ID: 961317757

View in Genome Browser
Species Human (GRCh38)
Location 3:126052206-126052228
Sequence CACACCTCACAGTCTCCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 203}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961317751_961317757 -2 Left 961317751 3:126052185-126052207 CCACCAGGCAGGGTGTCCTCCCA 0: 1
1: 0
2: 1
3: 23
4: 256
Right 961317757 3:126052206-126052228 CACACCTCACAGTCTCCTGGTGG 0: 1
1: 0
2: 3
3: 19
4: 203
961317746_961317757 29 Left 961317746 3:126052154-126052176 CCCTCTCTTAAAACTTGAGAAGA 0: 1
1: 0
2: 5
3: 37
4: 399
Right 961317757 3:126052206-126052228 CACACCTCACAGTCTCCTGGTGG 0: 1
1: 0
2: 3
3: 19
4: 203
961317747_961317757 28 Left 961317747 3:126052155-126052177 CCTCTCTTAAAACTTGAGAAGAA 0: 1
1: 0
2: 4
3: 26
4: 355
Right 961317757 3:126052206-126052228 CACACCTCACAGTCTCCTGGTGG 0: 1
1: 0
2: 3
3: 19
4: 203
961317752_961317757 -5 Left 961317752 3:126052188-126052210 CCAGGCAGGGTGTCCTCCCACAC 0: 1
1: 0
2: 2
3: 16
4: 219
Right 961317757 3:126052206-126052228 CACACCTCACAGTCTCCTGGTGG 0: 1
1: 0
2: 3
3: 19
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961317757 Original CRISPR CACACCTCACAGTCTCCTGG TGG Intronic
900495627 1:2974759-2974781 GACGCCTCACACTCACCTGGGGG + Intergenic
900638905 1:3678951-3678973 CCCACCCCACATGCTCCTGGTGG + Intronic
901167575 1:7230970-7230992 CACACCCTCCAGGCTCCTGGGGG - Intronic
902685295 1:18072743-18072765 CACACATCTCATTCTCCTGCTGG - Intergenic
903138968 1:21327164-21327186 CCCTCTTCCCAGTCTCCTGGTGG - Intronic
903481168 1:23654460-23654482 CAGAACTCACAGTCTGATGGGGG + Intergenic
903844747 1:26272270-26272292 CAGTCCCCACAGTATCCTGGGGG + Intronic
905098923 1:35501263-35501285 TAGATCTGACAGTCTCCTGGAGG - Intronic
905291599 1:36925479-36925501 CAAAGCTCACTCTCTCCTGGTGG - Intronic
905469471 1:38181004-38181026 GTCACCTCACTGTCACCTGGTGG + Intergenic
908724066 1:67156584-67156606 CAAACCTCCCAGTCTCCTTAGGG + Intronic
910238471 1:85060849-85060871 CACTCTTCGCACTCTCCTGGTGG - Intronic
910490193 1:87760570-87760592 GACACATCACAGTCTCTTAGAGG + Intergenic
910795243 1:91091307-91091329 CACACCTAACAGTCTTAGGGTGG + Intergenic
911063856 1:93770327-93770349 CTCTCTTCACTGTCTCCTGGTGG - Intronic
911292269 1:96071514-96071536 CCCTTCTCACACTCTCCTGGTGG + Intergenic
913385318 1:118252747-118252769 CACACACCACAGACTCCTGCAGG - Intergenic
915253006 1:154603808-154603830 CCCTCCTCAGACTCTCCTGGAGG + Intronic
916004277 1:160645581-160645603 CACACCTTACAGTCACCAAGAGG + Intronic
916192411 1:162192201-162192223 CACACATCAGAATCACCTGGAGG - Intronic
916250818 1:162736109-162736131 TACACAGCACAGTCACCTGGTGG + Intronic
916535416 1:165698751-165698773 TACCCCACACAGTCTCCAGGCGG + Exonic
918558087 1:185829418-185829440 CACACCCCACAGCCTGTTGGGGG - Intronic
920172328 1:204079839-204079861 CTCACCTCACAGCCTCTAGGAGG - Intronic
