-95841415 CGTCCGGGAGGGAGGCGGGGGGG - Intergenic
1100582428 12:95948344-95948366 CGTCTGGGAGGGAGGTGGGGGGG + Intronic
1100994985 12:100294260-100294282 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
1101380166 12:104207516-104207538 GCTGTGGCTGGGAGGCTGGGAGG - Intergenic
1101437480 12:104676701-104676723 CCTTAGGAAAGGAGGCAGGGAGG - Intronic
1101864106 12:108507385-108507407 CCTTTGGGAGCATGGCTGGCTGG - Intergenic
1102174667 12:110867130-110867152 CCTCCGGGAGGGAGGTGGGGGGG - Intronic
1102174869 12:110867580-110867602 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
1102186139 12:110950578-110950600 CGTCTGGGAGGGAGGTTGGGGGG - Intergenic
1102186250 12:110950823-110950845 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
1102280620 12:111615958-111615980 CCTTTGGGAGGCGAGGTGGGCGG - Intergenic
1102293959 12:111723325-111723347 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
1102294030 12:111723472-111723494 CGTCCGGGAGGGAGGCGGGGGGG - Intronic
1102418712 12:112787106-112787128 CTTATAGGAGGGAGGCTGGAGGG - Intronic
1102578823 12:113873040-113873062 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
1102687144 12:114734074-114734096 ACCTTGGGTGGGTGGCTGGGTGG - Intergenic
1102823147 12:115924933-115924955 CCAGTGGGAGGGCTGCTGGGTGG + Intergenic
1102960108 12:117086986-117087008 GCCTTGGGAGGGAGGCAGGGAGG + Intronic
1103131294 12:118470818-118470840 ACTTTGGGAGGTGGGGTGGGCGG + Intergenic
1103197332 12:119056109-119056131 CTTGTGGGAGGGAGGCTGAGAGG - Intronic
1103351582 12:120287410-120287432 CCAGTGGGTGGGAGGGTGGGTGG + Intergenic
1103362748 12:120363353-120363375 CCCTAGGGAGGGAGGCAGGAAGG - Intronic
1103457393 12:121076936-121076958 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1103457417 12:121076985-121077007 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1103874042 12:124113672-124113694 CCTTTGGGAGGATGGCTGAAAGG - Intronic
1104269154 12:127266767-127266789 CCCTGGGCAGGGAGGCTGTGGGG + Intergenic
1104320633 12:127747639-127747661 CCTCAGGGAGGGAGGGAGGGAGG - Intergenic
1104423567 12:128656790-128656812 GCTTTGGGAGGTGGGTTGGGAGG - Intronic
1104712554 12:130996662-130996684 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
1104712687 12:130996965-130996987 CATCCGGGAGGGAGGTTGGGGGG - Intronic
1104757079 12:131276038-131276060 GCCCTGGGAGGGAGGCTGGTGGG + Intergenic
1104802735 12:131565727-131565749 CCTCTGCGAGGGAGGTGGGGAGG + Intergenic
1105039712 12:132953229-132953251 TCTTGGGGAGAGAGACTGGGTGG - Intronic
1105248527 13:18674067-18674089 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1105527065 13:21186596-21186618 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
1105805598 13:23950236-23950258 GCACTAGGAGGGAGGCTGGGAGG - Intergenic
1105980364 13:25512689-25512711 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
1106033712 13:26025321-26025343 CCCTTGAGAGGGAGGCTCAGAGG - Exonic
1106188001 13:27425550-27425572 CCTTGGGGTGGGAGGCAGGTGGG + Intronic
1106388294 13:29309422-29309444 CCTGTGGGGTGGAGGATGGGGGG + Intronic
1106495398 13:30270233-30270255 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
1106559977 13:30839303-30839325 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
1106594872 13:31127433-31127455 CCTGAGGGTGGGAGGTTGGGTGG + Intergenic
1106680144 13:32000220-32000242 CGTTCGGGAGGGAGGTGGGGGGG + Intergenic
1106746892 13:32716649-32716671 CGTTTGGGAGGGAGGTGGGGGGG + Intronic
1106746966 13:32716826-32716848 TGTCTGGGAGGGAGGTTGGGGGG + Intronic
1107165847 13:37280426-37280448 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1107499064 13:40955708-40955730 CATCCGGGAGGGAGGCGGGGAGG + Intronic
1107499089 13:40955757-40955779 CGTCCGGGAGGGAGGCGGGGGGG + Intronic
1107499166 13:40955933-40955955 CGTCCGGGAGGGAGGCGGGGGGG + Intronic
1107848874 13:44550336-44550358 ACTTTGGGAGGCCGGGTGGGTGG + Intronic
1107874772 13:44780674-44780696 TCTTTGGGAGGCATGCAGGGAGG + Intergenic
1107968646 13:45620551-45620573 CTCTTGTGAGGGAGGCTTGGTGG + Intergenic
1108234546 13:48389759-48389781 CTCTAGGGAGGGAGGATGGGAGG - Intronic
1108608843 13:52064482-52064504 CGTCTGGGAGGGAGGTGGGGGGG + Intronic
1108822245 13:54367846-54367868 CTATAGGGATGGAGGCTGGGTGG + Intergenic
1109147239 13:58794757-58794779 CCTTTGGGTGGTAGACAGGGTGG + Intergenic
1109148411 13:58812590-58812612 ACTTGGGGAGGGAGTGTGGGAGG - Intergenic
1110269660 13:73575567-73575589 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
1111573420 13:90117693-90117715 ACTTTGGGAGGCAAGGTGGGCGG + Intergenic
1111978107 13:94988685-94988707 TCTTTTGCAGGGAGACTGGGAGG + Intergenic
1112147894 13:96722020-96722042 ACTTTGGGAGGTTGGATGGGCGG + Intronic
1112412989 13:99179771-99179793 TCATTGTTAGGGAGGCTGGGAGG - Intergenic
1113665839 13:112141888-112141910 ACTGTGGCTGGGAGGCTGGGAGG - Intergenic
1113665849 13:112141921-112141943 ACTGTGGCTGGGAGGCTGGGAGG - Intergenic
1114212712 14:20628998-20629020 CCTTGATGAGGGAGGCTGTGGGG - Intergenic
1114261497 14:21039997-21040019 CCTTTGGAGTGGAGGCTGGATGG - Intronic
1114427946 14:22637844-22637866 CGTCCGGGAGGGAGGCGGGGGGG + Intergenic
1114454068 14:22844222-22844244 TCTGTGGTAGGGCGGCTGGGTGG + Intronic
1114508049 14:23232769-23232791 CGTCTGGGAGGGAGGTGGGGGGG + Intronic
1114533556 14:23409742-23409764 CTGGTGGGAGGGGGGCTGGGAGG - Intergenic
1115259386 14:31437218-31437240 CGTCTGGGAGGGAGGTCGGGGGG - Intronic
1115703401 14:35977073-35977095 CGTCCGGGAGGGAGGCGGGGGGG - Intergenic
1115703473 14:35977241-35977263 CGTCCGGGAGGGAGGCGGGGGGG - Intergenic
1115847483 14:37555324-37555346 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
1116185935 14:41600944-41600966 CCTTTGGGAGGGTGGAAGGTGGG + Intergenic
1116191846 14:41674333-41674355 CATCTGGGAGGGAGGTGGGGGGG - Intronic
1116410838 14:44621510-44621532 CCTTTGCGAGGGAGACTAGAGGG - Intergenic
1116795500 14:49385457-49385479 CCTTTGGGAGGCAGGCCTGGTGG - Intergenic
1117215643 14:53549070-53549092 CCTATGGGAGGGAGGGTAGCGGG + Intergenic
1117277195 14:54203734-54203756 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1117298158 14:54397345-54397367 TCTTTGGCTGGGCGGCTGGGAGG - Intronic
1117596876 14:57333787-57333809 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1117596947 14:57333963-57333985 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1117763649 14:59058886-59058908 CGTCTGGGAGGGAGGCGGGGGGG - Intergenic
1117829032 14:59732512-59732534 CCCTTGGCTGGGAGGCAGGGGGG - Intronic
1117956792 14:61129414-61129436 CCTTTGGAAGGGAGGGAGAGGGG + Intergenic
1117982871 14:61359047-61359069 CCTTCAGGACTGAGGCTGGGAGG - Intronic
1118016392 14:61665408-61665430 ACTTTGGGAGGCAAGGTGGGTGG - Intergenic
1118341174 14:64895698-64895720 CGTCCGGGAGGGAGGCGGGGGGG - Intergenic
1118428401 14:65692235-65692257 CATCTGGGAGGGAGGTGGGGGGG - Intronic
1118428502 14:65692460-65692482 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
1119182625 14:72614911-72614933 CCTGGGGAAGGGAGGGTGGGAGG - Intergenic
1119299510 14:73560417-73560439 ACTTTGGGAGGCAAGTTGGGCGG + Intergenic
1119539242 14:75428036-75428058 CCTGCGGGAGGGACGCTCGGCGG + Intronic
1119594905 14:75925093-75925115 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
1119603089 14:75990619-75990641 CCTGGGGCAGGGAGGTTGGGAGG + Intronic
1119671119 14:76518933-76518955 GCTGTGGAAGGGAGGCTGGCAGG - Intergenic
1120015808 14:79471991-79472013 CCTTTGGGAGGGTGGAGGGTGGG - Intronic
1120790605 14:88577811-88577833 ACTTTGGGAGGCAAGGTGGGTGG - Intronic
1120957270 14:90093743-90093765 GCTCTGGGAGGATGGCTGGGAGG - Intronic
1121046258 14:90790602-90790624 CCTGTGGCAGGGAGGCGAGGAGG - Intronic
1121216824 14:92254911-92254933 CAAGTGGGAGGGAGGCTGGAGGG + Intergenic
1121232957 14:92371925-92371947 CCATTGGGAGAGAAGATGGGAGG - Intronic
1121257077 14:92538967-92538989 CCCCTGGGAGGGGGCCTGGGAGG - Intronic
1121473354 14:94173982-94174004 CGCTGGGGAGGGGGGCTGGGGGG - Intronic
1122101360 14:99412833-99412855 CCTTTTGGAGGGAGGCAACGGGG + Intronic
1122212422 14:100181289-100181311 CGTCCGGGAGGGAGGCGGGGGGG + Intergenic
1122372597 14:101236914-101236936 CCTTTGGGATGCACCCTGGGAGG - Intergenic
1122378928 14:101287762-101287784 CCTTTAGGAGAGAAACTGGGAGG - Intergenic
1122703717 14:103607331-103607353 CATTTGGAAGTGAGACTGGGTGG + Intronic
1122706873 14:103627462-103627484 ACTTTGGGAGGCCAGCTGGGAGG + Intronic
1122856573 14:104563048-104563070 CCTGAGGGAGGGAGGGAGGGAGG + Intronic
1122978280 14:105179917-105179939 CCTGAGGGAGGGAGGCAGGCAGG + Intronic
1123133484 14:106007012-106007034 CCTCTGGGAGTGGGGCTGGCTGG - Intergenic
1123135869 14:106026985-106027007 CCTCTGGGAGTGGGGCTGGCTGG - Intergenic
1123165227 14:106319690-106319712 CCTCTGGGAGTGGGGCTGGCTGG - Intergenic
1202937550 14_KI270725v1_random:105177-105199 CCTTTGGGAGGCCGCCGGGGTGG + Intergenic
1123583505 15:21737458-21737480 CCTCTGGGAGTGGGGCTGGCTGG - Intergenic
1123620155 15:22180061-22180083 CCTCTGGGAGTGGGGCTGGCTGG - Intergenic
1123693771 15:22861979-22862001 ACTTTGGGAGGCAAGGTGGGTGG - Intronic
1123907281 15:24933415-24933437 CCTAGAGGAGAGAGGCTGGGAGG + Intronic
1124020868 15:25921698-25921720 CCTTTTGGAGGGTGGGTGGGAGG - Intergenic
1124132544 15:27003858-27003880 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
1124373238 15:29115245-29115267 CCTGTGGGTGGGCGGGTGGGTGG + Intronic
1125079448 15:35656702-35656724 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1125079526 15:35656878-35656900 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
1125079551 15:35656927-35656949 CATCTGGGAGGGAGGCGGGGGGG + Intergenic
1125459437 15:39893914-39893936 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
1125482111 15:40088229-40088251 CCTTTAGCTGGGAGGCTGGCTGG + Exonic
1125573505 15:40739136-40739158 CCTTTGGGAGGGGGGATGTGGGG - Intronic
1125732290 15:41899947-41899969 CCCCTGGAAGGGAGGTTGGGAGG + Exonic
1125861688 15:43005453-43005475 CATCTGGGAGGGAGGTGGGGGGG + Intronic
1126195947 15:45932072-45932094 CCTTGAGGATGGAGGATGGGAGG - Intergenic
1126516972 15:49549966-49549988 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
1127154190 15:56110075-56110097 CGTCTGGGAGGGAGGTGGGGGGG + Intronic
1127154418 15:56110576-56110598 CGTCTGGGAGGGAGGTGGGGGGG + Intronic
1127154496 15:56110753-56110775 CGTCTGGGAGGGAGGTGGGGGGG + Intronic
1127154599 15:56111008-56111030 CGTCTGGGAGGGAGGTGGGGGGG + Intronic
1127584325 15:60366787-60366809 CGTCCGGGAGGGAGGCGGGGGGG + Intronic
1127649443 15:60992964-60992986 ACTTTGGGAGAGGGGGTGGGTGG - Intronic
1127914338 15:63442985-63443007 ACTTTGGGAGGAAGGCGGGTTGG - Intergenic
