ID: 961312010

View in Genome Browser
Species Human (GRCh38)
Location 3:126008403-126008425
Sequence GTGTGGGTTGCACTGTGTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 251}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961312010 Original CRISPR GTGTGGGTTGCACTGTGTTG TGG Intronic
901351202 1:8598437-8598459 GGGTGGGTTGCACCGTTCTGAGG + Intronic
902082794 1:13832741-13832763 GGCTGGGTTCCACTGTCTTGCGG + Intergenic
902818313 1:18928517-18928539 GTGTGGGTGGCAGTGTTCTGGGG - Intronic
905174478 1:36127145-36127167 GTGTGGGTGGCTGTGTGTGGGGG + Intergenic
906617183 1:47241426-47241448 GTGTGGTTGGCACCATGTTGTGG - Intergenic
907311043 1:53539213-53539235 GTGTGTGTTGGTGTGTGTTGGGG - Intronic
910353655 1:86329587-86329609 GTGTGGTTTGCATTTTTTTGAGG - Intergenic
912725606 1:112056797-112056819 GAGTGGCTTGGACTGTATTGGGG - Intergenic
913088771 1:115461919-115461941 GTCTTGGTTTCCCTGTGTTGTGG + Intergenic
914944216 1:152049167-152049189 GTGGAGGTTGCAGTGTGCTGAGG + Intergenic
915125324 1:153659615-153659637 CAGTGGCTTTCACTGTGTTGAGG - Intronic
915944484 1:160140004-160140026 GTGGGGCTTGCACTTTGCTGGGG - Intronic
916998658 1:170330477-170330499 TTGTGGGTGGCACTGTGCTATGG - Intergenic
917297375 1:173535559-173535581 CTGAGGGTTGTAGTGTGTTGCGG - Intronic
917864332 1:179178827-179178849 GTGGAGGTTGCAGTGAGTTGAGG + Intronic
919760436 1:201094750-201094772 GTGTGGGGTACACTGTGTGTGGG + Intronic
921120021 1:212128051-212128073 GTGGAGGTTGCAGTGAGTTGAGG - Intergenic
922693543 1:227713608-227713630 CCGTGGGTTGCACAGTTTTGTGG - Intergenic
922750734 1:228068975-228068997 GTGTGGGGGGCACTGTGTAGGGG + Intergenic
923546052 1:234923976-234923998 GGGTGCGTTGCACTATGCTGGGG - Intergenic
1065286431 10:24191819-24191841 GTGGAGGTTGCAGTGAGTTGAGG - Intronic
1065783516 10:29192221-29192243 CTTTGGGTTGCCCTGTCTTGTGG + Intergenic
1065967755 10:30783097-30783119 GGGTGGGCTGCCCTGTGTCGTGG + Intergenic
1068602919 10:58974674-58974696 GTGGGGGTTGCAGTGAGCTGAGG - Intergenic
1070039892 10:72766056-72766078 GTGGGGGTCTCACTGTTTTGCGG + Intronic
1070880792 10:79850812-79850834 GGGTGGGAAGCAGTGTGTTGGGG + Exonic
1071107635 10:82116944-82116966 GAGTGGGTTGCAGCTTGTTGAGG - Intronic
1071376488 10:85010714-85010736 GTGGGTGTTGTCCTGTGTTGAGG - Intergenic
1071647364 10:87367131-87367153 GGGTGGGAAGCAGTGTGTTGGGG + Exonic
1073179045 10:101573174-101573196 GTGTGGGTATGACTGTGATGAGG - Intronic
1074003276 10:109393468-109393490 CTGTGGGTTGCACAGTTCTGTGG - Intergenic
1074159565 10:110826401-110826423 CTGGGGGTTGCACTGTGGGGAGG - Intronic
1074597009 10:114876799-114876821 GAGTGGGGTGCACTGTGGGGAGG - Intronic
1077499514 11:2902834-2902856 CTGAGAGCTGCACTGTGTTGGGG + Intronic
1078011406 11:7575826-7575848 GGGTGGGTCACACTGTGCTGTGG + Intronic