920248847 1:204608744-204608766 CACACATCAGAATCACCTGGAGG - Intergenic
923575025 1:235150745-235150767 CACAGCTTACAGTCTGGTGGAGG + Intronic
924386747 1:243506217-243506239 CTGGCCTCACAGTCTCCTGGGGG + Intronic
924633418 1:245763293-245763315 AAGCCCTCACACTCTCCTGGGGG + Intronic
1062784159 10:247475-247497 CCCACCTCGCAGTATCCAGGTGG + Intronic
1065094303 10:22265578-22265600 GTCACCTCACAGTCTCCATGTGG + Intergenic
1068729748 10:60343789-60343811 CATACATGACAGTCACCTGGAGG + Intronic
1069581221 10:69568423-69568445 CACACCTCACTGGCTCTAGGAGG + Intergenic
1072419561 10:95278433-95278455 AGAAGCTCACAGTCTCCTGGGGG + Intronic
1073027104 10:100496109-100496131 AGCACCTCACAATCTACTGGGGG - Intronic
1077551314 11:3201601-3201623 CTCTCCTCACAGCCTCCTGAGGG + Intergenic
1077633918 11:3829017-3829039 AACACTTTCCAGTCTCCTGGTGG - Intronic
1078826748 11:14937163-14937185 CACACAACTCAGTCTCCAGGGGG + Intronic
1081995289 11:47359807-47359829 CAGGCCTGGCAGTCTCCTGGGGG + Intronic
1084001967 11:66300757-66300779 CTCAGCTCACAATCTCCTGATGG + Intergenic
1084949981 11:72659464-72659486 CACACCTCACTCTCTCCTGTGGG - Intronic
1085270772 11:75268710-75268732 CACGCCTCACTGTCTCCTGGTGG + Intronic
1088829997 11:113528779-113528801 CAGCCCTCAGAGTCACCTGGTGG + Intergenic
1089920238 11:122202842-122202864 CACAGCTCACAGGCCCCGGGTGG - Intergenic
1090084860 11:123641980-123642002 CAAACCTCAAAATCTCCTGCAGG - Intronic
1090208042 11:124896555-124896577 CAGAGCCCACAGTCTCATGGTGG - Exonic
1091388287 12:109047-109069 CCCACCTCAAAGCATCCTGGCGG + Intronic
1096926226 12:55150478-55150500 CATACCTCAGAATCACCTGGAGG - Intergenic
1100717839 12:97324598-97324620 GACACGTCATAGCCTCCTGGGGG + Intergenic
1101364068 12:104055205-104055227 CCAGCCTCACAGTCTCCTGTTGG + Intronic
1101571420 12:105957305-105957327 TACACCTGGCAGTGTCCTGGGGG - Intergenic
1103150626 12:118635576-118635598 CAAAGCTCAGAGTCTACTGGGGG + Intergenic
1104873076 12:132014615-132014637 CACACCTCACTCTCTGCTGGGGG + Intronic
1106766215 13:32916503-32916525 GACACAGGACAGTCTCCTGGCGG - Intergenic
1107860866 13:44660002-44660024 CTCACCTCACATGGTCCTGGTGG + Intergenic
1109304458 13:60623306-60623328 CACACCTCCTCCTCTCCTGGAGG - Intergenic
1113011576 13:105773496-105773518 CCCAGCACACAGTCTCCTTGTGG + Intergenic
1117334381 14:54744392-54744414 CACACCGCACAGCCTCCCTGTGG + Intronic
1117336934 14:54763974-54763996 CACACCTCCCCGTCTCCAGGAGG + Intronic
1120921623 14:89760857-89760879 CACTGCTCACATTCTCCTGGGGG - Intergenic
1121048419 14:90804438-90804460 CACTCCTCTCAGCGTCCTGGGGG - Intronic
1121369675 14:93345843-93345865 CATATCTAACAGTATCCTGGAGG + Intronic
1121467711 14:94126720-94126742 CTGACATCATAGTCTCCTGGGGG + Intergenic
1123837974 15:24215154-24215176 CTCACCTCACTGTCCCCTGTGGG - Intergenic
1123847514 15:24317450-24317472 CTCACCTCACTGTCCCCTGTGGG - Intergenic