1128099215 15:64984594-64984616 ACTTTGGGAGGCAAGATGGGAGG - Intronic
1128502528 15:68237234-68237256 ACTTTGGGAGGCAGGGTGGGAGG + Intronic
1128520993 15:68374809-68374831 CCTTGCAGAGGGAGGCTGTGAGG - Intronic
1128586822 15:68859532-68859554 CATCTGGGAGGGAGGTGGGGGGG - Intronic
1128919211 15:71594892-71594914 CCTTTGGGAGGGAGGGATTGGGG + Intronic
1128970537 15:72101673-72101695 CGTCTGGGAGGGAGGTGGGGGGG + Intronic
1129114458 15:73357537-73357559 CCCTAGGAGGGGAGGCTGGGAGG + Intronic
1129242527 15:74260005-74260027 CCCTGAGGAGGGAGGCTGTGAGG + Intronic
1129431741 15:75504624-75504646 CGTCTGGGAGGGAGGTGGGGGGG + Intronic
1129669181 15:77597739-77597761 GCTCAGGGAGGGAGGCTGGAGGG - Intergenic
1129749361 15:78049796-78049818 ACTGTGGGAGGGAGGATGTGAGG - Intronic
1129793719 15:78360515-78360537 ACTGTGGGAGAGAGGCTGGCTGG - Intergenic
1129898073 15:79123141-79123163 TCTGTAGGAGGGAGGCTGTGAGG + Intergenic
1130098156 15:80871581-80871603 GGTATGGGAGGCAGGCTGGGCGG - Intronic
1130153854 15:81332902-81332924 CTGTGGGGAGGGAGGCTGGCGGG + Exonic
1130207129 15:81887610-81887632 CATTAGTGAGGGAGGATGGGTGG - Intergenic
1130228567 15:82079027-82079049 GCTCTGGGAGAGAGGTTGGGAGG - Intergenic
1130236775 15:82142482-82142504 CCTGTGGGAGGGAGGGATGGAGG + Intronic
1130428269 15:83822131-83822153 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
1130796417 15:87214521-87214543 CTCTTGGGAGGGAGGGAGGGAGG + Intergenic
1130946495 15:88553163-88553185 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
1131479258 15:92768155-92768177 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
1132032197 15:98447273-98447295 TCTTTGGGAGGGAGGAAGGACGG - Intronic
1132036962 15:98493029-98493051 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
1132288645 15:100684145-100684167 CCTTGAGGGTGGAGGCTGGGAGG - Intergenic
1132527133 16:422820-422842 ACTTTGGGAGGCAAGGTGGGCGG - Intergenic
1132622372 16:873929-873951 GCTCAGGGAGGGAGGCTGGACGG + Intronic
1132893073 16:2214106-2214128 CCCTGGGGCGGGAGGCTGGGGGG - Intronic
1133017311 16:2949997-2950019 CCTCTGGAAGGGCTGCTGGGGGG + Exonic
1133495036 16:6309726-6309748 CCCTACAGAGGGAGGCTGGGAGG + Intronic
1133762951 16:8814314-8814336 CATGTGGGAGGGAGGCAGAGGGG - Intronic
1135154461 16:20040693-20040715 CCTTTAGGAGGGAGGGAGAGAGG - Intronic
1135191486 16:20358150-20358172 GGTTTGGGATGGGGGCTGGGAGG + Intergenic
1135255743 16:20940304-20940326 ACTTTGGGAGGCAAGCCGGGAGG - Intronic
1135509390 16:23069053-23069075 TCTTTGCGAGTGAGCCTGGGTGG + Exonic
1135605483 16:23820722-23820744 ACTTTGGGAGGAAGAGTGGGAGG - Intergenic
1135668372 16:24354459-24354481 CCTTTTCCAGGGAGGCAGGGAGG + Intronic
1136202210 16:28697874-28697896 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
1136426374 16:30170311-30170333 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
1136449120 16:30342792-30342814 CCTTGGGGAGGGCAGGTGGGCGG - Intergenic
1136478389 16:30526795-30526817 CCTGTGCGGGGGAGGGTGGGGGG - Intronic
1136654495 16:31701833-31701855 TCTCTGGGAAGGAGGATGGGTGG + Intergenic
1136668599 16:31836614-31836636 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1136668623 16:31836663-31836685 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1136791067 16:32968520-32968542 CCTTTGTGGGGGAGGTGGGGGGG - Intergenic
1137333940 16:47529587-47529609 ACTTTGGGAGGCAAGGTGGGCGG - Intronic
1137493578 16:48952056-48952078 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
1137522976 16:49210338-49210360 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
1137552188 16:49445285-49445307 CCTCTCTGAGGGAGGCTCGGGGG + Intergenic
1138043599 16:53698652-53698674 CCGTCGGGAGGGAGGTGGGGGGG + Intronic
1138043645 16:53698750-53698772 CGTCTGGGAGGGAGGTGGGGGGG + Intronic
1138200863 16:55087363-55087385 CCTGGGGTAGGGAGGGTGGGTGG + Intergenic
1138400204 16:56739400-56739422 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
1138467019 16:57200539-57200561 CATCCGGGAGGGAGGCAGGGAGG - Intronic
1139543817 16:67639207-67639229 CCTGCTTGAGGGAGGCTGGGGGG + Intergenic
1139852867 16:69961439-69961461 CTCTTGGAAGGGAGGCTGTGCGG + Intronic
1139864639 16:70052143-70052165 CGTCCGGGAGGGAGGCGGGGGGG + Intergenic
1139881838 16:70184347-70184369 CTCTTGGAAGGGAGGCTGTGCGG + Intronic
1140347860 16:74232387-74232409 GCTTTGGGAGGCAAGGTGGGAGG - Intergenic
1140370672 16:74411159-74411181 CTCTTGGAAGGGAGGCTGTGCGG - Intronic
1140407731 16:74722105-74722127 CCCTTGGGAGGGAGGGTGGGAGG - Intronic
1140449632 16:75060293-75060315 ACTTTGGGAGGCAAGATGGGCGG - Intronic
1140581846 16:76240255-76240277 CCTTTGGGAGGGTGGAGGGTGGG + Intergenic
1140910468 16:79446666-79446688 GCTTTGGGAGGCAAGGTGGGAGG + Intergenic
1141365955 16:83443274-83443296 CCTCTGAGAAAGAGGCTGGGAGG + Intronic
1141388958 16:83648478-83648500 CTTCTGGGAGGGAGGAGGGGTGG - Intronic
1141445400 16:84054849-84054871 CCTGTGGGGTGGAGGCTCGGTGG + Intronic
1141449721 16:84090342-84090364 CATTTAGGAGGGAGGCAGGGAGG - Intronic
1141553592 16:84822113-84822135 CCTGTTGGGGTGAGGCTGGGAGG + Intronic
1141614487 16:85202684-85202706 CCCTTGGGAGGGGCCCTGGGGGG + Intergenic
1141635382 16:85311497-85311519 CATTGGGGAGGGAGGGAGGGAGG + Intergenic
1141976029 16:87517318-87517340 CCTGAGGGATGGAGGCGGGGTGG + Intergenic
1142018472 16:87765462-87765484 CCCTCTGAAGGGAGGCTGGGTGG - Intronic
1142046306 16:87927268-87927290 CCTTGGGGAGGGCAGGTGGGTGG + Intronic
1142122976 16:88396415-88396437 CCTCCTGAAGGGAGGCTGGGAGG + Intergenic
1142122985 16:88396442-88396464 CCTTATGAAGGGAGGCCGGGCGG + Intergenic
1142180002 16:88663714-88663736 TGTGTGGGAGGGAGGCTGTGCGG + Intergenic
1142752701 17:1998200-1998222 CCTTTGGGGGAGGGGCGGGGAGG + Intronic
1142766695 17:2068393-2068415 GGTCTGGCAGGGAGGCTGGGAGG - Intronic
1142818864 17:2448061-2448083 CGTCCGGGAGGGAGGCGGGGGGG + Intronic
1142834285 17:2573302-2573324 CCTTTGGGAGGCACTTTGGGAGG + Intergenic
1143093422 17:4463152-4463174 ACTTTGGGAGGCAAGGTGGGTGG + Intronic
1143352360 17:6298080-6298102 TCCCTGGGAGGGAGGCTGGGAGG - Intergenic
1143504590 17:7356645-7356667 CCTTAGAGCTGGAGGCTGGGAGG - Exonic
1143550094 17:7625332-7625354 ACTTTGGGAGGCAAGGTGGGTGG + Intronic
1143630397 17:8136229-8136251 ACTTTGGGAGGCTGGGTGGGGGG + Intergenic
1143954560 17:10658274-10658296 TCTTTGGGAGGATGGCTGGGTGG + Intergenic
1144383824 17:14730277-14730299 CTTTTGGGAGAGAGGGTGGAGGG - Intergenic
1144524611 17:15979672-15979694 CATTCGGGAGGGAGGTGGGGGGG - Intronic
1144536466 17:16095522-16095544 CATCCGGGAGGGAGGTTGGGGGG + Intronic
1144559744 17:16312089-16312111 CCTCCGGGAGGGAGGTGGGGGGG - Intronic
1144767965 17:17743244-17743266 CCATTGGGAGGCACTCTGGGAGG - Intronic
1145051527 17:19665732-19665754 CCTTTGGGACCTAGGCTAGGTGG + Intronic
1145206222 17:20985459-20985481 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
1145206246 17:20985508-20985530 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
1145266628 17:21382874-21382896 CCCTTGGGGTGGAGGCAGGGAGG - Intronic
1145276616 17:21435214-21435236 CAGTGGGGAGGGAGGCTGAGGGG + Intergenic
1145314457 17:21721102-21721124 CAGTGGGGAGGGAGGCTGAGGGG + Intergenic
1145684523 17:26639032-26639054 CCTCCGGGAGGGAGGTGGGGGGG + Intergenic
1145712912 17:26993079-26993101 CAGTGGGGAGGGAGGCTGAGGGG + Intergenic
1145919299 17:28598691-28598713 TCTTAGGGAGGGAGGAGGGGCGG - Intronic
1146137701 17:30337667-30337689 CTTATGGGAGGCTGGCTGGGTGG + Intergenic
1146198709 17:30836420-30836442 ACTTTGGGAGGCCGGGTGGGTGG - Intronic
1146215979 17:30979538-30979560 CGTCCGGGAGGGAGGCGGGGGGG - Intronic
1146229416 17:31095097-31095119 GCGTTGGCAAGGAGGCTGGGGGG - Exonic
1146444138 17:32922209-32922231 CGTCCGGGAGGGAGGCGGGGGGG - Intergenic
1146444214 17:32922386-32922408 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
1146444437 17:32922878-32922900 CGTCCGGGAGGGAGGCGGGGGGG - Intergenic
1146831158 17:36070583-36070605 CCCTCGGGAGGGAGGATGGGAGG + Intronic
1146883883 17:36458108-36458130 CCCTGGGGAGGTAGGGTGGGAGG - Intergenic
1146994235 17:37304398-37304420 CTTTTGGGAGGCAAGCGGGGTGG - Intronic
1147153339 17:38531096-38531118 CCTTTGTGGGGGAGGTGGGGGGG - Exonic
1147188814 17:38726940-38726962 CCTTTGGCACAGAGGCTGAGTGG + Exonic
1147359411 17:39921733-39921755 CCTTTGGGATGTGGGCAGGGAGG - Intronic
1147430353 17:40366968-40366990 CCCTTGGGAGTGGGCCTGGGTGG + Intergenic
1147650285 17:42058193-42058215 TCTGTGGGAGGGAGACTGGGGGG - Intronic
1147974491 17:44238899-44238921 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1147985032 17:44301058-44301080 ACTTTGGGAGGCAAGGTGGGTGG + Intergenic
1148085039 17:44988678-44988700 GGTTAGTGAGGGAGGCTGGGGGG - Intergenic
1148129253 17:45253229-45253251 CCTGGGGGAGGGAGAATGGGAGG - Intergenic
1148389347 17:47259336-47259358 TTTTTGGGAGGGTGGGTGGGTGG + Intronic
1148404368 17:47398047-47398069 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
1148411851 17:47474193-47474215 ACTTTGGGAGGCAAGGTGGGTGG + Intergenic
1148636091 17:49150280-49150302 CGTCTGGGAGGGAGGTGGGGGGG + Intronic
1148720503 17:49749331-49749353 ACTTTGGGAGGCAAGGTGGGCGG + Intronic
1148786619 17:50149013-50149035 CTTCTGGGAAGGGGGCTGGGTGG + Intronic
1148837998 17:50476386-50476408 CCTTGGGCAGGCACGCTGGGAGG - Intergenic
1148839524 17:50485823-50485845 CCTTTGAGAGTGAAGGTGGGTGG + Exonic
1148892755 17:50819905-50819927 CCTTGGGGAAGGAAGCTGGAAGG + Intergenic
1149564346 17:57630609-57630631 CCTTTGGGAGGGGGTCAGGAGGG - Intronic
1149633068 17:58142689-58142711 CATCTGGGAGGGAGGTGGGGGGG + Intergenic
1149665899 17:58364611-58364633 CCCTAGGGAGGAAGGCTGGAGGG - Intronic
1149725865 17:58893679-58893701 CGATAGGGAGGGAGGCTGGTGGG + Intronic
1149909100 17:60551908-60551930 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
1150633532 17:66897236-66897258 CCATTCCCAGGGAGGCTGGGAGG + Intergenic
1150803857 17:68303367-68303389 ACTTTGGGAGGCAAGGTGGGAGG - Intronic
1150924921 17:69522809-69522831 CCTTTGGGAGGTGGGGTGGGAGG + Intronic
1151174288 17:72274378-72274400 CCTTTGTGTGGGAGGATGGTGGG + Intergenic
1151400453 17:73852493-73852515 CTTGTGGGAGGAAGGATGGGAGG + Intergenic
1151529154 17:74693318-74693340 CCTTTGAGAGGGAGGGTGGATGG + Intronic
1151538036 17:74749548-74749570 CCTTTGGGAGGGCGGCGCAGGGG + Intronic
1151675652 17:75596078-75596100 CCTATAGGAGGAAGGCTGGAAGG + Intergenic
1151718796 17:75844441-75844463 TTTTAGGGAGGGTGGCTGGGAGG + Exonic
1151860758 17:76759856-76759878 ACTTTGGGAGGCCGGGTGGGTGG - Intronic
1152100669 17:78300171-78300193 ACTTTGGGAGGCTGGGTGGGTGG - Intergenic
1152114832 17:78378981-78379003 CCTTCTTGAGGGAGGGTGGGCGG + Intronic
1152303425 17:79508281-79508303 CCTTCCGGAGGGAGGCTTAGTGG + Intronic
