ID: 961316025

View in Genome Browser
Species Human (GRCh38)
Location 3:126036287-126036309
Sequence CTTGTTGATGCCATCCTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 116}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961316025_961316032 14 Left 961316025 3:126036287-126036309 CCTGTAAGGATGGCATCAACAAG 0: 1
1: 0
2: 0
3: 19
4: 116
Right 961316032 3:126036324-126036346 CTTGCCCTTTCACTTCTGGTTGG 0: 1
1: 0
2: 8
3: 46
4: 268
961316025_961316035 20 Left 961316025 3:126036287-126036309 CCTGTAAGGATGGCATCAACAAG 0: 1
1: 0
2: 0
3: 19
4: 116
Right 961316035 3:126036330-126036352 CTTTCACTTCTGGTTGGTTCTGG 0: 1
1: 0
2: 2
3: 14
4: 183
961316025_961316037 28 Left 961316025 3:126036287-126036309 CCTGTAAGGATGGCATCAACAAG 0: 1
1: 0
2: 0
3: 19
4: 116
Right 961316037 3:126036338-126036360 TCTGGTTGGTTCTGGCCAATGGG 0: 1
1: 0
2: 12
3: 74
4: 296
961316025_961316038 29 Left 961316025 3:126036287-126036309 CCTGTAAGGATGGCATCAACAAG 0: 1
1: 0
2: 0
3: 19
4: 116
Right 961316038 3:126036339-126036361 CTGGTTGGTTCTGGCCAATGGGG 0: 1
1: 0
2: 8
3: 38
4: 194
961316025_961316028 10 Left 961316025 3:126036287-126036309 CCTGTAAGGATGGCATCAACAAG 0: 1
1: 0
2: 0
3: 19
4: 116
Right 961316028 3:126036320-126036342 CCCCCTTGCCCTTTCACTTCTGG 0: 1
1: 0
2: 1
3: 19
4: 231
961316025_961316036 27 Left 961316025 3:126036287-126036309 CCTGTAAGGATGGCATCAACAAG 0: 1
1: 0
2: 0
3: 19
4: 116
Right 961316036 3:126036337-126036359 TTCTGGTTGGTTCTGGCCAATGG 0: 1
1: 1
2: 16
3: 83
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961316025 Original CRISPR CTTGTTGATGCCATCCTTAC AGG (reversed) Intronic
901781540 1:11597905-11597927 CTTGTTGCTGCCAACATTGCAGG + Intergenic
911455231 1:98113989-98114011 CTTACTCATGCCATCCTCACTGG + Intergenic
912310971 1:108621054-108621076 CAAGTTTATGCCATCGTTACAGG + Intronic
913213710 1:116602631-116602653 CTTGGGGCTGCCATCTTTACTGG + Intronic
913253912 1:116937251-116937273 CTTATAGAGGCAATCCTTACAGG - Intronic
918334214 1:183491877-183491899 CTTGTTGCTGCCTTCTCTACAGG + Intronic
919589059 1:199476876-199476898 CTTGTTCATTGCATCCATACTGG + Intergenic
921094209 1:211873207-211873229 GTTTTTGATCCCATCCTGACTGG + Intergenic
921434910 1:215107526-215107548 TTTGATGATGCCATCCTAAGGGG + Intronic
922076275 1:222247967-222247989 CCTTTTGATGCCATCTGTACAGG - Intergenic
924536879 1:244942880-244942902 CTTTTTGGTGCCATCCTAAATGG - Intergenic
1064498255 10:15939090-15939112 CTGGTTGATGCCATCCTGGCTGG + Intergenic
1065021741 10:21507475-21507497 CTTGTCGATGGCTTCCGTACAGG - Intergenic
1071453601 10:85823776-85823798 CTTCTTGATTCCATCATTCCTGG - Intronic
1071543814 10:86512051-86512073 CTTGCTGATACTATCCTTTCAGG + Intronic
1073550556 10:104396807-104396829 GTGGTTGTTGCCATCCTTCCTGG + Intronic
1074306650 10:112285287-112285309 CTTCCTGATTCCATCCCTACAGG - Intronic