1081994756 11:47356242-47356264 GTGTGGGTGCCAGTGTGTGGGGG - Intronic
1084674658 11:70627052-70627074 GTGGGGGTGGCATGGTGTTGGGG + Intronic
1086990822 11:93302540-93302562 ATGTGGCTTTCATTGTGTTGAGG - Intergenic
1088363190 11:109012409-109012431 CTTTGGGCTGCCCTGTGTTGGGG - Intergenic
1089761739 11:120731207-120731229 GTATGGCTTTTACTGTGTTGAGG + Intronic
1090369860 11:126241955-126241977 GTGGAGGTTGCACTGAGTTGCGG + Intronic
1090373988 11:126276318-126276340 GTGTGGGGTGGACAGGGTTGGGG + Intronic
1090897472 11:130991176-130991198 ATGTGTGGTGGACTGTGTTGGGG + Intergenic
1090989310 11:131801886-131801908 GTGTGGGTGGCACAGGGCTGGGG - Intronic
1091027972 11:132158986-132159008 GTGTGGGTTTCACTGTGGAGGGG + Intronic
1092595907 12:10004360-10004382 GTGGGGGTTTTACTGAGTTGTGG + Intronic
1093786917 12:23203238-23203260 GTGTGGGTTGTTCTTTGGTGAGG - Intergenic
1094028003 12:25979449-25979471 GTGAGGTTAGCACTGAGTTGAGG + Intronic
1094318396 12:29157427-29157449 GTGTGGGCTTCAATGTTTTGGGG - Intronic
1098170120 12:67738255-67738277 GACGGGGTTTCACTGTGTTGGGG + Intergenic
1098170122 12:67738271-67738293 GTTGGGGTTTCACTGTGTTAGGG + Intergenic
1103630179 12:122253763-122253785 GTGTAGGTTGCAGTGAGCTGAGG - Intronic
1103703709 12:122860522-122860544 GTGTAGGTTGCCCTGGGTGGGGG + Exonic
1106977747 13:35241843-35241865 ATGTATGCTGCACTGTGTTGAGG - Intronic
1109689032 13:65861951-65861973 ATGAGGGTTGCACTGTGCTGGGG + Intergenic
1111658875 13:91184527-91184549 GTGTCGTTTGCTCTGTGTTGTGG + Intergenic
1112613385 13:100978034-100978056 GTGTGGGTTCCCCTGTGAGGAGG - Intergenic
1113744685 13:112735615-112735637 GTTTTGGTTGCATTGTGTAGAGG + Intronic
1113916308 13:113876033-113876055 GTGTGGGTGTCACTGTGGTGTGG + Intergenic
1113916311 13:113876050-113876072 GTGTGGGTATCACTGAGGTGTGG + Intergenic
1113916324 13:113876118-113876140 GTGTGGGTGTCCCTGTGGTGTGG + Intergenic
1113916352 13:113876271-113876293 GTGTGGGTGTCGCTGTGGTGTGG + Intergenic
1113916363 13:113876322-113876344 GTGTGGGTGTCCCTGTGGTGGGG + Intergenic
1113916374 13:113876373-113876395 GTGTGGGTGTCGCTGTGGTGTGG + Intergenic
1113916376 13:113876390-113876412 GTGTGGGTGTCCCTGTGATGTGG + Intergenic
1113916381 13:113876407-113876429 ATGTGGGTGTCACTGTGGTGTGG + Intergenic
1113916394 13:113876475-113876497 GTGTGGGTGTCCCTGTGGTGTGG + Intergenic
1113916399 13:113876492-113876514 GTGTGGGTGTCCCTGTGGTGTGG + Intergenic
1113916417 13:113876577-113876599 GTGTGGGTGTCACCGTGGTGTGG + Intergenic
1113916426 13:113876628-113876650 GTGTGGGTGTCACTGTGGTGTGG + Intergenic
1113916429 13:113876645-113876667 GTGTGGGTGTCCCTGTGGTGTGG + Intergenic
1113916434 13:113876662-113876684 GTGTGGGTGTCACTGTGGTGTGG + Intergenic
1113966301 13:114155558-114155580 GTGTGGGATGCACGGTGTGAGGG + Intergenic