1152325476 17:79633431-79633453 CCGTAGGGAGGTGGGCTGGGTGG + Intergenic
1152374883 17:79913862-79913884 CGTTTGGGAAGGAGGCAGGGAGG + Intergenic
1152384393 17:79962455-79962477 ACTTTGGGAGGCAAGGTGGGCGG - Intronic
1152579487 17:81159829-81159851 CCTGGGGGAGCCAGGCTGGGGGG - Intronic
1152681745 17:81671984-81672006 CCTATGGGAGGGAGGTGGGCGGG + Intronic
1152809996 17:82376825-82376847 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1153002154 18:465344-465366 ACTTTGGGAGTCAGGGTGGGCGG - Intronic
1153355842 18:4134325-4134347 CCCTGGGGCGGGAGGTTGGGGGG + Intronic
1153538330 18:6127837-6127859 CTTCTGGGAGGGTGGCTGGCAGG - Intronic
1153973950 18:10250290-10250312 ACTTGAGGATGGAGGCTGGGTGG - Intergenic
1154125345 18:11688040-11688062 ACTTTGGGAGGCAAGGTGGGTGG + Intergenic
1154265205 18:12874187-12874209 CATCTGGGAGGGAGGTTGGGGGG + Intronic
1154278422 18:12980424-12980446 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
1154294239 18:13135658-13135680 CCTTTGGGAAGGCGGATGGCAGG + Intergenic
1154398137 18:14010591-14010613 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
1154398235 18:14010816-14010838 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
1154401842 18:14046223-14046245 CCTTGGGTGGGGAAGCTGGGAGG - Intergenic
1154990119 18:21592383-21592405 CATCTGGGAGGGAGGTGGGGGGG - Intronic
1155219044 18:23668034-23668056 ACTTTGGGAGGCCGGCGGGGGGG - Intergenic
1155326016 18:24665624-24665646 ACTTTGGGAGGCAGAGTGGGAGG + Intergenic
1156252476 18:35364410-35364432 CCATTGGGTGGGTGGGTGGGTGG + Intergenic
1156326244 18:36077619-36077641 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
1157085139 18:44572923-44572945 ACTTTGGGAGGCCGGGTGGGTGG + Intergenic
1157200350 18:45654121-45654143 CTTTTGGCAGGAATGCTGGGGGG + Intronic
1157617940 18:48998440-48998462 GCCTTGGGGTGGAGGCTGGGAGG + Intergenic
1157639867 18:49202886-49202908 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
1157639936 18:49203035-49203057 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
1157639986 18:49203162-49203184 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
1157640011 18:49203211-49203233 CGTCTGGGAGGGAGGTGGGGGGG + Intronic
1157644641 18:49255429-49255451 ACTTTGGGAGGCAAGGTGGGCGG + Intronic
1157677207 18:49577700-49577722 CATCCGGGAGGGAGGTTGGGGGG - Intronic
1159959089 18:74541585-74541607 TTTATGGGAGGGAGCCTGGGTGG + Intronic
1160173870 18:76577527-76577549 ACTTTGGGAGGCAAGCTGGGCGG - Intergenic
1160436535 18:78856504-78856526 CCCATGGGAGGGAGGCAGGAAGG - Intergenic
1160532802 18:79575441-79575463 GCCTTGGGCGGGCGGCTGGGCGG - Intergenic
1160774301 19:848089-848111 CCCGTGGGAGGGAGTGTGGGGGG - Exonic
1160820154 19:1054138-1054160 GCTGTGGGGGGGTGGCTGGGAGG - Intronic
1160865239 19:1253278-1253300 CCATGGGGAGGGAGGCAGGGAGG - Intronic
1160916527 19:1499374-1499396 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
1160934528 19:1587343-1587365 GCTTTGGGAGGGAAGATGGGAGG - Intronic
1161154155 19:2723495-2723517 CCTTTGTGAGTGGGGGTGGGTGG + Intronic
1161219259 19:3110551-3110573 TACTTGGGAGGGAGGCTGTGGGG - Intronic
1161248207 19:3266762-3266784 CCTTTTGGAGTGAGAATGGGAGG + Intronic
1161267176 19:3369744-3369766 CCAGCGGGAGGGAGGCAGGGAGG - Intronic
1161297678 19:3527943-3527965 GCTGTGGCTGGGAGGCTGGGAGG - Intronic
1161627358 19:5335114-5335136 CTGTGGGGAGAGAGGCTGGGAGG - Intronic
1161664720 19:5568238-5568260 CTCCAGGGAGGGAGGCTGGGAGG + Intergenic
1161685848 19:5702236-5702258 CGTCTGGGAGGGAGGTTGGGGGG + Intronic
1161685946 19:5702465-5702487 CCTCTGGGAGGGAGGAGTGGGGG + Intronic
1161773137 19:6242108-6242130 CTTGAGGCAGGGAGGCTGGGAGG - Intronic
1161801218 19:6417671-6417693 TCTTTGGGAGGCAGGCTCTGAGG - Intronic
1161866175 19:6833629-6833651 CGAGTGGGAGGGAGGCTGGGAGG + Intronic
1162071956 19:8158196-8158218 CCAGAGGGAGAGAGGCTGGGCGG - Intronic
1162086910 19:8254784-8254806 CGTTTCCCAGGGAGGCTGGGGGG - Intronic
1162712803 19:12608717-12608739 ACTTTGGGAGGCAAGGTGGGTGG - Intronic
1162880852 19:13658092-13658114 ACTTTGGGAGGCCGGGTGGGTGG + Intergenic
1162907276 19:13831365-13831387 GCTCCAGGAGGGAGGCTGGGAGG + Exonic
1163003919 19:14385611-14385633 CCTGTGGGAGGGGGGCCCGGGGG + Intronic
1163200579 19:15765395-15765417 ACTTAGGGAGCGAGGTTGGGAGG - Intergenic
1163315665 19:16538936-16538958 CCTGAGGGAGGGAGCATGGGGGG - Intronic
1163385678 19:16998566-16998588 GCTTTGGGTGGGAGGTGGGGAGG + Intronic
1163452899 19:17389719-17389741 ACTTTGGGAGGCCGGGTGGGCGG + Intergenic
1163586756 19:18168555-18168577 CCGTCTGGAGGGAGGCAGGGAGG + Intronic
1163613238 19:18311657-18311679 CCTGTCGGAGGGCGTCTGGGTGG - Intronic
1163678892 19:18669397-18669419 GCTTTGGGAAGGAGGGAGGGAGG - Exonic
1163905625 19:20149458-20149480 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
1163945212 19:20529816-20529838 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
1164065044 19:21708052-21708074 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
1164066516 19:21721327-21721349 CGTCCGGGAGGGAGGCGGGGGGG + Intergenic
1164081519 19:21865382-21865404 CCTCCGGGAGGGAGGTGGGGGGG - Intergenic
1164192191 19:22926357-22926379 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1164192262 19:22926533-22926555 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
1164192515 19:22927087-22927109 CGTCCGGGAGGGAGGCGGGGGGG + Intergenic
1164192568 19:22927216-22927238 CATCCGGGAGGGAGGTTGGGGGG + Intergenic
1164238921 19:23366200-23366222 CATCTGGGAGGGAGGTGGGGGGG - Intronic
1164263999 19:23595067-23595089 CATCTGGGAGGGAGGTGGGGGGG + Intronic
1164652231 19:29899025-29899047 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
1164905966 19:31968296-31968318 TCTGTAGGAAGGAGGCTGGGAGG - Intergenic
1165540901 19:36491375-36491397 CGTTCGGGAGGGAGGTGGGGGGG + Intergenic
1165956214 19:39503535-39503557 CCCTAGGGAGGGAGGATGGAGGG - Intronic
1166030131 19:40118801-40118823 CCTCCGGGAGGGAGGTGGGGGGG + Intergenic
1166162610 19:40965442-40965464 CGTCCGGGAGGGAGGCGGGGGGG - Intergenic
1166162832 19:40965968-40965990 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
1166162960 19:40966270-40966292 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
1166180233 19:41103238-41103260 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
1166261579 19:41644763-41644785 CATCTGGGAGGGAGGTGGGGGGG + Intronic
1166417997 19:42610447-42610469 CATCTGGGAGGGAGGTGGGGGGG - Intronic
1166425700 19:42676426-42676448 CATCCGGGAGGGAGGCGGGGGGG - Intronic
1166664291 19:44669545-44669567 CCTGTGTGTGTGAGGCTGGGAGG - Intronic
1166813362 19:45527190-45527212 GCATGGGGAGGGAGGCTGGAGGG - Intergenic
1166975146 19:46601433-46601455 CCATGGTGAGTGAGGCTGGGGGG + Exonic
1167019024 19:46860903-46860925 CCATTGCGAGGGAGGGAGGGAGG + Intergenic
1167472819 19:49684901-49684923 CCCTGGGGAGGCAGGCAGGGAGG - Exonic
1167486011 19:49763333-49763355 CCTTTGTGAGGCAGGCTGAGGGG - Intergenic
1167618195 19:50547702-50547724 CCTTTGGCGGGCAGGGTGGGGGG - Intronic
1167833645 19:52048549-52048571 CCTTTTGGAGGGGAGCTGGTAGG - Exonic
1167839769 19:52105989-52106011 ACTTTGGGAGGCAAGGTGGGCGG - Intergenic
1167857135 19:52251235-52251257 ACTTGAGGATGGAGGCTGGGAGG - Intergenic
1167872723 19:52386556-52386578 ACTTTGGGAGGCAAGGTGGGTGG + Intergenic
1167897447 19:52593413-52593435 CCTCCGGGAGGGAGGTGGGGGGG - Intergenic
1167937498 19:52920050-52920072 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
1167970675 19:53186929-53186951 CGTCCGGGAGGGAGGCGGGGGGG - Intronic
1167970974 19:53187597-53187619 CATCCGGGAGGGAGGCGGGGGGG - Intronic
1168153362 19:54460610-54460632 CCTGAGGTGGGGAGGCTGGGAGG + Intronic
1168208780 19:54873303-54873325 CCTTTAGGGTGGAGGGTGGGAGG + Intergenic
1168290321 19:55354298-55354320 CGTTAGGGTGGGAGGCCGGGCGG - Exonic
1168394649 19:56037842-56037864 CCTGAGGGAGGGAGGAGGGGAGG + Intronic
1168696030 19:58405047-58405069 CATCTGGGAGGGAGGTGGGGGGG - Intronic
925047355 2:782749-782771 CCATTGGAAGGGAGGCCGGTGGG + Intergenic
925219583 2:2127234-2127256 CATATGGGGTGGAGGCTGGGAGG - Intronic
926215303 2:10902583-10902605 CATCCGGGAGGGAGGTTGGGGGG - Intergenic
926282276 2:11459633-11459655 ACTTTGGGAGGCGGGGTGGGGGG + Intronic
926801734 2:16665612-16665634 CCTTTGGGAGGGAGGGAGAGCGG - Intronic
926929110 2:18018363-18018385 GCTTGAGGAGGGAGGGTGGGAGG - Intronic
927158520 2:20236330-20236352 GCCCTGGGATGGAGGCTGGGTGG + Intergenic
927427412 2:22996254-22996276 CCTCTGGGCAGGGGGCTGGGGGG + Intergenic
927508471 2:23629560-23629582 CCACTGGGAGGGGGGCTTGGAGG + Intronic
927776852 2:25910350-25910372 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
927833047 2:26370492-26370514 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
927833098 2:26370618-26370640 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
927869833 2:26616403-26616425 CCTTGGGATGGGAGCCTGGGAGG + Intronic
927971432 2:27308067-27308089 CTCCGGGGAGGGAGGCTGGGTGG - Intronic
928005237 2:27557643-27557665 CGTCCGGGAGGGAGGCGGGGGGG - Intronic
928123393 2:28599856-28599878 ACTTTGGGAGGCAAGGTGGGTGG - Intronic
928542072 2:32293947-32293969 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
928888920 2:36180374-36180396 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
929447705 2:42014413-42014435 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
929447801 2:42014638-42014660 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
929447848 2:42014737-42014759 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
929515959 2:42605571-42605593 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
929577730 2:43063151-43063173 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
929690140 2:44067156-44067178 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
929690164 2:44067206-44067228 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
929690259 2:44067432-44067454 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
930079097 2:47433053-47433075 CGTCCGGGAGGGAGGCGGGGGGG - Intronic
930079121 2:47433102-47433124 CATCCGGGAGGGAGGCGGGGAGG - Intronic
930083807 2:47477913-47477935 CCTTTGTGTGGGAGGGAGGGAGG - Intronic
930202037 2:48556574-48556596 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
930665374 2:54095616-54095638 CATCTGGGAGGGAGGTGGGGGGG - Intronic
930755317 2:54967223-54967245 CTTTTGGGGGTGAGGGTGGGAGG + Intronic
930833921 2:55773844-55773866 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
930928254 2:56847999-56848021 CCTGTTGGAGGGTGGCTGGTGGG + Intergenic
930958377 2:57231132-57231154 CCTGGGGGAGGGAGGCCTGGAGG - Intergenic
931378015 2:61725159-61725181 ACTTTGGGAGGGTGAGTGGGAGG - Intergenic