1077219366 11:1408580-1408602 CCTGTGGCTGCCATCCTGACAGG + Intronic
1077759465 11:5076443-5076465 CTCATTGTTGCCTTCCTTACTGG - Intergenic
1079077883 11:17395102-17395124 CTTCTGTCTGCCATCCTTACAGG + Intronic
1080140228 11:28909218-28909240 CATTTTGTTGCCATCTTTACAGG + Intergenic
1084853533 11:71964258-71964280 CTTTTTGATGCCATTGTTAATGG + Intronic
1088872680 11:113904800-113904822 CCAGTTGATGCTATCCTTACTGG - Exonic
1089441550 11:118522102-118522124 CTTGTTGCTGGCATCCTCAATGG - Exonic
1090517110 11:127440637-127440659 CTTGATGATTCCTTCCTTGCAGG + Intergenic
1091250471 11:134140054-134140076 CCTGCTGATGCCATGCTTCCAGG - Intronic
1093271029 12:17062166-17062188 CTTGTTAAGGATATCCTTACTGG - Intergenic
1093558543 12:20508911-20508933 CTTGGAGATGCCATTCTTACAGG + Intronic
1097615569 12:61880356-61880378 CTTGGTGTTGGCATCCTTAATGG - Intronic
1100853235 12:98735609-98735631 CTTCTTCATGCCAGCCATACCGG - Exonic
1102761483 12:115389560-115389582 TTTATTGATGCAATCCTTTCAGG + Intergenic
1103164957 12:118762585-118762607 CCTGTTGATACCATCCATACAGG + Intergenic
1109681039 13:65752898-65752920 CTTGCTAATGTCATCCTTCCTGG + Intergenic
1110037366 13:70705048-70705070 ATTTTTAAAGCCATCCTTACTGG + Intergenic
1110977137 13:81852959-81852981 CTTTTTGATGCCATCGTAAATGG - Intergenic
1121858733 14:97295953-97295975 ATTGATGAGCCCATCCTTACAGG - Intergenic
1202852005 14_GL000225v1_random:27110-27132 CTTGTCTATGCTATGCTTACAGG + Intergenic
1125074760 15:35601224-35601246 CATGTTGATGCTATCATAACTGG - Intergenic
1126853201 15:52811500-52811522 CTTATTTATCCCATCCTTAGGGG + Intergenic
1129165187 15:73773171-73773193 CTTGTCGATGGCATCCCTGCTGG - Intergenic
1130790268 15:87147386-87147408 CTTATAGTAGCCATCCTTACTGG - Intergenic
1131114564 15:89786150-89786172 CTTGTTGATGCTATCGTAAATGG - Intronic
1137537265 16:49336833-49336855 CTTGCTGCCGCCATCCTCACAGG + Intergenic
1138753836 16:59457817-59457839 CTTGATCATGCCCTCCTCACAGG - Intergenic
1142659932 17:1421344-1421366 ATTTTTGATGCCATACTTTCAGG + Exonic
1143264588 17:5626565-5626587 CTTGATGATCTCATCCTTCCTGG + Intergenic
1156097221 18:33549676-33549698 CTTTTTCATGCCTTCCTTCCTGG + Intergenic
1164976963 19:32580930-32580952 CTTGTTGATGCCACACTTTCAGG + Intergenic
1165609247 19:37135937-37135959 CCTGTTGAGGCCATTTTTACTGG - Intronic
928059171 2:28092808-28092830 CTTATTCTTGCCATCCTTACTGG + Intronic
930099938 2:47595735-47595757 GTAGTTGAAGCCATCCTCACAGG - Intergenic
930742726 2:54848680-54848702 GTTGATGAAGCCATCTTTACTGG + Intronic
931448696 2:62349397-62349419 TTTATTGAAGCCATCCTTACAGG + Intergenic
935059424 2:99594473-99594495 CTGGATGATGCTGTCCTTACCGG + Intronic
936859323 2:116997668-116997690 CTTGGTGCTTCCATCCTAACGGG - Intergenic
939028719 2:137044926-137044948 CTTGTTGAAGTCTTCCTTATGGG + Intronic