1113966864 13:114157585-114157607 GTGTGGATTGCAGTGTTTCGGGG - Intergenic
1115228166 14:31127037-31127059 GTGGGGGTTGCAGTGAGCTGAGG - Intronic
1115330446 14:32190984-32191006 GTGTAGTAGGCACTGTGTTGGGG + Intergenic
1116942959 14:50809151-50809173 GTGTAGGTTGCAGTGAGCTGAGG + Intronic
1119516403 14:75251959-75251981 GTGGGGGTTGCAGTGAGCTGAGG + Intronic
1120880164 14:89409393-89409415 GTGTTGGATGCCCTGTGTTGAGG - Intronic
1122116017 14:99527652-99527674 GCGTGGGTTGCACAGTTCTGAGG - Intronic
1122424411 14:101597384-101597406 GTGGAGGTTGCAGTGAGTTGAGG - Intergenic
1123977056 15:25563587-25563609 GTGTGGAGGGCACTGTGATGTGG + Intergenic
1125724141 15:41859663-41859685 GTCAGGGTGGCACTGTGCTGGGG + Intronic
1127301908 15:57663192-57663214 GGGTGGGGGGCACTGTCTTGGGG - Intronic
1129756985 15:78104704-78104726 GTGAGGATTCCACGGTGTTGGGG + Exonic
1132079232 15:98851016-98851038 GTTTTGGTAGCACTGTGTTAAGG - Intronic
1132659580 16:1055358-1055380 GTGGGGGCTGCACGGTGGTGTGG + Intergenic
1133970000 16:10560674-10560696 GTGTGATTGGCCCTGTGTTGGGG + Intronic
1134431458 16:14211716-14211738 CTGTGAGTTGCACTGTGGTATGG + Intronic
1135052570 16:19204550-19204572 GTTTGGGGTGCAGGGTGTTGAGG + Intronic
1135996627 16:27254651-27254673 GTGGGGGTTGCAGTGAGCTGAGG - Intronic
1137040428 16:35606703-35606725 GTGGAGGTTGCAGTGAGTTGAGG + Intergenic
1139475857 16:67202256-67202278 GTGTGAGCTGCTCCGTGTTGGGG + Exonic
1141441623 16:84033032-84033054 GTGTGGGTAGGTGTGTGTTGTGG + Intronic
1141757687 16:86003275-86003297 GTCTGTGTTGCAGTGTGCTGTGG + Intergenic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1142675000 17:1508162-1508184 CTTTGGGTTGCACTTTGTTCGGG - Exonic
1144583897 17:16476298-16476320 GTGGAGGTTGCAGTGAGTTGAGG + Intronic
1145896840 17:28463612-28463634 GTGTAGGTTGCAGTGAGTTGAGG - Intronic
1146590596 17:34125159-34125181 GTGTCAGTAGCACTGTGGTGAGG - Intronic
1147508792 17:41047285-41047307 GTGTGGGTTGGGCTGTGGAGAGG + Exonic
1147509531 17:41055229-41055251 GTGTGGGTTGGGCTGTGGAGAGG + Exonic
1149287051 17:55176627-55176649 GTGTCAGTTTTACTGTGTTGAGG + Intergenic
1151620661 17:75242983-75243005 ATGTGGTTTGCACTGTGCTGCGG - Intronic
1152486286 17:80595897-80595919 GTTTGGGATGCAGTGTTTTGAGG + Intronic
1153391606 18:4568160-4568182 GTGATGGTTGCACGGTATTGCGG + Intergenic
1155847730 18:30730925-30730947 CTGTGGGTTGCACAGTTCTGCGG - Intergenic
1157489140 18:48110214-48110236 GTGTGGTATGGACTGTGGTGGGG - Intronic
1157856336 18:51108917-51108939 GTGAGGGTTGCAGTGAGCTGAGG - Intergenic
1162225954 19:9222943-9222965 GTGTGGTTTTTACTATGTTGAGG + Intergenic
1162753863 19:12845514-12845536 GTGGGGGTTGCAGTGAGTGGAGG + Intronic
1164737869 19:30555083-30555105 CTCTGGGTTGCACTGTGCTGGGG - Intronic
1165435670 19:35793384-35793406 ATTTGGGGAGCACTGTGTTGAGG - Intergenic