931494616 2:62789445-62789467 CCTTTTGGTGGGTGGGTGGGTGG - Intronic
931590983 2:63882977-63882999 CTTTTGGGAGGGTGGTGGGGAGG + Intronic
931752109 2:65339081-65339103 CGTCCGGGAGGGAGGTTGGGCGG + Intronic
931758104 2:65392290-65392312 CCTGTGGTTGGGAGGCTGAGTGG - Intronic
932710803 2:74061600-74061622 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
932807390 2:74795900-74795922 CGTTCGGGAGGGAGGTGGGGGGG - Intergenic
932814728 2:74852565-74852587 CTTGTGGGATGGAGGGTGGGGGG + Intronic
933563827 2:83924487-83924509 ACTTTGGGAGGGTGGTGGGGGGG - Intergenic
933734972 2:85487837-85487859 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
933735133 2:85488237-85488259 CATCCGGGAGGGAGGCAGGGAGG + Intergenic
933735209 2:85488412-85488434 CATCCGGGAGGGAGGCAGGGGGG + Intergenic
934708687 2:96501820-96501842 GCTGGGGGAGGGAGGCTGGCTGG + Intronic
934745100 2:96754183-96754205 CCTCTGGGAGGAAGGCTGCAGGG - Intergenic
934753004 2:96806084-96806106 CCTCCGGGAGGGAGGTTGGGGGG - Intronic
935175077 2:100642289-100642311 CCTGGGGGATGGAGGTTGGGGGG + Intergenic
935298292 2:101669850-101669872 ACTTTGGGAGGCTGGGTGGGCGG + Intergenic
935549747 2:104440390-104440412 TCTGTGTGAGGCAGGCTGGGTGG - Intergenic
935636241 2:105251502-105251524 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
935831034 2:107000663-107000685 CCTTAGAGAGGGAGGATGGGAGG + Intergenic
935874843 2:107495064-107495086 GCTTTGGCAGGAAGGCTGTGAGG - Intergenic
935944035 2:108270049-108270071 TCTTTGGGAAGAAGGCTGGGAGG - Intergenic
935972969 2:108548668-108548690 CCTTTGCCAGGGGGGCTGGTGGG - Intronic
936097214 2:109539685-109539707 ACTTTGGGAGGCAAGGTGGGCGG - Intergenic
936269253 2:111036321-111036343 CCTGAGGGAGGGAGGAAGGGAGG + Intronic
936271104 2:111049791-111049813 CCTTGGGGCGGGGGGTTGGGGGG - Intronic
936384931 2:112020723-112020745 CCTCTGGGAGGAAGGCTGCTGGG + Intronic
936504721 2:113096494-113096516 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
936537776 2:113325117-113325139 CCTCTGGGAGGCAGGCGTGGGGG + Intergenic
936546481 2:113395138-113395160 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
936546505 2:113395187-113395209 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
936950464 2:117973004-117973026 CCTCTGGGAGGGAGACTTGAAGG - Intronic
936950682 2:117974645-117974667 CCTCTAGGAGGGAGGCTTGAAGG - Intronic
937166577 2:119824276-119824298 TTTTTGGGGGGGAGGCAGGGCGG + Intronic
937323878 2:120977542-120977564 GTTGTGGGAGGGGGGCTGGGAGG + Intronic
937847786 2:126600877-126600899 CCCTTGGGAGGGAGGCAGGGTGG + Intergenic
938088711 2:128418379-128418401 CGTCCGGGAGGGAGGCGGGGGGG - Intergenic
938241059 2:129742574-129742596 CCTGTGCTAGGGAGGCTGGGAGG - Intergenic
938665817 2:133535284-133535306 CCAAAGGGAGGGAGGATGGGAGG - Intronic
938720714 2:134064280-134064302 CATCTGGGAGGGAGGTGGGGGGG + Intergenic
938925758 2:136040391-136040413 ACTATGGGAGGGTGGCTGTGGGG + Intergenic
940566306 2:155364983-155365005 ACTTTGGGAGGCAAGGTGGGTGG + Intergenic
940635610 2:156293675-156293697 CATCCGGGAGGGAGGTTGGGGGG + Intergenic
940652296 2:156451523-156451545 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
941424815 2:165329301-165329323 CCTTTGTGAAGGATGGTGGGAGG + Intronic
941768943 2:169327470-169327492 CGTCTGGGAGGGAGGTGGGGGGG + Intronic
941847923 2:170150265-170150287 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
942020930 2:171866641-171866663 CGTTCGGGAGGGAGGTGGGGGGG - Intronic
942630662 2:177946769-177946791 CGTCTGGGAGGGAGGTGGGGGGG + Intronic
942761034 2:179398437-179398459 CCTTTGGAAGGGCGCCTGGAAGG + Intergenic
943297082 2:186153965-186153987 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
943323553 2:186473281-186473303 CGTATGGGAGGGAGGTGGGGGGG + Intergenic
943608496 2:190004692-190004714 CCTTTGCAAGGGAGGTCGGGAGG - Intronic
944207755 2:197174610-197174632 CCCTGGGGAGAGAGGCGGGGAGG + Intronic
944263008 2:197696289-197696311 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
944263104 2:197696513-197696535 CCTCCGGGAGGGAGGTGGGGGGG - Intronic
944283371 2:197922908-197922930 CATCTGGGAGGGAGGTGGGGGGG - Intronic
944598799 2:201283693-201283715 CGTCCGGGAGGGAGGCGGGGGGG - Intronic
945028040 2:205637944-205637966 CATTGTGGAGAGAGGCTGGGAGG - Intergenic
945114909 2:206400870-206400892 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
945142962 2:206706563-206706585 CCTCTGGGAGGCAGGCTGATGGG + Intronic
945233155 2:207611079-207611101 CGTCCGGGAGGGAGGCGGGGGGG + Exonic
945374924 2:209068385-209068407 TCTTTGGGAGGCCGGGTGGGTGG + Intergenic
945835615 2:214835098-214835120 CGTCCGGGAGGGAGGCGGGGGGG - Intergenic
945970365 2:216226572-216226594 CGTCCGGGAGGGAGGCGGGGGGG - Intergenic
946155064 2:217801842-217801864 CCTTCCGCAGGGATGCTGGGAGG + Exonic
946732746 2:222724826-222724848 CCTTTGGCAGGGATGGTAGGGGG + Intergenic
946742823 2:222816901-222816923 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
947062247 2:226180189-226180211 CCTTTCAGAAGGAGGCTGGGGGG - Intergenic
947383634 2:229569276-229569298 ACTTTGGGAGGCAAGGTGGGCGG + Intronic
947633172 2:231666535-231666557 CATCTGGGAGGCAGGCTGGGCGG + Intergenic
947745129 2:232503446-232503468 GCTGGGGGAGGGAGGCTGAGCGG - Intergenic
947798017 2:232906329-232906351 CGTGTGGGAGGGAGGTGGGGGGG + Intronic
947798095 2:232906505-232906527 CGTGTGGGAGGGAGGTGGGGGGG + Intronic
947919123 2:233854324-233854346 CGTGTCGGAGTGAGGCTGGGAGG - Intronic
948455050 2:238101010-238101032 CCTTTGGGAGGCAGGCCCTGTGG - Intronic
948834387 2:240618931-240618953 CCCTTGGGAGAGATGCTGAGTGG + Exonic
948865514 2:240772898-240772920 CCTCTGGGTGGGAGGCCGGGCGG - Intronic
948917037 2:241039636-241039658 CCCTGGGGCGAGAGGCTGGGTGG - Intronic
949049247 2:241888431-241888453 CCAGTGAGAGGGAGGATGGGAGG - Intergenic
949049296 2:241888582-241888604 CCAGTGAGAGGGAGGATGGGAGG - Intergenic
949049374 2:241888824-241888846 CCAGTGAGAGGGAGGATGGGAGG - Intergenic
1168731569 20:86967-86989 CCTTTGGTAGTGGGGATGGGGGG + Intergenic
1169266278 20:4169244-4169266 ACTTTGGGAGGCAAGGTGGGAGG - Intronic
1169370988 20:5028012-5028034 CCTCCGGGAGGGAGGTGGGGGGG + Intergenic
1170645749 20:18194692-18194714 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1170717253 20:18842620-18842642 CCTTTGGAAGAGATGCTGGTTGG + Intergenic
1170732999 20:18990263-18990285 CCCCTGGGAGGGAGGCTGAGGGG - Intergenic
1170811540 20:19678517-19678539 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
1171771226 20:29324829-29324851 CCGTTGGGAGGGTGCCTGGATGG - Intergenic
1171861290 20:30405117-30405139 CATCTGGGAGGGAGGTGGGGGGG + Intergenic
1171981798 20:31633736-31633758 CCTTTTTCAGGGTGGCTGGGAGG - Intergenic
1172257970 20:33536304-33536326 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
1172279355 20:33699393-33699415 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1172280030 20:33701678-33701700 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1172348620 20:34223579-34223601 CCTCCGGGAGGGAGGTGGGGGGG + Intronic
1172349359 20:34229492-34229514 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
1172349682 20:34230245-34230267 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
1172613410 20:36267690-36267712 CCTGTGGGAGGGGAGCTGGGTGG - Intronic
1172615338 20:36279692-36279714 CCTTTGGGGAGGTGGTTGGGAGG - Intergenic
1172721153 20:37000705-37000727 CGTCCGGGAGGGAGGCGGGGAGG + Intronic
1172721306 20:37001058-37001080 CATCCGGGAGGGAGGCGGGGAGG + Intronic
1172735915 20:37126240-37126262 CGTCTGGGAGGGAGGTGGGGGGG + Intronic
1172819416 20:37718466-37718488 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
1172918382 20:38461327-38461349 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
1172951135 20:38724195-38724217 CCCTTGGGAAGGAGGCGGGAGGG - Intergenic
1173294735 20:41747032-41747054 CCTTGATGAGGGTGGCTGGGAGG + Intergenic
1173583598 20:44165079-44165101 ACTTTGGGAGGCAAGGTGGGTGG - Intronic
1173825278 20:46044037-46044059 CCTGTGGGAGGGAGGCCACGGGG + Intronic
1174020558 20:47525767-47525789 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
1174120244 20:48259636-48259658 CCTTTGGGGCAGAGACTGGGAGG - Intergenic
1174218611 20:48935825-48935847 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
1174390469 20:50215833-50215855 CCCTGGGGAGGGAAACTGGGGGG + Intergenic
1175942413 20:62543585-62543607 CAGTTGGGAGAGAGGCAGGGTGG - Intergenic
1175986532 20:62766697-62766719 CTTCTGGGAGGGAGAGTGGGGGG - Intergenic
1176015526 20:62929308-62929330 CCTTTGGGAGGGGAGCAGCGGGG + Intronic
1176092633 20:63325784-63325806 CCTTGGAGATGGAGGCTGTGGGG + Intronic
1176112836 20:63418349-63418371 CCATTGGGAGGGAGGGTGGCAGG - Intronic
1176130615 20:63495226-63495248 CCTTGGGGAGGGAGGCATGGGGG + Intronic
1176153023 20:63602771-63602793 ACTGTGGCAGGGAGGCTGGGAGG - Intronic
1176411645 21:6452354-6452376 CCTCGGGGAGAGGGGCTGGGAGG + Intergenic
1177178252 21:17720042-17720064 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
1177178326 21:17720192-17720214 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
1178075703 21:29011876-29011898 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
1178075801 21:29012101-29012123 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
1178170626 21:30035749-30035771 TGATTGTGAGGGAGGCTGGGGGG + Intergenic
1178172664 21:30059031-30059053 CACTTGAGAGGGAGGGTGGGAGG - Intergenic
1178504996 21:33155026-33155048 CCATTGGAAGGGAGGGAGGGAGG + Intergenic
1178724431 21:35038298-35038320 CCTTTGATAGGGAGGCCAGGAGG - Intronic
1179061332 21:37982209-37982231 CACTTGGGAGGGGGGCTGGATGG + Intronic
1179129113 21:38618538-38618560 CATTTGGCGGGGAGGTTGGGGGG + Intronic
1179314202 21:40226898-40226920 CCTTTTGGAGGGTGGATGGTGGG - Intronic
1179646348 21:42778537-42778559 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1179646371 21:42778585-42778607 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1179687139 21:43060676-43060698 CCTCGGGGAGAGGGGCTGGGAGG + Intronic
1179969359 21:44825296-44825318 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1180039606 21:45269021-45269043 CGTCTGGGAGGGAGGTGGGGGGG + Intronic
1180039657 21:45269148-45269170 CGTCTGGGAGGGAGGTGGGGGGG + Intronic
1180108569 21:45636930-45636952 CCTTTGGGAGGGCTGCGAGGGGG - Intergenic
1181083937 22:20430627-20430649 CCTTTGTTAGGGAGGCAGGGCGG + Intronic
1181179201 22:21055352-21055374 GATGTGGGAGAGAGGCTGGGAGG - Intronic
1181312578 22:21953064-21953086 GCTTTGGGTGGGCGGCTGGATGG + Intergenic
1181442069 22:22941835-22941857 CCTTGCTGTGGGAGGCTGGGGGG + Intergenic
1181530523 22:23514551-23514573 CCATGTGGTGGGAGGCTGGGTGG - Intergenic
