ID: 961314099

View in Genome Browser
Species Human (GRCh38)
Location 3:126022746-126022768
Sequence CTATAGACACAAAGGCTCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 89}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961314099 Original CRISPR CTATAGACACAAAGGCTCCG TGG (reversed) Intronic
900878730 1:5365314-5365336 CTATAGACAGAGCAGCTCCGAGG + Intergenic
903690080 1:25167274-25167296 CTATAGGCACCAAGGCCCTGAGG + Intergenic
903910108 1:26717892-26717914 CTATGAATACAAAGGCTCTGAGG + Intronic
905342744 1:37290404-37290426 CAAGAGACACAAAGGATCAGAGG - Intergenic
906328112 1:44861288-44861310 CTTTAGATACAGAGGCTCCTGGG + Intronic
913183584 1:116345989-116346011 CTACATATACAAAGGCACCGGGG + Intergenic
914709364 1:150198549-150198571 CTCTAGACTCCAAGGCTCAGTGG - Intergenic
915308267 1:154993501-154993523 CTACAGAGACAAAGGATCCAGGG - Intergenic
922454368 1:225762956-225762978 GTATAGAATCAAAGGCCCCGAGG - Intergenic
924393022 1:243584170-243584192 GTATAGACACATAGCCTCTGAGG - Intronic
1074682539 10:115922854-115922876 CTATAGAAACAAAGACCCAGTGG + Intronic
1075611011 10:123854654-123854676 GAGTAGACACACAGGCTCCGGGG - Intronic
1078021146 11:7656840-7656862 CCACAGAAGCAAAGGCTCCGGGG - Intronic
1078487722 11:11739634-11739656 CTGTATATACAAAGACTCCGAGG + Intergenic
1082186860 11:49193197-49193219 CTATAGAAAGAAAAGCTCAGAGG + Intronic
1083058828 11:59848566-59848588 CTATAGATAAAAAGGCTAAGGGG - Intergenic
1084439612 11:69165115-69165137 CTCTGGACACCAAGGCTCCGGGG + Intergenic
1086679477 11:89652177-89652199 CTATAGAAAGAAAAGCTCAGAGG - Intergenic
1090200546 11:124852117-124852139 TTATAGACACAAAGGGGCTGAGG - Intergenic
1091075035 11:132607396-132607418 CTTCAGAGACAAAAGCTCCGTGG - Intronic
1091877213 12:3945321-3945343 CTAAAGAAACCAAGGCTCAGAGG + Intergenic
1096118760 12:49072464-49072486 CTATAGGCATAAAGGCTGAGGGG - Intergenic
1101134409 12:101726077-101726099 TTATAGACACTGAGGCTCAGAGG - Intronic
1101831319 12:108259102-108259124 CTATGGACACAAAGTTTCTGAGG + Intergenic
1102592455 12:113966990-113967012 AAGTAGACACAAAGGCTCAGAGG - Intergenic
1107101587 13:36598897-36598919 TTACAGACACAAAGACCCCGAGG - Intergenic
1111990946 13:95116802-95116824 CTATACACACATAGCCTACGTGG + Intronic
1117653344 14:57928894-57928916 CAATAACCACAAAAGCTCCGTGG + Intronic
1121629405 14:95411660-95411682 CTATGGACACAGAGGCTTCCTGG + Intronic
1127290150 15:57562751-57562773 CTATAGTCAAAAAGGCTCTTAGG + Intergenic
1127614141 15:60666713-60666735 CTACAGATACAAAGGCACCGAGG + Intronic
1130264253 15:82384901-82384923 CTATATACAGAAAAGCTCCTTGG - Intergenic
1130469127 15:84210095-84210117 CTACATACACAAAAGCTCCTTGG + Intergenic
1130474512 15:84252147-84252169 CTATATACAGAAAAGCTCCTTGG - Intergenic
1130476617 15:84324651-84324673 CTACATACACAAAAGCTCCTTGG + Intergenic
1130481927 15:84366195-84366217 CTATATACAGAAAAGCTCCTTGG - Intergenic
1130495148 15:84463479-84463501 CTACATACACAAAAGCTCCTTGG - Intergenic
1130508109 15:84565864-84565886 CTACATACACAAAAGCTCCTTGG + Intergenic
1130591420 15:85214706-85214728 CTACATACACAAAAGCTCCTTGG + Intergenic
1131705102 15:94985085-94985107 CTATAGACACCAAGGCTTGGTGG + Intergenic
1137019820 16:35414384-35414406 CTATAGAGACGCAGGCTCTGCGG - Intergenic
1137026866 16:35485877-35485899 CTATAGAGACGCAGGCTCAGTGG - Intergenic
1137033060 16:35543391-35543413 CTATAGAGACTCAGGCTCGGCGG - Intergenic
1138680128 16:58678262-58678284 CTGTAGACCCAAGGGCTCCTGGG - Intronic
1143795186 17:9330439-9330461 GTCTACACACAAAGCCTCCGAGG + Intronic