1167169828 19:47823715-47823737 GTGGAGGTTGCACTGAGCTGAGG - Intronic
1167227010 19:48251899-48251921 GTATGGGTGGCTCTGTGTTCAGG - Intronic
1167773272 19:51536899-51536921 GTTTGGGCTGCACAGTGTTAAGG + Intergenic
925597281 2:5568338-5568360 GTGTGGGCTGCACTGTGACGTGG - Intergenic
925668360 2:6286306-6286328 GTGTGGGTTGTACTGATTTGTGG + Intergenic
926985230 2:18615529-18615551 GTGTGTGTTGTACTTTGTTTTGG - Intergenic
927361909 2:22245874-22245896 GTAGGGGTTGCCCTGTGATGAGG - Intergenic
927800080 2:26090743-26090765 GAGGGGGTTTCACTATGTTGGGG - Intronic
927887005 2:26724874-26724896 GTGTGGGAAGCACTGTGGAGAGG + Intronic
929269216 2:39954780-39954802 GTCCAGGTTGCACTGTGTTATGG + Intergenic
930282290 2:49384790-49384812 GTGTGAGTTGTAAAGTGTTGAGG + Intergenic
931090380 2:58879522-58879544 GTATGGGTTGCATTCTGCTGGGG + Intergenic
931527534 2:63173198-63173220 GTGGGGGTTGCAGTGAGCTGAGG + Intronic
932026452 2:68138520-68138542 ATGTGGTTTGCACAGCGTTGGGG - Intronic
933648270 2:84829613-84829635 GTGGGGTTTGCGTTGTGTTGTGG - Intronic
934117011 2:88808118-88808140 GTGTTGATTGCAATGTGTTCTGG + Intergenic
937872833 2:126798184-126798206 GTGTGGGTGTCACTGTGTGTGGG + Intergenic
937929701 2:127194526-127194548 ATGTGGGTTGTCCTGGGTTGAGG - Intronic
939645862 2:144698253-144698275 TTATGGGTTGCTCTGTGCTGTGG + Intergenic
940433426 2:153621658-153621680 GAGTGGGAAGGACTGTGTTGGGG - Intergenic
943069375 2:183122813-183122835 AAGTGGATTGCCCTGTGTTGTGG + Intronic
946307849 2:218866146-218866168 GTGGGGGTTGCACAGGGGTGGGG - Intronic
946513076 2:220381302-220381324 ATGTGGCTTTTACTGTGTTGTGG + Intergenic
1168916800 20:1495414-1495436 ATATGGGTTGTACTATGTTGAGG + Intergenic
1169607607 20:7340163-7340185 GTGGTGGCTGCACTGGGTTGGGG - Intergenic
1171126664 20:22608142-22608164 GTTTGTGTTGCACTGAGCTGAGG + Intergenic
1172273660 20:33668250-33668272 GGGGGGGTGGCACTGCGTTGGGG + Exonic
1172518692 20:35553641-35553663 GTGGGGGTGGGGCTGTGTTGGGG + Intronic
1172936997 20:38627537-38627559 GTGTGTGTTGGTGTGTGTTGGGG + Intronic
1173267385 20:41497065-41497087 TTTTGGGTTGCAGTGGGTTGAGG + Intronic
1173546414 20:43901788-43901810 GTGTGATCTGCACTGTGTTGGGG - Intergenic
1174484064 20:50850620-50850642 GGGGGGGTTGCTCTTTGTTGAGG + Intronic
1174775761 20:53341776-53341798 GTGGAGGTTGCAGTGAGTTGAGG - Intronic
1174898957 20:54478237-54478259 CTTTGGTTTGCACTGTGTTCTGG - Intronic
1175171669 20:57085321-57085343 GTGTGGGGTTCAGTCTGTTGTGG + Intergenic
1177012000 21:15742046-15742068 GGGTGGGATGAACTGTGGTGAGG + Intronic
1177293524 21:19146633-19146655 GTGGAGGTTGCAGTGTGCTGAGG - Intergenic
1177814635 21:25962878-25962900 GTGGAGGTTGCAGTGAGTTGAGG - Intronic
1178318834 21:31589481-31589503 ATGGGGGTTTCACTATGTTGGGG - Intergenic
1178739686 21:35186898-35186920 GTGGAGGTTGCAGTGAGTTGAGG - Intronic