1123866559 15:24524831-24524853 CTCACCTCACTGTCCCCTGTGGG - Intergenic
1125602378 15:40922796-40922818 CACACCTCACTCTCTCCCGCTGG - Intergenic
1128355424 15:66923181-66923203 CACACCTCATGGTCACATGGTGG + Intergenic
1128470269 15:67945973-67945995 AGCACCTCACAGTCTTGTGGTGG + Intergenic
1128929899 15:71694919-71694941 CACACCTCTCCATCTCCTGTGGG - Intronic
1129336484 15:74854901-74854923 CACACCACACAGGCTCCTGTTGG + Intronic
1130995059 15:88899009-88899031 CACACATCACATTCCCATGGTGG - Exonic
1132514327 16:359281-359303 CACACCTCCCAGTGTCCTGAGGG + Intergenic
1132999042 16:2840045-2840067 CACACCTCAGGGTCTCCAGAGGG - Intergenic
1133237766 16:4395533-4395555 CACTCCTCACAGAAACCTGGGGG - Intronic
1134069750 16:11253741-11253763 CAGACCACACAGTCTCCTTCTGG + Intronic
1134136759 16:11681631-11681653 GACACATCAGAGTCTCTTGGTGG + Intronic
1136133538 16:28240102-28240124 GTCACATCACAGTTTCCTGGAGG + Intergenic
1136635054 16:31515671-31515693 CACACATCACAGTCTCCATTAGG + Intergenic
1142350754 16:89578457-89578479 AGCACCTAAAAGTCTCCTGGTGG + Intronic
1142888727 17:2929388-2929410 CGCCCATCACAGTCACCTGGCGG - Intronic
1144040709 17:11408421-11408443 CACACATCAGAATCACCTGGAGG - Intronic
1147390494 17:40106432-40106454 CCCACATCACAGGATCCTGGAGG + Intergenic
1147727320 17:42574311-42574333 CACACCCCAAAGTCTCCAGAGGG + Intronic
1148071789 17:44912786-44912808 GACACCTCTCTGTGTCCTGGGGG + Intronic
1149534763 17:57424562-57424584 CACACCACACAGACTCCAGGAGG - Intronic
1150506596 17:65704726-65704748 CACACCTCACATTCACATGACGG + Intronic
1150932764 17:69603148-69603170 TAAACCTCACAGTCTAGTGGGGG + Intergenic
1151518779 17:74613977-74613999 CACACCTCCCATCTTCCTGGTGG - Exonic
1153396800 18:4631423-4631445 AGCACCCCACAGCCTCCTGGTGG + Intergenic
1155554123 18:26998907-26998929 CGCACCTCACTGTCCCCTGAGGG - Intronic
1157241766 18:46016563-46016585 CAGACCTCAGAGTCTAATGGAGG + Intronic
1159064674 18:63556843-63556865 CACTTCTCCCAGTCTCCTTGAGG + Intronic
1161312428 19:3602350-3602372 CACACCCCCAAGTCACCTGGAGG + Intronic
1161594143 19:5142618-5142640 CCCACCTGACAGTGTCCAGGTGG + Intronic
1163115241 19:15185119-15185141 CCCACCTCCCAAGCTCCTGGAGG + Intronic
1163250304 19:16122844-16122866 CCCACCTCACAGTTCTCTGGTGG + Intronic
1163310594 19:16512109-16512131 CACCACTCACCCTCTCCTGGGGG - Intronic
1163826388 19:19527087-19527109 CCCTCCTCTCAGGCTCCTGGTGG + Intronic
1164097788 19:22027250-22027272 CACAACACACAGTCTACAGGTGG - Intergenic
1164722395 19:30441900-30441922 CATGCCACGCAGTCTCCTGGCGG + Intronic
1166251849 19:41576780-41576802 CAGAGCTCACAATCTCATGGGGG + Intronic
1166518882 19:43465983-43466005 CAGAGCTCACAGTCTGATGGGGG + Intergenic
1167491465 19:49795113-49795135 CACAGCGCACCGGCTCCTGGAGG - Intronic
1168233348 19:55046982-55047004 CTCACCTCACAGTCACTGGGGGG - Intronic
