ID: 961317765

View in Genome Browser
Species Human (GRCh38)
Location 3:126052264-126052286
Sequence ACCCTATGTGGAGGGTGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 168}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961317765_961317771 -3 Left 961317765 3:126052264-126052286 CCTGCACACCCTCCACATAGGGT 0: 1
1: 0
2: 2
3: 29
4: 168
Right 961317771 3:126052284-126052306 GGTGGGCCTCCGTCCTCAGCAGG 0: 1
1: 0
2: 0
3: 11
4: 162
961317765_961317772 -2 Left 961317765 3:126052264-126052286 CCTGCACACCCTCCACATAGGGT 0: 1
1: 0
2: 2
3: 29
4: 168
Right 961317772 3:126052285-126052307 GTGGGCCTCCGTCCTCAGCAGGG 0: 1
1: 0
2: 0
3: 13
4: 235
961317765_961317776 7 Left 961317765 3:126052264-126052286 CCTGCACACCCTCCACATAGGGT 0: 1
1: 0
2: 2
3: 29
4: 168
Right 961317776 3:126052294-126052316 CGTCCTCAGCAGGGGAACCAAGG 0: 1
1: 0
2: 0
3: 7
4: 127
961317765_961317773 -1 Left 961317765 3:126052264-126052286 CCTGCACACCCTCCACATAGGGT 0: 1
1: 0
2: 2
3: 29
4: 168
Right 961317773 3:126052286-126052308 TGGGCCTCCGTCCTCAGCAGGGG 0: 1
1: 0
2: 4
3: 20
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961317765 Original CRISPR ACCCTATGTGGAGGGTGTGC AGG (reversed) Intronic
901020828 1:6254564-6254586 ACCGCATGTGGATGGTCTGCTGG - Exonic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
903650458 1:24918717-24918739 ACCCTATGAGCAGGGAGTTCTGG - Intronic
904863466 1:33558003-33558025 ACCCTGTCGGGAGGGTGAGCTGG + Intronic
910625565 1:89303033-89303055 AGCAGCTGTGGAGGGTGTGCTGG - Intergenic
910636091 1:89409629-89409651 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
912798354 1:112706237-112706259 TCCCTAGGTGTAGGGTGGGCCGG - Exonic
913084750 1:115426395-115426417 ACCCAATGTGCAGGGACTGCTGG + Intergenic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
915865547 1:159494822-159494844 AGCGGATGTGGAGGGTGTACTGG - Intergenic
916527883 1:165628825-165628847 TCCCTATGTGGAGGGAGTGCTGG + Intergenic
918078865 1:181190609-181190631 ACCCTATGAGGAGGGAGGGGAGG - Intergenic
920723927 1:208415998-208416020 ACCCTATGTGAAGGCTATGGAGG - Intergenic
924382827 1:243480210-243480232 ACTCTATGAGAAGGCTGTGCAGG + Intronic
924679985 1:246221318-246221340 ATGCAATGTGGAGGGTGAGCAGG - Intronic
1067342530 10:45417425-45417447 ACCATATGTGGGGGGTGGGGAGG - Intronic
1072360322 10:94653038-94653060 AGCCTATGTGGGGGTTCTGCAGG - Intergenic
1073961005 10:108928299-108928321 ACCCTATGTGGAGCAACTGCAGG - Intergenic
1074098138 10:110331604-110331626 AGCAGCTGTGGAGGGTGTGCCGG + Intergenic
1079764168 11:24369893-24369915 AACATATGTGCAGGATGTGCGGG + Intergenic
1079816964 11:25073398-25073420 TCCCTGTGTGGAGGAAGTGCTGG + Intronic
1080749716 11:35140589-35140611 ACCCTAGGTGGAGGCTAGGCAGG + Intronic
1080964342 11:37196561-37196583 ACCCTTTGTGGAGGCAGTGAGGG - Intergenic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1081115325 11:39192765-39192787 AGCGGCTGTGGAGGGTGTGCTGG - Intergenic
1082793517 11:57363862-57363884 ACCCTCTGAGGAGGGTTGGCAGG - Intronic