1181586437 22:23855342-23855364 CGTCCGGGAGGGAGGCGGGGTGG + Intergenic
1181657669 22:24316913-24316935 CGTCTGGGAGGGAGGTTGGGGGG - Intronic
1181657720 22:24317040-24317062 CCTCCGGGAGGGAGGTGGGGGGG - Intronic
1181982048 22:26773110-26773132 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
1182067919 22:27443501-27443523 CCTTGAGGAGGGAGGGTGGGAGG - Intergenic
1182228822 22:28820940-28820962 ACTTTGGGAGGGAGGCAGCCTGG + Intergenic
1182343538 22:29643924-29643946 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
1182616266 22:31591910-31591932 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
1182801831 22:33038118-33038140 CTTTTGGTGGGGAGCCTGGGAGG - Intronic
1182840477 22:33385292-33385314 ACTTTGGGAGGGGAGGTGGGTGG + Intronic
1183201820 22:36390344-36390366 ACTTTGGGAGGTAAGGTGGGAGG + Intergenic
1183209696 22:36443314-36443336 ACTTTGGGAGGGAGGGACGGAGG - Intergenic
1183330042 22:37214508-37214530 CATTTGGGCGGGAGGCGGGGGGG + Intergenic
1183368060 22:37417591-37417613 CCTGTGGAAGGAAAGCTGGGTGG + Intronic
1183841004 22:40501027-40501049 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
1183841355 22:40501859-40501881 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
1184118254 22:42434361-42434383 CCTCTGGGAGGCAGGGTGGGAGG + Intergenic
1184120418 22:42446281-42446303 CCTGTGGGAGGGAGCTGGGGGGG - Intergenic
1184132126 22:42523178-42523200 CCTGTGGGAGGGAGCTGGGGGGG - Intergenic
1184248646 22:43248242-43248264 ACAGTGGGAGGGAAGCTGGGGGG + Intronic
1184290928 22:43497793-43497815 CCTGGGGGAGGGAGGATGGAGGG + Intronic
1184507020 22:44910035-44910057 CCTTTGGCACGGAGCCTGGCAGG + Intronic
1184704882 22:46204014-46204036 ACTGGGGGAGGGAGGCAGGGAGG - Intronic
1184714697 22:46274147-46274169 CCCTTGGGACGGGGGCGGGGTGG + Intronic
1184826276 22:46953869-46953891 CCCTTAAGAGGGAGGCAGGGAGG + Intronic
1185379945 22:50503699-50503721 CCTGTGGGAGGGAGGGAGGGAGG + Exonic
949419530 3:3851082-3851104 CTTATGGGAGGGAGACAGGGAGG - Intronic
949581687 3:5394809-5394831 CCTTTAAGAGGGTGGCTGGAGGG + Intergenic
949916951 3:8972529-8972551 ACTTTGGGAGGTAGGGAGGGAGG - Intergenic
950078729 3:10206143-10206165 CATTTCCGAGGAAGGCTGGGTGG + Intronic
950114048 3:10438993-10439015 CCTTTGGGAGCCAGCGTGGGAGG + Intronic
950256747 3:11512199-11512221 CCTCTGGGAGGTAGGCTAGTTGG - Intronic
950412682 3:12849661-12849683 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
950442003 3:13015761-13015783 CCTTTTGGAGGGCAGGTGGGCGG - Intronic
950545771 3:13637162-13637184 CACTTGGGAGGGACCCTGGGAGG + Intronic
950661868 3:14471781-14471803 CCTTTGCAAAGGAGACTGGGCGG + Intronic
950685585 3:14616423-14616445 CCTTTGGGAAGATGGATGGGAGG + Intergenic
951013374 3:17704879-17704901 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
952257778 3:31710415-31710437 GCTTTGAGAGGGAAGCTGTGGGG - Intronic
952385704 3:32840223-32840245 CCTTTGGAAGGGAAGGGGGGTGG - Intronic
952885806 3:38010323-38010345 CCTTGGGTCGGGAGTCTGGGTGG - Intronic
952896331 3:38081449-38081471 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
952945762 3:38477178-38477200 CCTGAGGGAGGGAGGCCGGGTGG - Intronic
953138570 3:40205646-40205668 GCTTTTGCAGGGAGGGTGGGAGG - Intronic
953210748 3:40872845-40872867 CCCCTGGGAGGGATGCTGAGTGG + Intergenic
953257775 3:41306458-41306480 CATCTGGGAGGGAGGTGGGGGGG + Intronic
953270404 3:41437247-41437269 CCCTTGGCAGGGAGGATGGAAGG + Intronic
953855161 3:46494816-46494838 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
953959537 3:47256503-47256525 CGTCTGGGAGGGAGGTGGGGGGG + Intronic
954081109 3:48212390-48212412 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
954162825 3:48734495-48734517 CGTCTGGGAGGGAGGTGGGGGGG + Intronic
954162925 3:48734720-48734742 CATCTGGGAGGGAGGTGGGGGGG + Intronic
954356167 3:50084815-50084837 CCTCCGGGAGGGAGGTGGGGGGG - Intronic
954388933 3:50258977-50258999 CACTTGGAAGGGGGGCTGGGGGG - Exonic
954391208 3:50269065-50269087 CCTAGGGGAAAGAGGCTGGGGGG - Intronic
954399389 3:50311674-50311696 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
954799702 3:53180239-53180261 CCTCTGGGAAGGAGGCCTGGTGG - Intronic
955297620 3:57748068-57748090 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
956270529 3:67444319-67444341 CGTCTGGGAGGGAGGTGGGGGGG + Intronic
956270679 3:67444672-67444694 CGTCTGGGAGGGAGGTGGGGGGG + Intronic
956270805 3:67444979-67445001 CGTCTGGGAGGGAGGTTGGGGGG + Intronic
956410775 3:68976915-68976937 ACTTTGGGAGGCAAGGTGGGAGG + Exonic
956739993 3:72268260-72268282 ACATTGAGAGGGAGACTGGGAGG - Intergenic
956805343 3:72804425-72804447 CCTTTCGGAGGGTGGCGGGGTGG - Intronic
957040439 3:75331894-75331916 CATTGAGGAGGGTGGCTGGGAGG - Intergenic
957505881 3:81119871-81119893 ACTTGGTGAGGGAGGTTGGGAGG + Intergenic
957645504 3:82919170-82919192 CCTTTGGGAGTTAGGCTGTAGGG - Intergenic
957730288 3:84125580-84125602 ACTACGGGAGGGAGGCTGAGTGG + Intergenic
958450738 3:94269482-94269504 CAGTTGGGAAGGAGTCTGGGAGG + Intergenic
959252991 3:103972194-103972216 ACTTTGGGAGGCAAGGTGGGTGG - Intergenic
959415155 3:106073620-106073642 CGTCCGGGAGGGAGGCGGGGGGG - Intergenic
959415401 3:106074191-106074213 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
960029975 3:113046450-113046472 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
960780555 3:121313611-121313633 CGTCCGGGAGGGAGGCGGGGGGG - Intronic
960797392 3:121501733-121501755 ACTTTGGGAGGCTGGGTGGGCGG + Intronic
960817575 3:121688999-121689021 CCTCCGGGAGGGAGGTGGGGGGG + Intronic
960921079 3:122747615-122747637 CATCTGGGAGGGAGGTGGGGGGG + Intronic
961045224 3:123703456-123703478 CATTGAGGAGGGTGGCTGGGAGG - Intronic
961109624 3:124272958-124272980 CCTTCTGGTGGGAGGCTGGTTGG + Intronic
961163756 3:124750265-124750287 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
961163809 3:124750393-124750415 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
961311354 3:126004003-126004025 CCTTTGGGAGGGAGGCTGGGAGG + Intergenic
961327519 3:126118098-126118120 CCTGTGGGCGGGAGGGAGGGGGG + Exonic
961497847 3:127307085-127307107 ACTGTGGGAGGGAGACTGGAGGG - Intergenic
961522497 3:127475139-127475161 CCTGTGGGAGGCATGTTGGGGGG + Intergenic
961561569 3:127733948-127733970 CGATTGGGAGGCAGGCTGGAGGG - Intronic
961614065 3:128164792-128164814 CTTCTGGGAGGAAGGCTGGTAGG + Intronic
961645198 3:128389115-128389137 CCATGGGGATGGAGGCTGGAGGG + Intronic
961787654 3:129357304-129357326 CCTGTGGGAGGGAGCCTGCCAGG + Intergenic
961789022 3:129363286-129363308 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
962741686 3:138366831-138366853 GCTTTGGAAGTGATGCTGGGTGG + Intronic
962888031 3:139646072-139646094 CCTTTGGGATGTAGGTGGGGTGG + Intronic
963244793 3:143047885-143047907 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
963770182 3:149380330-149380352 CGTCTGGGAGGGAGGTTTGGGGG + Intergenic
963803963 3:149704391-149704413 CATTTGGGAGGGAGGCTTTTGGG - Intronic
963832290 3:150021363-150021385 ACTTTGGGAGGCAAGGTGGGTGG + Intronic
963906141 3:150774856-150774878 GCTCAGGGAGGGAGACTGGGGGG - Intergenic
963911234 3:150820204-150820226 CGTCCGGGAGGGAGGCGGGGGGG - Intergenic
964415171 3:156439861-156439883 CATTTTGGAGGGTGGCTGGGAGG - Intronic
964509843 3:157438286-157438308 CCTAACGGAGGGAAGCTGGGCGG - Intronic
965334216 3:167416200-167416222 ACTTGAGGAGGGAGGGTGGGAGG - Intergenic
965657460 3:171003437-171003459 TTTTTGGGGGGGAGGGTGGGAGG + Intronic
966015107 3:175131874-175131896 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
966015268 3:175132267-175132289 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
966015385 3:175132565-175132587 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
966359824 3:179120552-179120574 CGTCTGGGAGGGAGGTTGGGGGG + Intergenic
966420102 3:179727978-179728000 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
967169350 3:186811635-186811657 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
967177572 3:186874169-186874191 CGTCCGGGAGGGAGGCGGGGAGG + Intergenic
968409925 4:381651-381673 ACTTTGGGAGGCTGACTGGGTGG - Intronic
968440857 4:623806-623828 CCTGTGGGAGGGAGGTTGGCAGG + Intergenic
968666985 4:1827924-1827946 CATCCGGGAGGGAGGTTGGGGGG - Intronic
968667330 4:1828688-1828710 CATCCGGGAGGGAGGTTGGGGGG - Intronic
968924103 4:3538482-3538504 CGTCCGGGAGGGAGGCGGGGGGG - Intergenic
968924126 4:3538531-3538553 CATCCGGGAGGGAGGCGGGGAGG - Intergenic
968924246 4:3538834-3538856 CATCCGGGAGGGAGGCGGGGAGG - Intergenic
969339844 4:6533326-6533348 CTTGTTTGAGGGAGGCTGGGAGG - Intronic
969488321 4:7484894-7484916 CCTTAAGGAGGCAGGCTGTGTGG - Intronic
969511859 4:7622604-7622626 CCTGTGGGAGGGCGCCTGGCCGG + Intronic
971153510 4:24058700-24058722 ACTTTGGGAGGCAGAGTGGGTGG + Intergenic
971957145 4:33435315-33435337 CCTTTGGGAGGCCAGCTGGGAGG - Intergenic
972288439 4:37669344-37669366 CCTCCGGGAGGGAGGTGGGGGGG + Intronic
972782933 4:42301621-42301643 CCTTCGGGATGGGGGCTGGTTGG - Intergenic
973196545 4:47449445-47449467 ACTTGGGGAGGAAGGCTGGGAGG + Intergenic
973263449 4:48186797-48186819 CATCTGGGAGGGAGGTTGGGGGG + Intronic
973646983 4:52959853-52959875 CATGAGGGAGGGAGGCAGGGAGG + Intronic
973675163 4:53255973-53255995 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
974021173 4:56693491-56693513 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
974421760 4:61685023-61685045 TACTTGGGAGGGAGGCTGAGGGG - Intronic
974588859 4:63918579-63918601 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
975685791 4:76917336-76917358 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
975686113 4:76918056-76918078 CGTCCGGGAGGGAGGCGGGGGGG + Intergenic
975848503 4:78548412-78548434 CATCTGGGAGGGAGGTGGGGGGG + Intergenic
976265642 4:83185407-83185429 CGTCCGGGAGGGAGGCGGGGGGG - Intergenic
976265741 4:83185632-83185654 CATCTGGGAGGGAGGTGGGGGGG - Intergenic
976440444 4:85067158-85067180 ACTTTGGGAGGCAAGGTGGGTGG - Intergenic
976607427 4:86996085-86996107 CGTCTGGGAGGGAGGTGGGGGGG + Intronic
977543014 4:98340867-98340889 ACTTGAGGAGGGAGGGTGGGAGG + Intronic
977706325 4:100075081-100075103 CCTTTGGGAGGGAGGTGGCAGGG + Intergenic
977808704 4:101334376-101334398 ACTTTGGGAGGCCGGGTGGGTGG - Intronic
978061408 4:104344776-104344798 CATGCAGGAGGGAGGCTGGGAGG + Intergenic
978154443 4:105473604-105473626 CCTCGGGGAGGGCGGCTGGCAGG + Intronic
978274510 4:106933491-106933513 ACTTTGGGAGGAACGCTGTGTGG + Intronic
979557235 4:122062771-122062793 CCATTGGGAGGGTGGTGGGGAGG - Intergenic
979595890 4:122533439-122533461 ACTTTGGGAGTCAGGGTGGGTGG + Intergenic