1168416387 19:56171817-56171839 CACATCCCACAGTTTCCTTGTGG - Intergenic
925986331 2:9218152-9218174 CCCACCTGTCAGTCTCCTGCTGG + Intronic
926122384 2:10251232-10251254 CACACATCAGAATCACCTGGAGG + Intergenic
928425068 2:31171035-31171057 CAGAGCTCACAGTCTCCTGGAGG - Intergenic
929583777 2:43101136-43101158 CAGAGCTCCCAGTCTCCTCGCGG - Intergenic
930726309 2:54685360-54685382 GAAACGTGACAGTCTCCTGGTGG - Intergenic
931174277 2:59837221-59837243 CACACCTCCTAGTCTGCTGGAGG + Intergenic
934984497 2:98874523-98874545 CACCCCTCCCAGTGTCCAGGAGG + Intronic
936150990 2:110022432-110022454 CAGACCTGACACTCGCCTGGTGG + Intergenic
936193686 2:110348937-110348959 CAGACCTGACACTCGCCTGGTGG - Intergenic
936492270 2:112982527-112982549 ACCACCTCAAAGTCTCCTGAAGG - Intronic
940058659 2:149540497-149540519 CACACCTCTCAGTCTCCCAGAGG - Intergenic
940392240 2:153145956-153145978 TACACCTCACATTCTCCTCTGGG - Intergenic
940932834 2:159455537-159455559 CTTACCTCACAGTATCCTTGTGG - Intronic
941491462 2:166147027-166147049 CATGCCTCACAGTCACCTGGAGG + Intergenic
941788437 2:169523850-169523872 CACACATCTAAGTCACCTGGAGG - Intronic
942047177 2:172106530-172106552 TACTCCTCACAGTCTCGTCGAGG + Intergenic
942801689 2:179883266-179883288 CACACCTCACAGACTCTTTAGGG - Intergenic
946168152 2:217877901-217877923 CCCTCCTCCAAGTCTCCTGGTGG + Intronic
946402886 2:219477768-219477790 CACACCTGCCGATCTCCTGGTGG - Exonic
948899697 2:240950020-240950042 CACAGGTCACAGGCTTCTGGAGG + Intronic
1168763216 20:363783-363805 CACAACTCTGAGGCTCCTGGTGG - Intronic
1169428465 20:5514203-5514225 TAGGCCTCACAGTCCCCTGGTGG - Intergenic
1169786117 20:9360879-9360901 CACACCTAACAGTTTTCTGAGGG - Intronic
1172426511 20:34859751-34859773 CGCACTTAACAGGCTCCTGGGGG - Intronic
1172666946 20:36606663-36606685 CACACCTCACACTCACCCAGCGG - Intronic
1173758137 20:45536140-45536162 AAAACCTCACATTCTCATGGAGG - Intronic
1173922927 20:46759352-46759374 CACCCCTCACCCTGTCCTGGGGG - Intergenic
1174421052 20:50399414-50399436 CTCCCAGCACAGTCTCCTGGGGG + Intergenic
1175404115 20:58716066-58716088 CACACAGCACAGACTCCAGGTGG + Intronic
1182867299 22:33614783-33614805 CACAGCTGACAGTCTCATGGAGG - Intronic
1183270967 22:36862415-36862437 CTCCCCTCACATGCTCCTGGGGG + Intronic
1184118929 22:42437968-42437990 AACGCCGCACAGTCTCCTCGGGG + Intergenic
1184531343 22:45057699-45057721 GACATCTCACAGTCACCCGGTGG + Intergenic
1184851351 22:47123088-47123110 AACACCCCTCAGCCTCCTGGAGG - Intronic
1185147493 22:49147214-49147236 CACACATCACCTTCCCCTGGAGG - Intergenic
952118299 3:30211255-30211277 AACCCCTCACTTTCTCCTGGAGG - Intergenic
953735327 3:45489392-45489414 CACACATCAGAGTCCCCTGGTGG + Intronic
954138302 3:48592408-48592430 CACAGCCCACAGCCTCCTGGTGG - Exonic
954412041 3:50374999-50375021 CACTTCTCAAACTCTCCTGGGGG + Intronic
956451705 3:69381388-69381410 AATACCTGTCAGTCTCCTGGGGG - Intronic