1082912321 11:58390785-58390807 AGCAGCTGTGGAGGGTGTGCTGG - Intergenic
1082960885 11:58917796-58917818 TCCCTTTGTGGAGGGAATGCTGG + Intronic
1083859565 11:65412578-65412600 ACCCTCCGAGGTGGGTGTGCGGG + Exonic
1084661762 11:70550311-70550333 TCCCTACCTGGAGGGTGGGCAGG + Intronic
1087032212 11:93717008-93717030 TCCCTATGTTGAAGGAGTGCTGG + Intronic
1087871257 11:103295458-103295480 TCCCTAAGTTGAGGGAGTGCTGG - Intronic
1092960877 12:13595921-13595943 ACCCTATGTGGTGTATGTGCTGG + Intronic
1094070960 12:26412418-26412440 ATCCTGAGTTGAGGGTGTGCGGG + Intronic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1098405580 12:70122983-70123005 TCCCTCTGTGGATGGGGTGCTGG - Intergenic
1102261551 12:111446286-111446308 GCCCTATGTGCCGGGTGTCCTGG + Intronic
1103380153 12:120487940-120487962 TCCCTATGTTGAGGGAGTACTGG + Intronic
1103760873 12:123249533-123249555 AGCAGCTGTGGAGGGTGTGCCGG - Intronic
1104470309 12:129024873-129024895 AGTCTATGTGGGGGGTGTGGAGG - Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1108337790 13:49463826-49463848 TCTCTATGTTGAGGGAGTGCTGG + Intronic
1109091513 13:58052201-58052223 ACCCTATGTGGAAGGTGCCAAGG - Intergenic
1109487402 13:63045043-63045065 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1113463471 13:110497553-110497575 GCCCTGAGTGGAGGTTGTGCTGG - Intronic
1113463479 13:110497596-110497618 GCCCTGAGTGGAGGTTGTGCTGG - Intronic
1116933710 14:50715931-50715953 ATCCTATTTGGAGGCTGTGTGGG + Intergenic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1121994706 14:98593101-98593123 AGCCCATGTGGAGTGTGTGGAGG - Intergenic
1122308891 14:100782502-100782524 GGCCTATTTGGAGGGTGGGCTGG + Intergenic
1122647539 14:103205378-103205400 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123218635 14:106836579-106836601 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123449826 15:20352579-20352601 GCCCACTGTGGAGGGTGTGCAGG + Intergenic
1127447883 15:59084145-59084167 ATCCTATGTGGATGGGGTGGGGG - Exonic
1127984781 15:64061030-64061052 AGCCGCTGCGGAGGGTGTGCTGG + Intronic
1128600568 15:68992161-68992183 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1129556211 15:76512548-76512570 TCCCATTGTGGAGGGTCTGCAGG - Intronic
1129981769 15:79878709-79878731 TCCCTATGTGGAGGGAGTGGTGG + Intronic
1130149976 15:81304033-81304055 ATCCTTTGTGTAGGCTGTGCTGG + Intronic
1132598859 16:765097-765119 AGCCTCTCTGCAGGGTGTGCGGG + Exonic
1141424318 16:83935490-83935512 CCGCTGTGTGGAGGGTGTGTTGG + Intronic
1141658650 16:85429783-85429805 AGGCCATGTGGAGGCTGTGCGGG - Intergenic
1143037111 17:4005611-4005633 TCCCTCTGTGCAGGGTCTGCAGG - Exonic
1143178668 17:4970852-4970874 AGCCTATGGGGAGCATGTGCTGG - Intronic
1144825676 17:18104466-18104488 GATCTATGTGGAGGGTGTGCTGG + Intronic
1144838941 17:18173855-18173877 CCCCTATGTGGAGATTGCGCTGG + Exonic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145361109 17:22213165-22213187 TCCCAATGTTGAGGGAGTGCTGG - Intergenic
1147610909 17:41801369-41801391 TCCCGGTGTGCAGGGTGTGCAGG - Intergenic