980056403 4:128083577-128083599 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
981523971 4:145693668-145693690 CCTCCGGGAGGGAGGTGGGGGGG - Intronic
982026121 4:151255129-151255151 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
982615622 4:157636458-157636480 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
982615842 4:157636959-157636981 CGTCTGGGAGGGAGGTTGGGGGG - Intergenic
982784384 4:159523691-159523713 CTTCCGGGAGGGAGGTTGGGGGG + Intergenic
982784555 4:159524091-159524113 CTTCCGGGAGGGAGGTTGGGGGG + Intergenic
982784750 4:159524538-159524560 CTTCCGGGAGGGAGGTTGGGGGG + Intergenic
983492193 4:168400669-168400691 AATTTGGGTGGGAGGATGGGAGG - Intronic
984037947 4:174692300-174692322 CGTCTGGGAGGGAGGTGGGGGGG + Intronic
984533461 4:180944841-180944863 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
984533641 4:180945246-180945268 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
984803784 4:183735938-183735960 CGTCCGGGAGGGAGGCGGGGGGG - Intergenic
984804108 4:183736678-183736700 CGTCCGGGAGGGAGGCGGGGGGG - Intergenic
985451696 4:190066595-190066617 ACGTTAGGAGGGAGGCAGGGAGG + Intergenic
985452684 4:190069887-190069909 ACGTTAGGAGGGAGGCAGGGAGG + Intergenic
985454660 4:190076477-190076499 ACGTTAGGAGGGAGGCAGGGAGG + Intergenic
985456632 4:190083064-190083086 ACGTTAGGAGGGAGGCAGGGAGG + Intergenic
985457620 4:190086364-190086386 ACGTTAGGAGGGAGGCAGGGAGG + Intergenic
985458607 4:190089657-190089679 ACGTTAGGAGGGAGGCAGGGAGG + Intergenic
985459596 4:190092957-190092979 ACGTTAGGAGGGAGGCAGGGAGG + Intergenic
985567359 5:626033-626055 CTTTTGGGTGGGGGGCAGGGGGG + Intronic
985625527 5:983273-983295 CCTCTGGGAGGGGAGCTGGCTGG + Intergenic
986000832 5:3629449-3629471 CCTGTGGGAGGAAGGGTGGAGGG + Intergenic
986058561 5:4164264-4164286 CCTGTGGGTGGGTGGGTGGGTGG - Intergenic
986100830 5:4609613-4609635 ACTTTAGGAGGGAAGGTGGGAGG + Intergenic
986327617 5:6688242-6688264 CCTTTAAGAGGGAGGCAGGCAGG + Intergenic
987168970 5:15233028-15233050 CGTGTGGGAGGGAGGGTGGGAGG - Intergenic
987292409 5:16521245-16521267 GATTTGGGAGGTAGGATGGGAGG - Intronic
987634782 5:20526076-20526098 CCAGTGCAAGGGAGGCTGGGAGG + Intronic
988240068 5:28597048-28597070 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
988592768 5:32563395-32563417 ACTTTGGGAGGCTGGATGGGAGG + Intronic
989048468 5:37295860-37295882 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
989075719 5:37563082-37563104 CGTCCGGGAGGGAGGCGGGGGGG - Intronic
989075744 5:37563131-37563153 CATCCGGGAGGGAGGCCGGGAGG - Intronic
989206798 5:38817322-38817344 CCTTTGGGGAGGTGGCAGGGTGG - Intergenic
990426908 5:55696528-55696550 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
990462910 5:56046423-56046445 ACTTTGGGAGGCAAGGTGGGTGG - Intergenic
991073605 5:62513316-62513338 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
991373327 5:65940501-65940523 CGTCTGGGAGGGAGGTGGGGGGG + Intronic
991723531 5:69515412-69515434 CGTCTGGGAGGGAGGTAGGGGGG - Intronic
991909991 5:71551780-71551802 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
991934179 5:71785567-71785589 ACTTTGGGGGTGGGGCTGGGAGG - Intergenic
992289798 5:75270751-75270773 CATCTGGGAGGGAGGTGGGGGGG + Intergenic
992463621 5:76984752-76984774 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
992524656 5:77596868-77596890 ACTTTGGGAGGGAGGTTAAGGGG + Intronic
992551767 5:77866276-77866298 CGGGTGGGAGGGAGGCAGGGTGG + Intronic
992574578 5:78097045-78097067 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
992778752 5:80109840-80109862 GCTGGGGGAGGGAGCCTGGGAGG - Intergenic
992921373 5:81525328-81525350 CCTTGAGGATGGAGGGTGGGAGG - Intronic
992978425 5:82140580-82140602 CCTCCGGGAGGGAGGTGGGGGGG + Intronic
992999141 5:82362992-82363014 CACTTGGGAGGGAGGCTGCAGGG + Intronic
993657701 5:90595568-90595590 CATCTGGGAGGGAGGTTGGGGGG - Intronic
994721677 5:103387519-103387541 ACTTGAGGATGGAGGCTGGGAGG - Intergenic
994820522 5:104645074-104645096 TCTGAGGGTGGGAGGCTGGGAGG - Intergenic
995193914 5:109342814-109342836 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
995523302 5:113031156-113031178 CTTTTGGGAGAGAGGATGGAAGG + Intronic
996069908 5:119122141-119122163 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
996069983 5:119122317-119122339 CCTCCGGGAGGGAGGTGGGGGGG - Intronic
996070036 5:119122445-119122467 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
996470257 5:123852314-123852336 CCTGTGGGTAGGAGGCTGGTGGG + Intergenic
997161680 5:131615654-131615676 ACTTTGGGAGGCAGAGTGGGCGG + Intronic
997367403 5:133334866-133334888 TCTCTGGGGAGGAGGCTGGGTGG + Intronic
997461195 5:134053566-134053588 GCTCTGGGAGGAAGCCTGGGGGG + Intergenic
997535443 5:134616985-134617007 ACTTTGGGAGGCTGGATGGGAGG + Intronic
997560937 5:134845854-134845876 GCTTTGGGAGGGAGCCAGGCTGG - Intronic
997874863 5:137538062-137538084 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
998431625 5:142075289-142075311 CGTCCGGGAGGGAGGCGGGGGGG - Intergenic
998431649 5:142075338-142075360 CGTTCGGGAGGGAGGTGGGGGGG - Intergenic
998631282 5:143901378-143901400 CCCTTGGGAGGAATGCAGGGAGG + Intergenic
998656921 5:144191583-144191605 GCTTAGGGAGGGAGGATGAGAGG - Intronic
999167912 5:149566499-149566521 TTTTTGGGGGGGAGGATGGGGGG - Intronic
999181121 5:149670618-149670640 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
999231573 5:150065148-150065170 CCTTTGGTGGGGAGGATGGGAGG - Intronic
999392569 5:151205014-151205036 CCATAGGGAGGGAGGGAGGGAGG - Intronic
999604059 5:153296705-153296727 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
1000985827 5:167860351-167860373 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
1001081314 5:168669746-168669768 CCTGTGGGAGGGAGGAAGTGGGG - Intronic
1001493472 5:172171946-172171968 ACTTTGGGAGGGGAGGTGGGTGG + Intronic
1001944836 5:175770419-175770441 CCCATGGCAGGGAGGCTGGCTGG - Intergenic
1002013862 5:176305515-176305537 CGTCTGGGAGGGAGGTGGGGGGG + Intronic
1002014086 5:176306016-176306038 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
1002205472 5:177560100-177560122 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
1002205526 5:177560227-177560249 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
1002499018 5:179635106-179635128 GGTGTGAGAGGGAGGCTGGGAGG - Intergenic
1002502658 5:179657418-179657440 GGTGTGAGAGGGAGGCTGGGAGG + Intergenic
1002524024 5:179805985-179806007 CCTGTGGGAGGGAGGGAGGGAGG - Intronic
1002830347 6:814860-814882 GCCTTGGGAGGGAGGCTGAATGG - Intergenic
1003004548 6:2368949-2368971 CCTGAGGCAGTGAGGCTGGGCGG - Intergenic
1003059965 6:2855185-2855207 CCTTTGTTCGGGAGGCAGGGGGG + Intergenic
1003277422 6:4664517-4664539 CCTTGGGAAGTGGGGCTGGGTGG - Intergenic
1003358766 6:5403026-5403048 CCTTTGGCAGGCAGGCAGGCAGG - Intronic
1003407353 6:5835713-5835735 CATCTGGGAGGGAGGTGGGGGGG - Intergenic
1003589208 6:7423105-7423127 CCTTTGGGAAGCAGGCAGGATGG - Intergenic
1004041855 6:11986971-11986993 ACTTTGGGAGGCAAGGTGGGCGG - Intergenic
1004388244 6:15189346-15189368 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
1004721921 6:18275317-18275339 CTTTGGGGTGGGAGACTGGGAGG - Intergenic
1004874668 6:19940284-19940306 CATCTGGGAGGGAGGTGGGGGGG + Intergenic
1005004079 6:21270535-21270557 GCTTTGGGAGGGAGAGTTGGGGG - Intergenic
1005385192 6:25279084-25279106 GGTTTGGGAGGGAGGCTGCGAGG + Intronic
1005606648 6:27484737-27484759 CCTCCGGGAGGGAGGTGGGGGGG - Intergenic
1005837281 6:29718876-29718898 CGTCCGGGAGGGAGGCGGGGGGG + Intergenic
1005865402 6:29932924-29932946 CATCCGGGAGGGAGGTTGGGGGG + Intergenic
1005994001 6:30920877-30920899 TGTGTGGGATGGAGGCTGGGCGG + Intronic
1006039809 6:31244240-31244262 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1006064582 6:31454511-31454533 CCTCCGGGAGGGAGGTGGGGGGG - Intergenic
1006143037 6:31942534-31942556 ACTTTGGGAGGCAAGGTGGGAGG - Intronic
1006231963 6:32595047-32595069 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
1006232299 6:32595779-32595801 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
1006232353 6:32595908-32595930 CGTCTGGGAGGGAGGTAGGGGGG - Intergenic
1006275866 6:33005248-33005270 ACTTTGGGAGGGAAGGTGGGTGG + Exonic
1006281876 6:33059935-33059957 CCTCCGGGAGGGAGGTGGGGGGG - Intergenic
1006346286 6:33485740-33485762 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
1006358213 6:33573075-33573097 ACCTTGGGAGGCAGGCTTGGAGG + Exonic
1006492509 6:34398082-34398104 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
1006492686 6:34398487-34398509 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
1006990107 6:38208084-38208106 CCTTTGGGAGCAGGGCTGGAAGG + Intronic
1007249901 6:40488454-40488476 CCTGCAGGAGGGAGGCTTGGAGG - Intronic
1007348570 6:41251614-41251636 ACTTAGGGGGTGAGGCTGGGAGG + Intergenic
1007403177 6:41616425-41616447 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1007674080 6:43580543-43580565 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
1007714965 6:43850579-43850601 CATTTGGGAGGCAGGGTGTGGGG + Intergenic
1008624608 6:53305109-53305131 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
1008645683 6:53511895-53511917 ACTTTGGGGGGGGGGGTGGGAGG + Intronic
1009320928 6:62286895-62286917 TCTGTGGAAGGGAGGTTGGGAGG + Intergenic
1009684271 6:66936329-66936351 AGCATGGGAGGGAGGCTGGGAGG + Intergenic
1009889354 6:69661590-69661612 ACTTGAGGGGGGAGGCTGGGAGG + Intergenic
1010030271 6:71266092-71266114 CATCCGGGAGGGAGGCGGGGAGG - Intergenic
1010097600 6:72064483-72064505 CCTCTGGGAGGGAGGGAGGTAGG + Intronic
1010240533 6:73611521-73611543 ACTTTGGGAGGCAAGGTGGGTGG - Intronic
1010245941 6:73660800-73660822 CCTCCGGGAGGGAGGTGGGGGGG - Intergenic
1010513188 6:76744547-76744569 CATCTGGGAGGGAGGTGGGGGGG + Intergenic
1010513299 6:76744809-76744831 CCTCCGGGAGGGAGGTGGGGGGG + Intergenic
1011148564 6:84244666-84244688 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
1011297382 6:85839044-85839066 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1011687994 6:89839620-89839642 ACTTTGGGATGGATGGTGGGTGG - Intronic
1012570367 6:100718512-100718534 ACTTTGGGAGGCAAGGTGGGCGG + Intronic
1012794572 6:103743073-103743095 CAGATGGGAGGGAGGCTGGGAGG + Intergenic
1012971863 6:105739584-105739606 CCTTTGGGAGTGAGGCTCATGGG - Intergenic
1012983664 6:105854046-105854068 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
1012998715 6:105999310-105999332 ACTTTGGGAGGCAAGGTGGGAGG + Intergenic
1012998847 6:106000537-106000559 CCTTGGTGAGGGAGGGAGGGAGG - Intergenic
1013044604 6:106471742-106471764 CCCTTTGGAGTGGGGCTGGGGGG - Intergenic