1145972800 17:28966704-28966726 CTATTCACACAAAGGCACCCAGG - Intronic
1146613154 17:34326321-34326343 CTATAGAAACAAGAGCTCCTGGG + Intergenic
1150946922 17:69757531-69757553 CTATAGAAACAGAGGCTTTGGGG + Intergenic
1165146293 19:33732935-33732957 CTCTAGACACTGAGGCTCAGAGG - Intronic
1168410407 19:56136337-56136359 GTATGGGCACAAAGGATCCGAGG - Intronic
932740920 2:74290704-74290726 CTAGAGAGAGAAAGGCTCAGTGG + Intronic
935749251 2:106215873-106215895 CTCTAGACACTGAGGCTCAGGGG + Intergenic
939857765 2:147381190-147381212 CAATAGACACTGAGGCTCCATGG + Intergenic
941672730 2:168311720-168311742 CTATTTATACAAAAGCTCCGGGG + Intergenic
945457607 2:210067327-210067349 ATATACACACAAAGGCTCTCCGG - Intronic
946349858 2:219143032-219143054 CTATAGACAATAAGGCACAGGGG - Intronic
1169354189 20:4893954-4893976 CTAGAGACACCAAGGGTCAGGGG + Intronic
1174430899 20:50468120-50468142 CTATAGAGGTAAATGCTCCGTGG + Intergenic
1183110116 22:35642623-35642645 GTACAGACACAAAGCCTCTGGGG + Intergenic
1184686668 22:46099411-46099433 GTGCAGACACAAAGGCCCCGGGG - Intronic
961314099 3:126022746-126022768 CTATAGACACAAAGGCTCCGTGG - Intronic
961696960 3:128712038-128712060 CTAGAGGCACAAAGGCCCCAAGG + Intergenic
965977238 3:174640668-174640690 CTAAAGGCAAAAAGGCCCCGAGG - Intronic
966965342 3:184986230-184986252 CTATATACACAAAGACTTTGAGG + Intronic
968273786 3:197424574-197424596 CTAGAGACACAGAGGCCCGGGGG - Intergenic
968844492 4:3032522-3032544 GGATAGAAACAAAGGCTCAGGGG + Intronic
970366457 4:15363612-15363634 CACTAGCCACAAAGGCTCCCAGG + Intronic
980531169 4:134057232-134057254 CTATAAACAAAAAGGCTCAGAGG - Intergenic
981061197 4:140427280-140427302 CTGAAGACACAAAGGGTCCCAGG + Intronic
997500025 5:134366680-134366702 CCAAAGACAAAAAGGCTCAGTGG - Intronic
997775301 5:136599046-136599068 CTCTAGACAACAAGGCTCAGTGG - Intergenic
1000317451 5:160106310-160106332 AGATAGACACCAAGGCTCAGAGG - Intronic
1001055283 5:168444471-168444493 CTATAGAGACAAAGGTTGCTGGG - Intronic
1004426812 6:15512288-15512310 CTTTGGACACAAAGGATCCCGGG - Exonic
1007032503 6:38640673-38640695 CTGTAGTCACAAATGCTCGGGGG + Intergenic
1007337771 6:41166981-41167003 CTAGGAACACAAAGGCTCCATGG - Intergenic
1012429160 6:99146138-99146160 CTATACACACACAGGCTCATAGG - Intergenic
1024333152 7:48176898-48176920 ATATACACACAAAAGCTCTGAGG - Intronic
1024663403 7:51521060-51521082 CCAGAGATACAAAGGCTCCAAGG - Intergenic
1028625557 7:92872925-92872947 CTCTTGGCACAAAGGCTCCCAGG + Intergenic
1029136886 7:98379375-98379397 CTACAGACACAAAGGCCCCGTGG + Intronic
1032260950 7:130336699-130336721 TTATAGAAACAAAGGCACGGTGG + Intergenic
1035360943 7:158314013-158314035 CTAGTGCCACAAGGGCTCCGGGG - Intronic
1039406184 8:37314729-37314751 TTAGAGACACAAAAGCTCAGAGG + Intergenic
1042100614 8:65271795-65271817 ATGTGGACACAAAGGCTCTGGGG - Intergenic
1047798897 8:128288353-128288375 CTACAGGCACAAAGGCCTCGGGG + Intergenic
1062388541 9:136324887-136324909 CTGCAGACACGATGGCTCCGTGG - Intergenic
1186514546 X:10156825-10156847 CTCTGGACACGAATGCTCCGGGG + Intergenic
1186555478 X:10553844-10553866 CTTTTGACACACAGGCTCCCTGG - Intronic
1189230574 X:39449579-39449601 CTAAAGACACAGAGGTTCAGTGG - Intergenic
1193868958 X:86773263-86773285 CTAAAGACACAAATGCTTAGGGG + Intronic
1194620705 X:96167631-96167653 CTATTGACAGAAAGGTTCAGAGG + Intergenic
1195700814 X:107704312-107704334 CCAGACACACAAAGGCTCTGAGG + Intergenic
1202376479 Y:24242720-24242742 CTATATACAGAAAAGCTCCTTGG + Intergenic
1202494301 Y:25427399-25427421 CTATATACAGAAAAGCTCCTTGG - Intergenic