1147976341 17:44250284-44250306 ACCCTTTGTGGAAGGTCTCCTGG + Exonic
1148225315 17:45894947-45894969 ACCCCAGGTGGAGGCTGTGCCGG + Intronic
1148678173 17:49457161-49457183 ACTGGATGTGGAGGGTGTGGAGG - Intronic
1149556997 17:57580445-57580467 GGCCTAAGTGGAGGGTGTGGGGG - Intronic
1151183376 17:72345839-72345861 ACCCTAGGTGAAGGGTATACAGG - Intergenic
1151439902 17:74121641-74121663 GCCCTATGGAGAGGGTGTGTGGG - Intergenic
1151923513 17:77175701-77175723 TCCCTGTGTTGAGGGAGTGCTGG + Intronic
1152338815 17:79713311-79713333 GCCCACTGTGGAGGGTGTGTGGG - Intergenic
1159054777 18:63452762-63452784 TCCCTATGTTGAAGGAGTGCTGG - Intergenic
1159729974 18:72013930-72013952 AAACTATGTAGAGGGTGTGAAGG - Intergenic
1160493611 18:79357380-79357402 ACCCTGTGTGAGGGGTGTCCTGG + Intronic
1162091086 19:8280571-8280593 AGCAGCTGTGGAGGGTGTGCCGG - Intronic
1162093320 19:8295409-8295431 AGCAGCTGTGGAGGGTGTGCCGG - Intronic
1163256762 19:16160707-16160729 ACCCCAGGTGGAGGGGGTGTGGG + Intergenic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1163450278 19:17373176-17373198 ACCCTATTGGGAGGGTCTGAGGG + Intronic
1164044060 19:21519279-21519301 TCCCTATGTTGAGGGAATGCTGG - Intronic
1164206312 19:23061716-23061738 ATCCTATCTGTAGGCTGTGCTGG + Intergenic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1165638722 19:37365635-37365657 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1166124918 19:40708999-40709021 AATCGAGGTGGAGGGTGTGCGGG - Intronic
1167002914 19:46756428-46756450 CCGCTATGTGGTGGGCGTGCTGG + Exonic
1167496281 19:49820597-49820619 TCTCTATGTTGAGGGAGTGCTGG + Intronic
925751701 2:7095434-7095456 ACCCTGTGAGGAGGGAGGGCAGG + Intergenic
927132717 2:20073982-20074004 TCCCTATGTTGAGGGAGGGCTGG - Intergenic
930866947 2:56131146-56131168 ACTGTAGATGGAGGGTGTGCCGG + Intergenic
933469033 2:82696605-82696627 ATCCTAACTGTAGGGTGTGCAGG + Intergenic
933532744 2:83531092-83531114 TCCCTCTGTAGAGGGAGTGCTGG - Intergenic
937144988 2:119637040-119637062 ACCCTATGGGGATAGTGTGAGGG - Intronic
937303055 2:120854989-120855011 GCTCTGTGTGGAGGGTGTGCAGG - Intronic
937379325 2:121362400-121362422 ACCCTCTGTGGCATGTGTGCAGG + Intronic
943443292 2:187951861-187951883 AGCAGCTGTGGAGGGTGTGCTGG + Intergenic
943520617 2:188944638-188944660 AGCAGCTGTGGAGGGTGTGCTGG - Intergenic
947784715 2:232806637-232806659 ACCATATGAGGAGGGGGAGCTGG - Exonic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
949052890 2:241906714-241906736 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1169398590 20:5259579-5259601 AGTGTATGTGCAGGGTGTGCAGG - Intergenic
1171188342 20:23139768-23139790 ACCCTCTGTGAAGGTGGTGCTGG + Intergenic
1171286765 20:23946095-23946117 TCCCTATGTCCAGGGTGTCCAGG + Intergenic
1172125826 20:32624685-32624707 GGCCTATTTGGAGGGTGTACAGG - Intergenic
1173408771 20:42791261-42791283 ACCCTGTGTGGAATGTGTCCGGG - Exonic
1173679081 20:44863619-44863641 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