1013060010 6:106624578-106624600 ACTTTGGGAGGCAAGGTGGGTGG - Intronic
1013204697 6:107934831-107934853 CGTCTGGGAGGGAGGTGGGGGGG + Intronic
1013988012 6:116219710-116219732 ACTTTGGGAGGCAGAGTGGGCGG + Intronic
1014210497 6:118703447-118703469 ACTTTGGGAGGCTGGGTGGGAGG - Intronic
1014764165 6:125389144-125389166 CGTCCGGGAGGGAGGCCGGGGGG - Intergenic
1014787069 6:125631333-125631355 CCAGTGGGAGGCAGGCTGCGTGG - Intergenic
1014853561 6:126371009-126371031 ACTTTGGGAGGCAGGGCGGGTGG - Intergenic
1015220950 6:130802670-130802692 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1015838810 6:137453728-137453750 CCTTTTGGAGGGTGGCTGGTGGG - Intergenic
1016845535 6:148564844-148564866 CCCTAGGGAGGGAGAATGGGAGG - Intergenic
1016973449 6:149786167-149786189 CGTCTGGGAGGGAGGTTGGGGGG - Intronic
1016973473 6:149786217-149786239 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
1017170439 6:151450435-151450457 CGTCTGGGAGGGAGGTGGGGGGG + Intronic
1017214975 6:151899130-151899152 CGTCCGGGAGGGAGGCGGGGGGG - Intronic
1017660674 6:156670379-156670401 CTTCTGGGAGGGAGGTGGGGGGG + Intergenic
1017720619 6:157240909-157240931 CCCTGGGGAGGGAGGGAGGGAGG + Intergenic
1017843913 6:158240652-158240674 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
1017872722 6:158500819-158500841 CCTTTGGGAGGCGAGGTGGGTGG + Intronic
1018063163 6:160106167-160106189 CATGCTGGAGGGAGGCTGGGCGG + Exonic
1018207143 6:161446263-161446285 CTTTGGGAAGGGAGGCTTGGAGG + Intronic
1018295431 6:162339324-162339346 CGTCTGGGAGGGAGGTGGGGGGG + Intronic
1018377908 6:163231127-163231149 CCTTTGGGAGGCTGGCAAGGTGG + Intronic
1018597480 6:165498165-165498187 ACTTTGGGAGCTAGGGTGGGAGG + Intronic
1019174420 6:170153000-170153022 CCGGTGGGGGGGAGGTTGGGAGG - Intergenic
1019229384 6:170545841-170545863 CCTTTTAGAAGGAGCCTGGGAGG - Intronic
1019458831 7:1146461-1146483 CGTCCGGGAGGGAGGCGGGGGGG - Intergenic
1019459055 7:1146979-1147001 CATCCGGGAGGGAGGCGGGGGGG - Intergenic
1019981416 7:4624261-4624283 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1020056209 7:5118986-5119008 CATTTGGGGAGAAGGCTGGGAGG - Intergenic
1020097956 7:5378938-5378960 ACTTTGGGAGGCCGGGTGGGGGG + Intronic
1020284624 7:6670954-6670976 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
1020284718 7:6671180-6671202 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
1020325948 7:6975217-6975239 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
1020616336 7:10465611-10465633 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
1020657139 7:10940982-10941004 GCTTTGCGGGGGAGGGTGGGGGG + Intergenic
1020756653 7:12211459-12211481 CCTTCCGGAGCGAGGCTGAGCGG + Intronic
1020831737 7:13102807-13102829 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
1021011150 7:15467929-15467951 TGTTTGGGAGGGTGGCAGGGAGG - Intronic
1021672371 7:23046334-23046356 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
1021735561 7:23637237-23637259 CGTTCGGGAGGGAGGTGGGGGGG + Intronic
1021872595 7:25019217-25019239 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
1022005490 7:26262285-26262307 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1022083408 7:27045155-27045177 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1022203312 7:28138868-28138890 GCTCTGGGAGGTAGTCTGGGAGG - Intronic
1022274096 7:28838886-28838908 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
1022528101 7:31051340-31051362 GCTGTGGGATGGGGGCTGGGTGG + Intergenic
1023659951 7:42460911-42460933 CCAGTGCGAGGAAGGCTGGGAGG + Intergenic
1023723340 7:43117422-43117444 CCTTTGGTGGGGCGGGTGGGGGG - Intronic
1023831164 7:44039724-44039746 ACTTGGGGAGGGGGGGTGGGAGG - Intergenic
1023868317 7:44249403-44249425 CCCTTGGGAGGGCCCCTGGGAGG - Intronic
1024578889 7:50785679-50785701 CCTGGTGGAGGGAGGCTGGAAGG - Intronic
1024625883 7:51208371-51208393 CGTCTGGGAGGGAGGTGGGGGGG + Intronic
1024931153 7:54667685-54667707 CGTCCGGGAGGGAGGCGGGGGGG - Intergenic
1024931177 7:54667734-54667756 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
1025011436 7:55402253-55402275 CGTCCGGGAGGGAGGCGGGGGGG - Intronic
1025043257 7:55666934-55666956 ACTTTGGGAGGCGGGGTGGGCGG + Intergenic
1025103078 7:56151038-56151060 CTTCCGGGAGGGAGGTTGGGGGG + Intergenic
1025103198 7:56151311-56151333 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1025103325 7:56151613-56151635 CTTCCGGGAGGGAGGTTGGGGGG + Intergenic
1025706928 7:63874479-63874501 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1025800916 7:64785082-64785104 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1025803615 7:64809548-64809570 CATCTGGGAGGGAGGTGGGGGGG - Intronic
1025808555 7:64857006-64857028 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1025821322 7:64967568-64967590 CGTCCGGGAGGGAGGCAGGGGGG - Intergenic
1025852927 7:65258411-65258433 CGTCCGGGAGGGAGGCGGGGGGG + Intergenic
1025853336 7:65259304-65259326 CGTCCGGGAGGGAGGCGGGGGGG + Intergenic
1025909389 7:65815834-65815856 ACTTTGGGAGGGGGTCGGGGAGG - Intergenic
1026688248 7:72531051-72531073 ACTTTGGGAGGCAAGGTGGGTGG - Intergenic
1026723484 7:72852935-72852957 ACTTTGGGAGGCAAGGTGGGTGG - Intergenic
1027087526 7:75275088-75275110 CCTCCGGGAGGGAGGTGGGGGGG + Intergenic
1027315152 7:76981029-76981051 CCTGTGGGGGGGGTGCTGGGGGG - Intergenic
1027371268 7:77509636-77509658 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1027371317 7:77509763-77509785 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1028227274 7:88266212-88266234 CATCTGGGAGGGAGGTGGGGGGG - Intergenic
1028916556 7:96265933-96265955 CCTTTGTGAAGGAGGCTTGAGGG - Intronic
1029603830 7:101586323-101586345 GAATTGGGAAGGAGGCTGGGAGG + Intergenic
1029612497 7:101634594-101634616 ACTTTGGGAGGCAAGGTGGGAGG + Intergenic
1029741492 7:102494030-102494052 ACTTGGGGAGGGGGGGTGGGAGG - Intronic
1029759484 7:102593199-102593221 ACTTGGGGAGGGGGGGTGGGAGG - Intronic
1029776851 7:102689109-102689131 ACTTGGGGAGGGGGGGTGGGAGG - Intergenic
1030022371 7:105288350-105288372 ACTTTGGGAGGTAGGGCGGGTGG + Intronic
1030072361 7:105709087-105709109 ACTTTGGGAGGCAAGGTGGGTGG + Intronic
1030389961 7:108915502-108915524 GATTTGGGAGGAAGGGTGGGAGG - Intergenic
1030956414 7:115857617-115857639 ACTTTGGGAGGCAAGGTGGGTGG - Intergenic
1031017297 7:116588639-116588661 GCTTCGGGAGGGAGGGAGGGAGG - Intergenic
1031446279 7:121858491-121858513 CCCTTGGGAGGAAGGTAGGGAGG + Intergenic
1031912779 7:127534932-127534954 GCTGTGGGAGGCAGGGTGGGTGG + Intergenic
1032042922 7:128577094-128577116 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
1032271173 7:130408083-130408105 CCTTGGGGAAGGAGGCAGGAGGG - Intronic
1032430870 7:131860430-131860452 ACTTTGGGAGGCAAGGTGGGTGG - Intergenic
1032462483 7:132122303-132122325 CCTATGGGTGGGTGGGTGGGTGG + Intergenic
1032569957 7:132985764-132985786 CGTCCGGGAGGGAGGCGGGGGGG + Intronic
1032607364 7:133370133-133370155 CTTTTGGGGGGGAGGGTGGGCGG - Intronic
1032810172 7:135406298-135406320 TTTTTGGGGGGGAGGGTGGGGGG - Intronic
1033144942 7:138863226-138863248 CCTCTGTGAGGAAGGGTGGGCGG + Intronic
1033324004 7:140362886-140362908 CGTCCGGGAGGGAGGCGGGGGGG + Intronic
1033376084 7:140763241-140763263 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
1034101844 7:148457416-148457438 AGTGTGGGAGGGAGGCTGGGAGG - Intergenic
1034309897 7:150078231-150078253 CCTTTGGGAGGGAAGGAGAGAGG - Intergenic
1034410810 7:150941181-150941203 CCCTGGGGAGGCAGGCGGGGAGG + Intergenic
1034638474 7:152585584-152585606 CGTCCGGGAGGGAGGCGGGGGGG - Intergenic
1034638575 7:152585810-152585832 CATCTGGGAGGGAGGTGGGGGGG - Intergenic
1034723440 7:153315132-153315154 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
1034796951 7:154022390-154022412 CCTTTGGGAGGGAAGGAGAGAGG + Intronic
1034888994 7:154822710-154822732 CCTTTGAGAGGGTGCCAGGGAGG - Intronic
1034972450 7:155427688-155427710 CCGTAGGGAGTGTGGCTGGGGGG - Intergenic
1035051855 7:156003472-156003494 CCCTGGGAAGGGAGGCTGGGAGG + Intergenic
1035115075 7:156517396-156517418 GCTGTGTGAGGGAGGCTGTGTGG + Intergenic
1035115140 7:156517717-156517739 GCTGTGTGAGGGAGGCTGTGTGG + Intergenic
1035486283 7:159228728-159228750 CCTTTGGCCTGGAGACTGGGAGG + Intergenic
1035507733 8:149531-149553 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
1035914486 8:3604281-3604303 CCAGAGGGAGGGAGGCTGCGGGG + Intronic
1036454585 8:8895397-8895419 TCTCTGGGAGGGAGTGTGGGTGG - Intergenic
1036536531 8:9657303-9657325 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
1037150017 8:15626025-15626047 CTGTGGCGAGGGAGGCTGGGTGG + Intronic
1037278265 8:17204651-17204673 CCTTTTGGAGGGAGGAGGGTGGG + Intronic
1037632972 8:20675005-20675027 CCTTTAGGAGAGAAGCTGTGGGG + Intergenic
1038395792 8:27244546-27244568 CATTTGCCAGGGAGCCTGGGAGG + Intronic
1038448921 8:27626365-27626387 CCTTAGGGAGAGAGGCCTGGGGG + Intergenic
1038487662 8:27948349-27948371 CCTCTGGGAGGGAGGCAGGGAGG + Intronic
1038569529 8:28648625-28648647 CCTCTGGAAGGGAGGGAGGGAGG - Intronic
1038709139 8:29924994-29925016 ACTTGGGGAGGGAGGTTTGGAGG - Intergenic
1039153267 8:34529092-34529114 CATCTGGGAGGGAGGTGGGGGGG - Intergenic
1039153319 8:34529219-34529241 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
1039390416 8:37176129-37176151 TCTTTTGCAGGGAGGCAGGGAGG - Intergenic
1039418827 8:37418957-37418979 CTTTTTGGGGGGAAGCTGGGGGG + Intergenic
1039488273 8:37928060-37928082 CCTCCGGGAGGGAGGTTGGGGGG + Intergenic
1039740511 8:40378695-40378717 ACTTTGGGAGGCTGGGTGGGTGG + Intergenic
1039816659 8:41100523-41100545 CCTTTCCCAGGGAGGCTGGGTGG + Intergenic
1039881147 8:41626395-41626417 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
1039881175 8:41626448-41626470 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
1039945016 8:42121511-42121533 GCTTTGGGAGGCAAGGTGGGAGG - Intergenic
1039953689 8:42191320-42191342 CATCAGGGAGGGAGGCAGGGCGG - Intronic
1040785636 8:51159545-51159567 CATCCGGGAGGGAGGCGGGGGGG + Intergenic
1041070818 8:54125476-54125498 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1041070866 8:54125603-54125625 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
1041090159 8:54294582-54294604 CCTTTGAGACAGATGCTGGGGGG + Intergenic
1041201607 8:55455136-55455158 CCATGGGGAGGGACGCTGGGCGG + Intronic
1041358217 8:57022412-57022434 CATCTGGGAGGGAGGTGGGGGGG + Intergenic
1041847275 8:62344090-62344112 CCTTTGACAGCCAGGCTGGGGGG + Intronic
1042049271 8:64686438-64686460 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
1042317160 8:67436193-67436215 CCTTTGGCACAGAGGCTGAGTGG + Intronic