961317757 3:126052206-126052228 CACACCTCACAGTCTCCTGGTGG + Intronic
968631245 4:1653266-1653288 CACACCTCACACTCTACCGGGGG + Intronic
968813667 4:2811077-2811099 GACACCCCACTGTCTCCTAGAGG - Intronic
968966347 4:3770865-3770887 CAGACCTCACAGCCCCCAGGGGG - Intergenic
972923293 4:43970359-43970381 CTCAGCTCACCCTCTCCTGGAGG + Intergenic
972957978 4:44415890-44415912 TCCACCTGACAGTCCCCTGGTGG - Intronic
976064154 4:81164620-81164642 CACACCTAACACTCTAATGGTGG - Intronic
978316361 4:107441706-107441728 CACACCTCACGTTCTCCAAGAGG + Intergenic
981304619 4:143233489-143233511 GACACCTCAGAGTCTGCTGCAGG + Intergenic
982553814 4:156835938-156835960 CTCTCCTCAGAGTCTCCTGTGGG + Intronic
983051635 4:163054794-163054816 CACACATCAGAGCCTGCTGGAGG - Intergenic
984592470 4:181632031-181632053 CACACCTCACACTCAGCTAGTGG - Intergenic
985761344 5:1750789-1750811 CTCACCTCATTGTCTCCTGCAGG + Intergenic
985958670 5:3283313-3283335 CTCACCTCACAGCACCCTGGGGG - Intergenic
987516022 5:18909386-18909408 CACAAATCACAGTTTCCAGGAGG + Intergenic
990795849 5:59539984-59540006 CATACATCAGAGTGTCCTGGAGG + Intronic
997676048 5:135714128-135714150 CACACCTCACCAGCTCCAGGTGG - Intergenic
999124329 5:149235861-149235883 AATACCTCACTGTCTCCTGTGGG - Intronic
1001357879 5:171048641-171048663 CAGACAGCACAGTCTACTGGAGG - Intronic
1001580026 5:172791932-172791954 GTGACCTCACGGTCTCCTGGTGG - Intergenic
1001747045 5:174099928-174099950 GAGACCTCACAGTCTACAGGGGG - Intronic
1003968969 6:11280315-11280337 CACACCTCACAGCCAAGTGGTGG - Intronic
1004126747 6:12881638-12881660 TGCAGCTCACACTCTCCTGGGGG - Intronic
1007341270 6:41192768-41192790 CCCACCTCCCAGCCTCCTGAGGG - Intronic
1007575712 6:42924254-42924276 CACCCCTGAGAGGCTCCTGGGGG - Exonic
1007626938 6:43251973-43251995 CAGACCTCCCAGTCTCAGGGCGG - Intronic
1008682717 6:53891166-53891188 CACACCTAACAAGCTCCTGCAGG - Intronic
1010003474 6:70971262-70971284 CACACATCAGAATCACCTGGAGG + Intergenic
1011241757 6:85279008-85279030 CACTCCTCTCAGTGTCCTAGAGG + Intergenic
1015614110 6:135056965-135056987 CACACCTTACAGAGTCCTGAGGG - Intronic
1015770429 6:136762801-136762823 TCCTCCTCCCAGTCTCCTGGAGG + Intronic
1017460687 6:154646743-154646765 CACACCTTCTAGTCACCTGGGGG + Intergenic
1018615590 6:165683671-165683693 TACAAGCCACAGTCTCCTGGAGG + Intronic
1019548077 7:1587979-1588001 CACACCTCACAGCCACCTGATGG + Intergenic
1019607150 7:1915756-1915778 CACATCTCACTGTCTCCGTGTGG - Intronic
1019938265 7:4270303-4270325 CCTACCTCACAGGGTCCTGGTGG - Intergenic
1020082179 7:5291983-5292005 CACACTACACAGGCTCCTGTGGG - Intronic
1020467441 7:8496699-8496721 CATGCCTCACAGTCACCTGAAGG - Intronic
1020953983 7:14716319-14716341 CACACATCAGAGTCACCTGCAGG - Intronic
1021587098 7:22221121-22221143 CCCACATCACAGACTCCTAGAGG + Intronic
1021877301 7:25060641-25060663 CACACAGCGCAGCCTCCTGGGGG - Intergenic