1175039414 20:56032861-56032883 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1177319149 21:19497640-19497662 AGACAATGTGGAGTGTGTGCTGG - Intergenic
1178976313 21:37224136-37224158 AACCCATGTGCAGGGTGGGCTGG - Exonic
1179319091 21:40272581-40272603 ACCCTCTGTGCAGGGTTCGCAGG + Intronic
1179881340 21:44294443-44294465 AGCCCCTGTGGAGGGGGTGCTGG + Exonic
1180894164 22:19316210-19316232 TCCTTATGTGGAGGGAGTGCTGG - Intergenic
1181276251 22:21688919-21688941 GCCCTCTCTGAAGGGTGTGCTGG + Intronic
1181917290 22:26291563-26291585 GGCCTATGTGCAGGATGTGCAGG - Intronic
1181969010 22:26676139-26676161 ACCCAATGTGAGGGCTGTGCTGG + Intergenic
1184233407 22:43170349-43170371 CCCCTGTGGGGAGTGTGTGCTGG + Intronic
1184892457 22:47388378-47388400 ACCTTGTGGGGAGGGTGGGCAGG - Intergenic
950487354 3:13281550-13281572 GCCCTGCCTGGAGGGTGTGCTGG - Intergenic
951323200 3:21271835-21271857 AGCAGCTGTGGAGGGTGTGCTGG - Intergenic
952843868 3:37670348-37670370 ACCCTAAGGGGAGGCTGTGATGG - Intronic
956726931 3:72163902-72163924 ACAGAATGTGGAGGGTGTGCTGG + Intergenic
959961255 3:112302004-112302026 TCCCTGTGTTGAGGGGGTGCTGG - Intergenic
959962002 3:112308059-112308081 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
960016952 3:112902077-112902099 ACCACATGTGCAGGATGTGCAGG - Intergenic
961317765 3:126052264-126052286 ACCCTATGTGGAGGGTGTGCAGG - Intronic
961333997 3:126159296-126159318 GACCTGTGAGGAGGGTGTGCTGG - Intronic
962531305 3:136283390-136283412 GCCTTCTGTGGAGGGTGTGGAGG + Intronic
964393780 3:156224135-156224157 AGCAGCTGTGGAGGGTGTGCCGG - Intronic
965850194 3:173013860-173013882 TCCCTAGGTTGAGGGAGTGCTGG + Intronic
967526424 3:190499419-190499441 AAACGATGGGGAGGGTGTGCTGG - Intergenic
969322116 4:6418590-6418612 AGCCTATGTGGGGGGTGTTGAGG - Intronic
970521045 4:16884064-16884086 TCCCTTTGTGGAGGGTGGACTGG - Intronic
971278853 4:25224407-25224429 TCCTTATGTTGAGGGAGTGCTGG + Intronic
971563569 4:28112927-28112949 AGCGGCTGTGGAGGGTGTGCTGG + Intergenic
978254881 4:106681667-106681689 AGCAGCTGTGGAGGGTGTGCCGG - Intergenic
978533346 4:109736183-109736205 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
979066957 4:116149813-116149835 ATCCTTTGTGGTGGGTGTGGTGG + Intergenic
980484462 4:133437814-133437836 TGCCTTTGTGGAGGGTCTGCTGG - Intergenic
982819281 4:159926446-159926468 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
983007339 4:162500266-162500288 ATTCTCCGTGGAGGGTGTGCAGG + Intergenic
983081235 4:163387597-163387619 ACCCTATGTGGAGGGTGTCAGGG + Intergenic
984821355 4:183885516-183885538 TCCATCTGTGGAGGCTGTGCAGG + Intronic
985726674 5:1519893-1519915 ACACCCTGTGGAGGATGTGCAGG - Intronic
990593603 5:57291573-57291595 AGCCTATGCAGAGGGTGGGCTGG + Intergenic
992048867 5:72925639-72925661 AGCAGATGTGGAGGGTGCGCTGG + Intergenic
994841398 5:104929151-104929173 AGCGGCTGTGGAGGGTGTGCTGG + Intergenic
994894708 5:105687973-105687995 ACTGTGTGTGGAGGGTCTGCGGG + Intergenic
997364704 5:133318549-133318571 TGCCTGTGTGGAGGGTCTGCAGG + Intronic