1042475788 8:69246045-69246067 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1042475860 8:69246221-69246243 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
1042586627 8:70346694-70346716 CCAGTGGAAGGGAGGCAGGGAGG + Intronic
1043619629 8:82173335-82173357 ACTTTGGGAGGCAAGGTGGGTGG + Intergenic
1043985832 8:86694081-86694103 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
1044483572 8:92722725-92722747 ACTTGAGGAGGGAGGCTAGGAGG + Intergenic
1044692526 8:94894908-94894930 CCCGTGGGAGAGAGGATGGGAGG - Intronic
1044729736 8:95220277-95220299 CCTTGAGGATGGAGGCTGGATGG - Intergenic
1045038027 8:98192571-98192593 CTTTTGGGAGTGAGGTTGTGGGG + Exonic
1045312840 8:101018148-101018170 CCCTTGGGAGTGAGGCAGGCAGG + Intergenic
1045385247 8:101666470-101666492 CTTTTGTGGTGGAGGCTGGGAGG - Intronic
1045485151 8:102625462-102625484 CCTTTGGGAGAGAAGGTGCGAGG - Intergenic
1045524051 8:102928269-102928291 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
1045524226 8:102928643-102928665 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
1046608656 8:116399533-116399555 CCTGTGGGAGAGAGGGAGGGAGG + Intergenic
1046636818 8:116680020-116680042 CGTCCGGGAGGGAGGCGGGGGGG + Intronic
1046746703 8:117883551-117883573 CCTTTAGGAGAGAGACTGAGTGG - Intronic
1047266625 8:123314875-123314897 CATCTGGGAGGGAGGTGGGGGGG + Intergenic
1047266895 8:123315511-123315533 CATCTGGGAGGGAGGTGGGGGGG + Intergenic
1047687629 8:127317243-127317265 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
1047847710 8:128825666-128825688 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
1047848058 8:128826460-128826482 CATCTGGGAGGGAGGTGGGGGGG - Intergenic
1047848130 8:128826609-128826631 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
1048368560 8:133758075-133758097 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1048914607 8:139169958-139169980 CTTTGGGGAAGTAGGCTGGGTGG + Intergenic
1049069733 8:140347142-140347164 CATTAGAGCGGGAGGCTGGGAGG + Intronic
1049149803 8:141027249-141027271 CCTGGGGGAGAGGGGCTGGGAGG - Intergenic
1049358697 8:142201614-142201636 CCTTCCAGGGGGAGGCTGGGGGG - Intergenic
1049501911 8:142971553-142971575 CCTAGGGGAGGGAGGCTGGGTGG - Intergenic
1049580615 8:143408939-143408961 CCTTGGGCAGGGATGCTGAGGGG + Intergenic
1049586101 8:143433038-143433060 CCTTGGGTTGGGAGGCTGGCGGG - Intergenic
1050016494 9:1239471-1239493 GCTTGAGGTGGGAGGCTGGGAGG - Intergenic
1050558206 9:6807775-6807797 CGTCTGGGAGGGAGGTGGGGGGG + Intronic
1050558278 9:6807925-6807947 CCTCCGGGAGGGAGGTGGGGGGG + Intronic
1051280900 9:15442066-15442088 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
1052492767 9:29189100-29189122 CGTCCGGGAGGGAGGCGGGGCGG - Intergenic
1052816568 9:33106663-33106685 GCCCTGGGAGGGAGGCAGGGAGG + Intronic
1052998927 9:34566544-34566566 TTTTTGGAAGGGAGGCTGGAGGG - Intronic
1053255761 9:36615202-36615224 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
1053255782 9:36615251-36615273 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
1053397799 9:37790129-37790151 CCTCAGGGAAGGAGGCTGGTTGG - Intronic
1053400890 9:37821009-37821031 CTTTGGGGAGGGAAACTGGGTGG - Intronic
1053416511 9:37950179-37950201 ACTTTGGGAGGTGGGGTGGGAGG - Intronic
1054792137 9:69266184-69266206 CTTGTGAGAGGGAGCCTGGGAGG + Intergenic
1054914162 9:70480459-70480481 GCTTAGGGAGGGAGGCAGTGAGG - Intergenic
1055137491 9:72841464-72841486 CATCCGGGAGGGAGGTTGGGGGG - Intergenic
1055414318 9:76064513-76064535 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
1055510012 9:76986690-76986712 ACTTTGGGAGGTGGGGTGGGTGG + Intergenic
1055586229 9:77761433-77761455 CTTCCGGGAGGGAGGTTGGGGGG + Intronic
1055586348 9:77761706-77761728 CGTCTGGGAGGGAGGTGGGGGGG + Intronic
1055586576 9:77762233-77762255 CTTCCGGGAGGGAGGTTGGGGGG + Intronic
1055593075 9:77838384-77838406 ACTTTGGGAGGCAAGGTGGGCGG - Intronic
1056019813 9:82430181-82430203 CCTTCTGAAGGGAGGCTGGAAGG + Intergenic
1056152602 9:83804282-83804304 CATCTGGGAGGGAGGTGGGGGGG + Intronic
1056254520 9:84785217-84785239 CCTGTGTGATGGAGGGTGGGAGG - Intronic
1056589898 9:87958473-87958495 GCTTTGGGAGGCAAGGTGGGTGG - Intergenic
1056624681 9:88244726-88244748 CGTCCGGGAGGGAGGCGGGGGGG - Intergenic
1056624706 9:88244775-88244797 CGTCCGGGAGGGAGGCGGGGAGG - Intergenic
1056722150 9:89081811-89081833 CCTTAGGGAGGGAGGAGAGGAGG - Intronic
1057072025 9:92106849-92106871 CCTTCTGAAGGGAGGCTGGAAGG - Intronic
1057082186 9:92181319-92181341 CCTTTGCAAGAGAGGCTGGTGGG + Intergenic
1058102928 9:100937198-100937220 CCTTGATGAGGGTGGCTGGGGGG + Intergenic
1058452617 9:105111377-105111399 ACTTTGGGAGGCTGGGTGGGTGG - Intergenic
1058480375 9:105387120-105387142 ATTTTTGGAGGGAGGCAGGGAGG + Intronic
1059932825 9:119278262-119278284 GCTGTGGGAGAGAGGCAGGGAGG - Intronic
1059961736 9:119571827-119571849 GCTTGGGGAGGTGGGCTGGGTGG + Intergenic
1060065415 9:120496720-120496742 CGTTCGGGAGGGAGGTTGGGGGG + Intronic
1060199886 9:121646225-121646247 CTTTTGGGAGGAAGTCTGGGGGG + Intronic
1060343322 9:122795847-122795869 ACTTTGGGAGGCAAGGTGGGTGG + Intergenic
1060351876 9:122867392-122867414 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
1060352097 9:122868053-122868075 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
1060491841 9:124090949-124090971 CCTTTGGGAGTGCAGGTGGGAGG + Intergenic
1060495649 9:124116556-124116578 ACTCTGGGCGGGAGGGTGGGAGG + Intergenic
1060687238 9:125624016-125624038 CGTCTGGGAGGGAGGTGGGGGGG + Intronic
1060703719 9:125780420-125780442 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
1060744152 9:126119103-126119125 CATTTTGGCGGGGGGCTGGGGGG + Intergenic
1060812276 9:126616476-126616498 CAATTGGGAGGGAGGCAGTGAGG + Intronic
1060985162 9:127815533-127815555 CCTCTGAGAGGGAGGCGGGAAGG + Exonic
1061022458 9:128025160-128025182 ACTTTGGGAGGTAGGGTGGGAGG - Intergenic
1061120197 9:128637238-128637260 CCTCTGGGCGGGAGCCTGGTCGG - Intronic
1061518788 9:131105088-131105110 CCTTTGGCAGGGACGGGGGGAGG + Intronic
1061679860 9:132237674-132237696 CCTTGGGGAGGGAGGCCTGTAGG - Intronic
1061746040 9:132741024-132741046 CATGTGGCAGGAAGGCTGGGTGG - Intronic
1061767431 9:132890308-132890330 CCTTTGAGACTAAGGCTGGGAGG - Intergenic
1061982738 9:134115690-134115712 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
1061983062 9:134116444-134116466 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
1061983363 9:134117149-134117171 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
1061983687 9:134117903-134117925 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
1062288757 9:135785411-135785433 CCTGTGGGTGGGTGGGTGGGTGG - Intronic
1062431991 9:136530344-136530366 CCTTTGTGTGGGAGGCGGGATGG + Intronic
1062614080 9:137388206-137388228 TTTTGGGGAGGGTGGCTGGGGGG - Intronic
1203405605 Un_KI270539v1:406-428 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1203405771 Un_KI270539v1:788-810 CCTCCGGGAGGGAGGTGGGGGGG + Intergenic
1186309444 X:8301990-8302012 CCTTGGGGAAGGAGGTTGGAAGG - Intergenic
1186349990 X:8731425-8731447 GCACTGGGAGGGAGTCTGGGAGG - Intronic
1187183561 X:16965045-16965067 CATCTGGGAGGGAGGTGGGGGGG - Intronic
1187184198 X:16968651-16968673 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
1187976328 X:24709021-24709043 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
1188367579 X:29333586-29333608 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
1188367678 X:29333803-29333825 CGTCCGGGAGGGAGGCGGGGGGG - Intronic
1188477273 X:30602708-30602730 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1189210363 X:39278021-39278043 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1189260516 X:39675386-39675408 CAGTTGGGAGGAAGGCTGGCAGG - Intergenic
1189295318 X:39913659-39913681 CCTTGGCAAGGGAGGCTGGAGGG + Intergenic
1189837765 X:45040777-45040799 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
1189921699 X:45908995-45909017 ACTTTGGGAGGCAGAGTGGGCGG - Intergenic
1189968402 X:46395742-46395764 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
1189968445 X:46395840-46395862 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
1190521191 X:51280280-51280302 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1190778987 X:53578338-53578360 CGTCTGGGAGGGAGGTGGGGGGG + Intronic
1190779189 X:53578788-53578810 CGTCTGGGAGGGAGGTGGGGGGG + Intronic
1190779290 X:53579014-53579036 CGTCCGGGAGGGAGGCGGGGGGG + Intronic
1191009933 X:55748768-55748790 CATCTGGGAGGGAGGTGGGGGGG + Intronic
1191637436 X:63393386-63393408 CCTCCAGGAGGGAGGTTGGGGGG + Intergenic
1191826742 X:65374509-65374531 CCTGTGGGAGGGATGCTTGGTGG - Intronic
1192134620 X:68585601-68585623 ACTTTGGGAGCCAGGTTGGGAGG - Intergenic
1192344034 X:70286617-70286639 TTTTTGGGAGAGAGGCTAGGAGG + Exonic
1192476942 X:71452114-71452136 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
1192567897 X:72179169-72179191 CGTCCGGGAGGGAGGCGGGGGGG + Intergenic
1192621222 X:72681378-72681400 CATCTGGGAGGGAGGTGGGGGGG + Intronic
1192621597 X:72682222-72682244 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
1192768653 X:74166813-74166835 CCTCCGGGAGGGAGGTGGGGGGG + Intergenic
1192768824 X:74167214-74167236 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1192768872 X:74167312-74167334 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1193068111 X:77279564-77279586 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1193068155 X:77279663-77279685 CATCTGGGAGGGAGGTGGGGGGG + Intergenic
1193345167 X:80396907-80396929 CGTCTGGGAGGGAGGTGGGGGGG - Intronic
1193362314 X:80591458-80591480 CGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1193362338 X:80591507-80591529 CTTCTGGGAGGGAGGTGGGGGGG + Intergenic
1194611471 X:96050921-96050943 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
1195035979 X:100972363-100972385 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
1196404369 X:115347495-115347517 CGTCTGGGAGGGAGGTGGGGGGG - Intergenic
1196767608 X:119262389-119262411 CCTTTTGGAGGTAGGGAGGGAGG + Intergenic
1196853204 X:119958613-119958635 ACTTTGGGAGGCAAGGTGGGCGG + Intergenic
1198007217 X:132507663-132507685 ACTTTGGGAGGCAAGGTGGGCGG + Intergenic
1198197879 X:134382996-134383018 GCTTTGGGAGGCCGACTGGGAGG + Intronic
1199452574 X:147992294-147992316 CCTCTGGGAGGGAGGTGGGGGGG - Intronic
1199689565 X:150298089-150298111 CCTTGGGGTGGGGGGCCGGGGGG + Intergenic
1199748673 X:150793893-150793915 CCAGTGGGAGGGGGTCTGGGGGG - Intronic
1200123029 X:153800195-153800217 GCCTTGGGAGGGGGGTTGGGAGG + Intergenic
1200915104 Y:8564606-8564628 CATTTGTGAGGCAGGCTTGGGGG - Intergenic