1022733316 7:33052781-33052803 CACACATCACAATCACCTGCAGG + Intronic
1022813546 7:33892461-33892483 TCCACCTCTCAGTCTCCTTGAGG + Intergenic
1024389389 7:48790068-48790090 AACACCTCACTGTCTCCTAGAGG + Intergenic
1026275095 7:68869747-68869769 TACAGTTTACAGTCTCCTGGCGG - Intergenic
1026666296 7:72342601-72342623 GACTCCTCACTGTTTCCTGGAGG - Intronic
1027139906 7:75649655-75649677 TACACATCACAGCCTCCTGGGGG - Intronic
1027351459 7:77315906-77315928 TACACCTTGCAGTCTGCTGGGGG + Intronic
1029261940 7:99308691-99308713 CACACATCTGAGTCACCTGGAGG - Intergenic
1033645334 7:143298069-143298091 AACATATCACAGTGTCCTGGAGG + Intronic
1034528051 7:151678518-151678540 CACACTGCTCAGTCTCCTGAAGG - Intronic
1037112743 8:15184619-15184641 CTCACCTCTCAGTTTCCTGCTGG - Intronic
1037701909 8:21283120-21283142 CATGGGTCACAGTCTCCTGGTGG - Intergenic
1038346121 8:26734056-26734078 CACACCTCACAGGCCACTGAGGG - Intergenic
1039691031 8:39864929-39864951 CACACTTCACAGTTGCCTTGAGG + Intergenic
1040517324 8:48145503-48145525 CAGACCTCCCAAGCTCCTGGAGG + Intergenic
1044398098 8:91737439-91737461 AATATCTCACAGTCTCATGGGGG + Intergenic
1045024646 8:98075196-98075218 CAAACTTCAGAGTCTCCAGGAGG - Intronic
1045712815 8:105005354-105005376 CACTCATCCCATTCTCCTGGAGG - Intronic
1047104858 8:121720951-121720973 AAAACCTCACACTCTTCTGGAGG - Intergenic
1049916869 9:326437-326459 CATGCATCACAATCTCCTGGAGG + Intronic
1050745721 9:8873822-8873844 GACACCAAATAGTCTCCTGGAGG + Intronic
1051675332 9:19553018-19553040 GAAACTTCACAGCCTCCTGGGGG + Intronic
1053171303 9:35887284-35887306 GAAACCTCATACTCTCCTGGTGG - Intergenic
1053424858 9:38004072-38004094 CACAACTCCCAGGTTCCTGGAGG + Intronic
1054878900 9:70124478-70124500 CAAAGCTCACTTTCTCCTGGTGG - Intronic
1059849759 9:118324703-118324725 AACACCTCACTGCCTCATGGTGG - Intergenic
1060000043 9:119950295-119950317 CACATCTCAGCATCTCCTGGAGG - Intergenic
1060532262 9:124354835-124354857 CACCCCTCAGTGTCTCCGGGAGG + Intronic
1060986825 9:127824887-127824909 CACACCTCAAGGCCTCCTGGGGG - Exonic
1061464112 9:130764179-130764201 CACACATCACTGTGTCCTTGAGG + Intronic
1061588944 9:131585718-131585740 CACATCAGACATTCTCCTGGAGG + Intronic
1062438288 9:136556817-136556839 CACAGCCCACAGCCTCCTGACGG + Intergenic
1062552952 9:137098505-137098527 CCCACCTCAGAGACACCTGGGGG - Intronic
1186734332 X:12445283-12445305 CACACATTACAATCACCTGGAGG - Intronic
1187716266 X:22105353-22105375 CACGCCTCAGAATCCCCTGGAGG + Intronic
1191256589 X:58282167-58282189 CACATGTCTCCGTCTCCTGGGGG + Intergenic
1192578695 X:72263111-72263133 TGCACCTCACAGTCTCCTGGGGG + Intronic
1192759813 X:74085642-74085664 GACAGCACACAGTCTCTTGGGGG - Intergenic
1192829572 X:74737158-74737180 CAGACCTCAGAGTCACCTGCTGG - Exonic
1200848021 Y:7851482-7851504 CAGACCACACAGTCTCCAGCAGG + Intergenic