940646687 2:156399562-156399584 CCTGTTGGGGCCAGCCTTACAGG + Intergenic
940813217 2:158269240-158269262 TTTGGTCATGCCATCCTTTCAGG + Intronic
941382515 2:164812893-164812915 TTTGGTTATGCCATACTTACGGG - Intronic
942509411 2:176680868-176680890 CTTGTTTATGTAATCCTAACTGG + Intergenic
945827196 2:214736696-214736718 TTTTTTGATGCCATACTTACTGG - Intronic
947068273 2:226255533-226255555 GTTGTTGTTGCCATTCTAACTGG - Intergenic
947436527 2:230077584-230077606 CTTGGTGATGCCAACCTTCTTGG - Intergenic
1170530364 20:17285161-17285183 CTTCTTGAAGCCATCCTCACAGG - Intronic
1171171971 20:23023525-23023547 ATTGGTGAAGCCATCCTCACAGG + Intergenic
1173008118 20:39156688-39156710 CTTGGGCAAGCCATCCTTACAGG - Intergenic
1178389067 21:32183929-32183951 TCTGTTGATACCATCCTTAAAGG + Intergenic
1179491078 21:41741943-41741965 CTTGTGGATGCCATCGTGTCCGG - Exonic
950012740 3:9734526-9734548 CTTGTTGCTGCCATTCTCAGGGG - Exonic
950749045 3:15114338-15114360 CAGGTTGAAACCATCCTTACAGG + Intergenic
954407582 3:50354117-50354139 CTTGTTAATGCCATCAGCACAGG + Intronic
954701698 3:52453998-52454020 CTTGTAGATGTCATCCATGCTGG + Exonic
957431156 3:80109119-80109141 TTTGTTGATGCAATACTCACTGG + Intergenic
957581244 3:82076196-82076218 CATGTTGCTGCCATTCCTACCGG - Intergenic
958803668 3:98784133-98784155 GTTGTTGAGGCTATCCTTCCAGG - Intronic
961316025 3:126036287-126036309 CTTGTTGATGCCATCCTTACAGG - Intronic
961347582 3:126274141-126274163 CTTGTTGGTCCCTTCCCTACTGG + Intergenic
962012037 3:131401247-131401269 CTGTCTGATGCCATCCTCACTGG - Intergenic
962216311 3:133524976-133524998 CTTGTTCATCCCAACCTTGCAGG - Intergenic
963970985 3:151429318-151429340 CTTGTTGATGCCCTCCACACAGG + Intronic
965216415 3:165869844-165869866 TTTGATTATGCCATTCTTACAGG + Intergenic
966355041 3:179071333-179071355 CTTCGTGATGGCATCCATACCGG - Intronic
971033636 4:22668869-22668891 CTTGTTGAGGCATTCCCTACTGG + Intergenic
971810581 4:31420406-31420428 CTTTTTGATGCCATTCTAACAGG + Intergenic
972127937 4:35792536-35792558 CATCTTGATGGCAGCCTTACAGG - Intergenic
975057477 4:69952502-69952524 ATTGTTGATGCCTTCCTTATAGG - Intergenic
977181006 4:93874089-93874111 CTTGTCGATGCCAGGCTTTCTGG - Intergenic
977984973 4:103372531-103372553 CTTGAAGAAGCCATCCTCACAGG - Intergenic
979351178 4:119646116-119646138 CTTGTTGATGTAGTCCTTACAGG - Intergenic
980341882 4:131561249-131561271 CATGTTGGTGCCATCCATCCTGG - Intergenic
981239059 4:142452571-142452593 CTTGGTGTTCCCATCCTTAAAGG - Intronic
982283588 4:153711645-153711667 CAGGTTGATGCCAACCTTTCAGG + Intronic
987268858 5:16284354-16284376 ATTGTTGATGTCCTCCTTAAAGG + Intergenic
990034049 5:51298034-51298056 GTTGTTGATGACTTCCTTAATGG - Intergenic
994240767 5:97418172-97418194 CTTGATGATGTAAACCTTACTGG + Intergenic
995559018 5:113360957-113360979 CTTGTTGAGTCCATACATACTGG - Intronic