1179391167 21:40993045-40993067 GTGTGGTATGCAGTGTGTGGGGG - Intergenic
1179945073 21:44667913-44667935 GTATGGCTTGTATTGTGTTGAGG - Intronic
1180234529 21:46449790-46449812 TTCTGGGTTGTGCTGTGTTGCGG - Intergenic
1180876466 22:19177365-19177387 GTGTGGGCTGCCCTGTGTCCCGG - Intronic
1181730593 22:24843483-24843505 CTGTGGGTTCCACTGGGTGGGGG + Intronic
1181769401 22:25114351-25114373 GTGTGCCTGGCACTGTGCTGGGG - Intronic
1183049597 22:35250130-35250152 CTGTGGGTTGGAATGTGGTGGGG - Intergenic
1184297024 22:43531301-43531323 GTGTGGCCTGAAGTGTGTTGGGG - Intronic
1184409781 22:44319825-44319847 GAGTGGGATGCACTGTGCCGGGG + Intergenic
1184843021 22:47063553-47063575 GTTTGGGGAGCACTGTGTTGAGG + Intronic
952223375 3:31348047-31348069 CTGTGGGTTGCACATTGTGGAGG - Intergenic
952503862 3:33989606-33989628 TCGTGGGTTGCACAGTTTTGTGG + Intergenic
953887218 3:46721687-46721709 GTGTGGTGTGCAATGTTTTGAGG - Intronic
954655292 3:52190755-52190777 CTGTAGGGTGCACTGTGTGGGGG + Intergenic
956677897 3:71753241-71753263 ATGTGGGTGGCAGTGTGCTGGGG - Intronic
957090495 3:75725138-75725160 GTGAGGGTTTCACTGAGTCGAGG - Intronic
957248550 3:77743388-77743410 GTGGAGGTTGCAGTGTGCTGAGG + Intergenic
961312010 3:126008403-126008425 GTGTGGGTTGCACTGTGTTGTGG + Intronic
963314771 3:143747334-143747356 GTGGGGGTTGCAGTGAGCTGAGG + Intronic
963575576 3:147058102-147058124 GTGATGGCTGCACCGTGTTGAGG + Intergenic
965058340 3:163750003-163750025 GGGGTGGTTGCACTGTGCTGGGG - Intergenic
965676800 3:171206008-171206030 GTAAGGGTTGCAATGTGTTATGG - Intronic
968451511 4:678214-678236 GTGTGGGCTGTGCTGTGTTGTGG + Intronic
968567791 4:1323626-1323648 GTGGGGCTGGCACTGTGTAGTGG - Intronic
969308353 4:6338357-6338379 CTGGGTGTTGCACGGTGTTGTGG + Intronic
969914166 4:10473738-10473760 TTGAGGGTTGCACTGTCTGGAGG - Intergenic
972901769 4:43693867-43693889 ATGTGGGTTTTATTGTGTTGAGG + Intergenic
975167786 4:71197145-71197167 GTGGGGGTTGCAGTGAGGTGAGG + Intronic
975846091 4:78526577-78526599 GTGTGGGCTGCACTGTGCAAGGG - Intronic
976708058 4:88039595-88039617 GTGGGGGTTGCAGTGAGCTGAGG + Intronic
977422620 4:96821963-96821985 CAGTGGGTGGCACTGTGCTGAGG - Intergenic
981706994 4:147670245-147670267 GTGGAGGTTGCAGTGAGTTGAGG - Intronic
981880486 4:149605360-149605382 ATGTGGGTGGGACTGTGATGTGG + Intergenic
982254214 4:153436390-153436412 GTGTGTGTTGAACTGGGTTCTGG + Intergenic
983066268 4:163213032-163213054 GTGGAGGTTGCAGTGAGTTGAGG - Intergenic
984110489 4:175607198-175607220 TTTTGGGTTGCATTGAGTTGAGG + Intergenic
984494304 4:180475294-180475316 GTGTGAGTTGCCCTGTGATGGGG + Intergenic
986059610 5:4175477-4175499 GTGGAGGTTGCAGTGAGTTGGGG + Intergenic
986900800 5:12430953-12430975 GTGTGTGATGCACTGTGGGGTGG - Intergenic
987065916 5:14289315-14289337 GTGTAGGTTGCAGTGAGCTGAGG + Intronic
