ID: 961314522

View in Genome Browser
Species Human (GRCh38)
Location 3:126025572-126025594
Sequence AGGTGAGGAGGTGGCGCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 489
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 439}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961314512_961314522 8 Left 961314512 3:126025541-126025563 CCTAACCCACATGTTGAAATCCT 0: 1
1: 3
2: 71
3: 1089
4: 13547
Right 961314522 3:126025572-126025594 AGGTGAGGAGGTGGCGCCTTTGG 0: 1
1: 0
2: 2
3: 47
4: 439
961314514_961314522 2 Left 961314514 3:126025547-126025569 CCACATGTTGAAATCCTCACCCA 0: 1
1: 2
2: 9
3: 56
4: 341
Right 961314522 3:126025572-126025594 AGGTGAGGAGGTGGCGCCTTTGG 0: 1
1: 0
2: 2
3: 47
4: 439
961314509_961314522 11 Left 961314509 3:126025538-126025560 CCCCCTAACCCACATGTTGAAAT 0: 1
1: 0
2: 13
3: 159
4: 1550
Right 961314522 3:126025572-126025594 AGGTGAGGAGGTGGCGCCTTTGG 0: 1
1: 0
2: 2
3: 47
4: 439
961314513_961314522 3 Left 961314513 3:126025546-126025568 CCCACATGTTGAAATCCTCACCC 0: 1
1: 0
2: 10
3: 169
4: 4631
Right 961314522 3:126025572-126025594 AGGTGAGGAGGTGGCGCCTTTGG 0: 1
1: 0
2: 2
3: 47
4: 439
961314511_961314522 9 Left 961314511 3:126025540-126025562 CCCTAACCCACATGTTGAAATCC 0: 1
1: 1
2: 11
3: 181
4: 1454
Right 961314522 3:126025572-126025594 AGGTGAGGAGGTGGCGCCTTTGG 0: 1
1: 0
2: 2
3: 47
4: 439
961314510_961314522 10 Left 961314510 3:126025539-126025561 CCCCTAACCCACATGTTGAAATC 0: 1
1: 0
2: 11
3: 130
4: 1068
Right 961314522 3:126025572-126025594 AGGTGAGGAGGTGGCGCCTTTGG 0: 1
1: 0
2: 2
3: 47
4: 439

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961314522 Original CRISPR AGGTGAGGAGGTGGCGCCTT TGG Intronic