995718715 5:115106586-115106608 CTTTTTAATGCCATTCTTGCAGG - Intergenic
997230518 5:132239103-132239125 CCTGTTGATGCTATCCATATAGG - Intronic
1002329874 5:178434073-178434095 ATTGTTGATGCCATCCCAACTGG + Intronic
1004818250 6:19336058-19336080 CCTGCCGATGCAATCCTTACAGG - Intergenic
1005347380 6:24903974-24903996 CTTCTTGCTGCCTTCCTTACTGG + Intronic
1006020467 6:31114869-31114891 CTTCTAGATGCCATCCTCTCTGG - Exonic
1006914521 6:37585737-37585759 CTTGTGGATGACATCCTCCCTGG - Intergenic
1007029111 6:38611620-38611642 CTTGTTTATTGCATCCTTATGGG - Intronic
1008713346 6:54256451-54256473 CTTATTTCTGCCATCCTTCCCGG - Intronic
1012154580 6:95801918-95801940 CTTATTGATTCAATCCGTACAGG + Intergenic
1015551178 6:134413989-134414011 CTTGTTGAAGCCATTCATATGGG + Intergenic
1018175070 6:161171510-161171532 CTTGTTAATGCCATTATTTCAGG - Intronic
1018317262 6:162569310-162569332 CTTGGTGTTGGCATCCTTAATGG - Intronic
1019102638 6:169643717-169643739 GTTTTTGATGCCAGCCTGACTGG - Exonic
1024722317 7:52150849-52150871 CTTGTTGATGCATGTCTTACAGG - Intergenic
1028904178 7:96134677-96134699 CTTGTAGATGCCATTGTAACAGG - Intronic
1031292784 7:119958930-119958952 CTTTTTGAAGCCATCCTCACAGG - Intergenic
1034860473 7:154590897-154590919 CTTGTCGAGGCCATCATTATGGG - Intronic
1035819564 8:2577416-2577438 CTTGTGGATGGCTCCCTTACTGG + Intergenic
1037666524 8:20974500-20974522 CATGTTGTTGCCATCCTCATTGG - Intergenic
1038088033 8:24221731-24221753 CTTGTTAATGCCATTCTGACTGG - Intergenic
1038598752 8:28915729-28915751 CATATTGATGCCATACTTAGTGG + Intronic
1040436054 8:47392750-47392772 CCTTTTTATGCCATCCTTTCTGG + Intronic
1041176479 8:55202394-55202416 CTTGGTGAGGGCATCCTTTCAGG - Intronic
1045583696 8:103505940-103505962 CTTGTTTATGCCTTTTTTACTGG + Intronic
1046279651 8:112009205-112009227 CTTGTTGATGGCATCCCTCAAGG - Intergenic
1046906682 8:119581387-119581409 CTCTTTGATGCCATCCCTAGAGG - Intronic
1047577185 8:126169469-126169491 TTTATTGTTGCCATGCTTACAGG + Intergenic
1050313035 9:4372435-4372457 CATGTTGAAGACATGCTTACAGG - Intergenic
1050928885 9:11300147-11300169 GTTGTTGATGCCATCCAAGCTGG - Intergenic
1051810902 9:21048513-21048535 CTTGAGGATGCAATCCTCACAGG + Intergenic
1054976531 9:71153064-71153086 TTTGATGATGCCAACCTCACAGG - Intronic
1057989811 9:99756902-99756924 CATGTAGATGCCATCCTTGCAGG - Intergenic
1061692974 9:132349442-132349464 CTTCTTGATGTCATCTTTTCTGG - Intronic
1187439761 X:19307452-19307474 CCTGATGATGCCATCCATATGGG + Intergenic
1188699500 X:33240738-33240760 CTTCTTGATGTCATTCTAACAGG + Intronic
1189694634 X:43651969-43651991 CTTGGTGATGCAGTCCATACAGG - Intergenic
1190971474 X:55353149-55353171 CTTGTTGATGTCATCTCTATTGG + Intergenic
1192545506 X:72009393-72009415 CCTGTTGATGCCATCCACACAGG + Intergenic
1194556141 X:95362588-95362610 CTTGAAGATGCCATGGTTACTGG - Intergenic