987847649 5:23307095-23307117 GTGGGGGTTGCAGTGAGCTGAGG - Intergenic
989189178 5:38653521-38653543 GTGGGGATTGCATTGTGCTGGGG + Intergenic
989468159 5:41782280-41782302 GTGGAGGTTGCACTGAGCTGAGG - Intronic
992510035 5:77423705-77423727 GTGAGGGTTGCAGTGAGCTGAGG - Intronic
993117327 5:83734121-83734143 CTGTGGGTTGCACGGTTCTGTGG + Intergenic
993200122 5:84805158-84805180 GTCTGGGGTGCATTCTGTTGAGG + Intergenic
997632225 5:135377534-135377556 TCGTGGGCTGCACTGTGTTGGGG + Intronic
1000822673 5:166003970-166003992 GTGTGGGCTGTACTGTGGTATGG - Intergenic
1004760024 6:18656379-18656401 CTGTGGGTTGCACAGTTCTGTGG - Intergenic
1004769736 6:18768557-18768579 GTGTAGGTTGCATTGAGCTGAGG + Intergenic
1006093421 6:31641579-31641601 GTGTGGGTTGCCATCTGTGGAGG + Exonic
1007198283 6:40082484-40082506 GTATGGGTTGGGCTGGGTTGTGG + Intergenic
1008480369 6:51979566-51979588 GTGTGGGTGACTATGTGTTGGGG - Intronic
1008823169 6:55658416-55658438 GTGGTGTTTGCACTGGGTTGGGG - Intergenic
1017471981 6:154747441-154747463 GTGGAGGTTGCAGTGAGTTGAGG + Intronic
1018283942 6:162217446-162217468 GTGGGGGTTGCAGTGAGCTGAGG - Intronic
1018592971 6:165447517-165447539 GTGTGGAATGCAGTCTGTTGTGG - Intronic
1019121279 6:169806703-169806725 CTGTGGAGTGCTCTGTGTTGTGG - Intergenic
1020077547 7:5268351-5268373 GTGGAGGTTGCAGTGAGTTGAGG - Intergenic
1020748591 7:12111418-12111440 GTGGGGGTTGCAGTAAGTTGTGG - Intergenic
1020799914 7:12720666-12720688 GATGGGGTTTCACTGTGTTGAGG - Intergenic
1022067205 7:26871573-26871595 GTCTTGGTTGCTCTGTCTTGTGG - Intronic
1022669942 7:32446470-32446492 GGGTGTGTTGCACTTTGGTGGGG - Intergenic
1022795581 7:33729044-33729066 GAGTGAGTTACACTGTGTTTAGG - Intergenic
1024442695 7:49438911-49438933 TTGTGTGTTGCATTGTGATGTGG - Intergenic
1024579243 7:50788496-50788518 GTGCAGGTGGCACTGCGTTGGGG - Intronic
1025191127 7:56896794-56896816 GTGGGGGTTGCAGTGAGCTGTGG + Intergenic
1025201582 7:56965324-56965346 GTGGAGGTTGCAGTGAGTTGAGG + Intergenic
1025670362 7:63611606-63611628 GTGGAGGTTGCAGTGAGTTGAGG - Intergenic
1025680821 7:63680136-63680158 GTGGGGGTTGCAGTGAGCTGTGG - Intergenic
1028572392 7:92305426-92305448 GTGTTTGTGACACTGTGTTGGGG + Intronic
1031249429 7:119360193-119360215 GTGTGAGTTTCTTTGTGTTGGGG - Intergenic
1032585713 7:133144600-133144622 GTGTGGGTTACAGTCTGGTGGGG + Intergenic
1035394784 7:158527669-158527691 GTGTGGGCTCCACTCTGTGGGGG + Intronic
1035599621 8:889914-889936 CCGTGGGTTGCACGGTTTTGTGG + Intergenic
1036024912 8:4896053-4896075 GTGTGGTTTGCACTATTTAGAGG + Intronic
1036223867 8:6942427-6942449 GTGTGGGTTGCCCTCTAATGTGG + Intergenic
1039425041 8:37478583-37478605 ATGTGTGTTGAACTGTATTGAGG - Intergenic
1039542007 8:38380970-38380992 GTGTGGGTTTTACTGTTTTGAGG - Intronic
1040386069 8:46915914-46915936 GTGGAGGGTGCAGTGTGTTGGGG + Intergenic