999433158 5:151541181-151541203 ACCCTAAGTGGAGGTTCTGTAGG + Intronic
1003007360 6:2394109-2394131 AGCCTATGTGGAAGGGCTGCAGG + Intergenic
1003213976 6:4091954-4091976 TCGCTATGTTGAGGGAGTGCTGG - Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1005059291 6:21761306-21761328 AGCGGCTGTGGAGGGTGTGCTGG + Intergenic
1005206320 6:23409501-23409523 CCCCTGTGTGGAAGGTGTGTGGG - Intergenic
1005423301 6:25675158-25675180 TCCCTTTGTTGAGGGAGTGCTGG - Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1007293304 6:40802938-40802960 GCCCTGTGTGCAGGGTGGGCTGG - Intergenic
1007633339 6:43284521-43284543 AGCATGTGTGGAGGGGGTGCCGG + Intronic
1013058099 6:106604779-106604801 ACCCTATGAAGAGGGTATGTAGG + Intronic
1027757945 7:82239806-82239828 ACCCTATCTGCAGGGTCTACTGG + Intronic
1028912989 7:96228855-96228877 AGCAGCTGTGGAGGGTGTGCTGG + Intronic
1031513306 7:122674041-122674063 AGCAGCTGTGGAGGGTGTGCCGG - Intronic
1032339652 7:131058911-131058933 AGCAGCTGTGGAGGGTGTGCCGG + Intergenic
1032670497 7:134077950-134077972 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1033376486 7:140766501-140766523 AATCTATGTGGAAGGTGTGTGGG - Intronic
1033714805 7:143989221-143989243 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
1039500578 8:38013574-38013596 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1040063497 8:43125013-43125035 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1046658656 8:116924768-116924790 TCCCTGTGTTGAGGGAGTGCTGG + Intergenic
1047398826 8:124528798-124528820 TCCTTATGTTGAGGGAGTGCTGG - Intronic
1050903019 9:10968831-10968853 AACCTATGTGAAGAGTTTGCAGG + Intergenic
1051186640 9:14467308-14467330 ACCCTGTGTGCTGGCTGTGCTGG - Intergenic
1053781720 9:41616612-41616634 TCCCTATGTTGAGGGAGCGCTGG + Intergenic
1056578648 9:87874182-87874204 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1057937814 9:99255718-99255740 ACCCTATGAGGAGGTTGGGCAGG + Intergenic
1061055546 9:128220586-128220608 GACCTATGTGGAGGGTGTCATGG + Intronic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1190584284 X:51922597-51922619 ACCCTCTGTGAAAGGTGTGGAGG + Intergenic
1191645369 X:63474910-63474932 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1191846139 X:65549649-65549671 ACCCTCTGAGGTGGGTGTGCAGG - Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1194740448 X:97566590-97566612 TCCCTATGTGAAACGTGTGCAGG - Intronic
1195896368 X:109749534-109749556 AGCATCTGCGGAGGGTGTGCTGG - Intergenic
1197719892 X:129738222-129738244 CCCCTATCTGGAGGGTTTGGGGG - Intergenic
1199745642 X:150770617-150770639 GCCCTATGAGGATGGAGTGCCGG - Intronic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1201428291 Y:13878603-13878625 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1202237472 Y:22728550-22728572 TCCCTGCGTTGAGGGTGTGCTGG - Intergenic
1202263354 Y:22992764-22992786 GCCCTTTGTGGAGTGTGTCCAGG - Intronic
1202416344 Y:24626505-24626527 GCCCTTTGTGGAGTGTGTCCAGG - Intronic
1202454443 Y:25043581-25043603 GCCCTTTGTGGAGTGTGTCCAGG + Intronic