1041685853 8:60644013-60644035 GTGTGGGCTGCAGAGCGTTGGGG + Intergenic
1042564997 8:70102092-70102114 GTGTGGTTTGCACTGTGGCCTGG + Intergenic
1043782532 8:84354175-84354197 GGGTGGCTTTCACTGAGTTGAGG - Intronic
1044165740 8:88981799-88981821 GTGATGGATGCACTGTGATGTGG + Intergenic
1052646727 9:31246101-31246123 GTGGGGGTTGCAGTGAGCTGAGG - Intergenic
1053276260 9:36785862-36785884 GTGTGGATTTAAGTGTGTTGCGG - Intergenic
1053291688 9:36883601-36883623 GTGTAGGTTGCAGTGAGCTGAGG + Intronic
1053919201 9:42972095-42972117 CTGTGGGCTGAGCTGTGTTGGGG - Intergenic
1054820367 9:69515762-69515784 GTGTGGGAAGCACTGATTTGAGG + Intronic
1055323686 9:75106575-75106597 GTGGAGGTTGCAGTGAGTTGAGG + Intronic
1055449919 9:76421623-76421645 GTGTGGGTTGTTTTTTGTTGTGG - Intronic
1056967640 9:91178414-91178436 GTGTGGGCAGCACTGGGGTGTGG + Intergenic
1057053690 9:91945685-91945707 GTGTGGTTGGCACTGTTTTTGGG - Intronic
1057077375 9:92145465-92145487 GTGGGGGTTGCATGGTGTAGCGG - Intergenic
1057672039 9:97100512-97100534 GTGGAGGTTGCACTGAGCTGAGG + Intergenic
1057723290 9:97549955-97549977 GTGGTGGTTGCACAATGTTGTGG - Intronic
1057735317 9:97653186-97653208 GCGGAGGTTGCACTGAGTTGAGG - Intronic
1057907539 9:98994135-98994157 GTTGGGGAGGCACTGTGTTGGGG + Intronic
1058698548 9:107581407-107581429 GTGGAGGTTGCAGTGAGTTGAGG + Intergenic
1060005590 9:119996866-119996888 GTGTAGGTTGGACAGTGGTGAGG + Intergenic
1060297204 9:122350858-122350880 GTGGGGGTTGCCCTGTTCTGGGG + Intergenic
1060321182 9:122562476-122562498 CTGTGGGTTGCACAGTTCTGTGG + Intergenic
1061325048 9:129858626-129858648 TTGTTGGTGACACTGTGTTGAGG + Intronic
1062292607 9:135803663-135803685 GTGTGGGGTGCAGGGTGTGGAGG + Intergenic
1062634399 9:137482659-137482681 GTGTGTGGTGCAGTGTGGTGTGG - Intronic
1186227770 X:7419889-7419911 CTGTGGATTGCAATGTGTTTTGG + Intergenic
1189852089 X:45187874-45187896 GTGTGTGTTGCTGTGTGTTTAGG - Intronic
1190743403 X:53305836-53305858 CTTTGGGCTGCACTGTGTGGTGG - Intronic
1192951873 X:76026114-76026136 CTGTGGGTTGCACAGTTCTGTGG - Intergenic
1193533593 X:82686353-82686375 GGAGGGGTTGCACTGTGCTGTGG + Intergenic
1193742667 X:85236686-85236708 GTGTGACTTTTACTGTGTTGTGG - Intergenic
1193943750 X:87707675-87707697 GTGTGGCTTCCCCAGTGTTGGGG + Intergenic
1194058270 X:89164129-89164151 CTGTGGGTTGCACAGTTCTGTGG + Intergenic
1195979427 X:110561566-110561588 CTGTGGGTTGCACAGTTCTGTGG + Intergenic
1197071567 X:122304802-122304824 GTGTGGGATGCAGTGCTTTGTGG - Intergenic
1197124251 X:122925313-122925335 GTGAGATTTGCACTGTGTTTTGG + Intergenic
1199706929 X:150435444-150435466 GTGGAGGTTGCAATGAGTTGAGG + Intronic
1200742078 Y:6864588-6864610 CTGTGGATTGCACTGTTCTGTGG + Intergenic
1201742337 Y:17337312-17337334 GATGGGGTTTCACTGTGTTGAGG + Intergenic