ID: 961317816

View in Genome Browser
Species Human (GRCh38)
Location 3:126052483-126052505
Sequence GAGAGCAGGAGGAAGGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 950
Summary {0: 1, 1: 0, 2: 11, 3: 105, 4: 833}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961317816 Original CRISPR GAGAGCAGGAGGAAGGCTGC TGG (reversed) Intronic
900124035 1:1061760-1061782 CAGAGGAGGAGGAAGGTTGAGGG - Intergenic
900227718 1:1540682-1540704 GAGAGGCGGAGGAAGGCGGCGGG - Intergenic
900395697 1:2452419-2452441 GAGAGCAGGAGGCAGGATCAAGG - Intronic
900485225 1:2919634-2919656 GACAGCAGGAGTCAGGCTCCTGG + Intergenic
900990221 1:6095263-6095285 GTGAGCAGGCGGGAGGCTGCCGG - Intronic
901157995 1:7153637-7153659 AAGAGCAGGTGGGAGGTTGCCGG - Intronic
901182638 1:7352163-7352185 GAGAGAAGGAGGAAGTGGGCGGG + Intronic
901221549 1:7586578-7586600 TGGGGCAGGAGGGAGGCTGCAGG - Intronic
901280994 1:8034892-8034914 GAGCCCAGGATCAAGGCTGCAGG - Intergenic
901395919 1:8981445-8981467 GAAAGCAGGAGGAAGGAGGGAGG - Intergenic
901815212 1:11789814-11789836 GAGGGGATGAGGAAGGCAGCTGG + Exonic
901868921 1:12126153-12126175 GACACCAGGAGGAAGGCTGGGGG - Intronic
901965651 1:12863757-12863779 GAGTGTAGGAGGGAGGCTGAGGG + Intronic
901981048 1:13034135-13034157 GAGTGTAGGAGGGAGGCTGAGGG + Intronic
902001039 1:13194795-13194817 GAGTGTAGGAGGGAGGCTGAGGG - Intergenic
902020269 1:13340499-13340521 GAGTGTAGGAGGGAGGCTGAGGG - Intergenic
902546522 1:17193849-17193871 GAGAGCAGGAGGCAGGAGGTGGG + Intergenic
902786299 1:18734727-18734749 GAGAGGAGGAGGAAGGGTCTGGG - Intronic
902863170 1:19260316-19260338 GACAGCAGGAAGCAGGCTTCGGG + Intergenic
903280063 1:22245250-22245272 CAGTGCAGGAGGAAGGCAGGGGG + Intergenic
903331725 1:22600100-22600122 GAGAGAAGGAGGAAGGAAGGAGG + Intronic
903332321 1:22602447-22602469 GAGAGCCGGGTGGAGGCTGCAGG - Exonic
903806477 1:26009332-26009354 GAGGGCAGGAAGAAGGCAGTGGG + Intergenic
903865199 1:26392749-26392771 GAGGGCAGGAGGAAGCCTCTTGG + Intergenic
904092610 1:27955888-27955910 GAGAGAAGGAGGGAGGGAGCTGG - Intronic
904131495 1:28279059-28279081 GAAAGCATGAGTAATGCTGCTGG + Intronic
904219120 1:28950580-28950602 GGGAGCAGGAGAAAGGCAGAAGG + Intronic
904339516 1:29825054-29825076 AAGAGCCGGAGGGAGGCTCCAGG - Intergenic
904855070 1:33491571-33491593 ATGAGCAGGAGGAAGGGGGCTGG + Exonic
904859131 1:33521571-33521593 GAGAGCAGGTGGGAGGCTGCTGG + Intronic
905243314 1:36595505-36595527 CAGAGGAGGAGGAAGCCGGCGGG - Intergenic
905323492 1:37133893-37133915 GAGAGGAGGAGAGAGGCTGCTGG + Intergenic
905325593 1:37149514-37149536 GAGGCCTGGTGGAAGGCTGCTGG + Intergenic
905337677 1:37256713-37256735 GAGAGAAGGAGGATGGGAGCAGG - Intergenic
905533730 1:38702282-38702304 GGGAGCAGGAGGGAGACTGTGGG - Intergenic
906288327 1:44602941-44602963 GAGAGAAGGAGGCAGGGAGCAGG - Intronic
906301105 1:44682366-44682388 CAGAGGAGGAGGAAGGGTTCAGG + Intronic
906790465 1:48654641-48654663 GATGGCAGGAGGAAGGCAGCAGG + Intronic
907235721 1:53045190-53045212 GGGGGCAGGAGGGAGGCTTCTGG - Intronic
907276192 1:53317815-53317837 GAGTGCAGGAAGAAGGCAGAAGG + Intronic
907460018 1:54599932-54599954 GGGATCAGGAGCCAGGCTGCCGG + Intronic
907836767 1:58116638-58116660 GAGAGCAAGAGGAATGCTCAGGG - Intronic
908528422 1:65010332-65010354 GAGGGCAGGAGGATGGATGGAGG - Intergenic
909433365 1:75615208-75615230 GGGAGCAGGAAGTAGCCTGCAGG + Intergenic
909741973 1:79040268-79040290 GAGAGAGAGAGAAAGGCTGCTGG + Intergenic
910160284 1:84265027-84265049 GAGATGAGGAGGAAGGATGGTGG + Intergenic
910259822 1:85284125-85284147 GAGCACAGGAGGGAGGCTGAGGG + Intergenic
910283106 1:85523344-85523366 GAGAAGGGGAGGAGGGCTGCAGG - Intronic
910713801 1:90208663-90208685 GTGGGCAGGAGGGAGGATGCTGG + Intergenic
911660925 1:100500349-100500371 GAGGGGAGGAGGAAAGGTGCTGG + Intronic
912932862 1:113980297-113980319 GGGATCAGGAGGGAGGCTGCAGG - Intronic
912933352 1:113983040-113983062 GAGAGGAGGAGGAAGGCTCCAGG + Intergenic
912993433 1:114510921-114510943 AGGAGGAGGAGGAAGGCGGCAGG - Exonic
914206909 1:145539645-145539667 GAGAAGGGGAGGAGGGCTGCAGG + Intergenic
915194248 1:154177456-154177478 GAAAGAAGGAGGCAGCCTGCAGG + Intronic
915239215 1:154507887-154507909 GAATGCAGGAGGGAGGCTGAAGG - Intronic
915453083 1:156020542-156020564 GGGAGCAGCGGGAAGGCTGTGGG - Intronic
916084351 1:161257979-161258001 AAGAGAGGGAGGAAGGCTGGGGG - Intergenic
916379083 1:164188690-164188712 GGGAGCAGGAGGGGGCCTGCAGG - Intergenic
917534825 1:175866803-175866825 GTGAGCAGGAGAAAGGCAGGTGG + Intergenic
917858755 1:179124378-179124400 GAGAGCATAAGGGAGGCTTCTGG - Intronic
917962048 1:180153389-180153411 AAGAGAAGAAGGAAGGCTGAGGG + Intergenic
918015850 1:180632025-180632047 GAGAGGAGGAGGAAGATGGCGGG + Exonic
918083752 1:181227796-181227818 GAGAAGAGAAGGAAGGATGCTGG - Intergenic
918263240 1:182816075-182816097 CAAAGCAGGAGGAGTGCTGCTGG + Intronic
919614182 1:199784971-199784993 GAGAGAAGGTGGGAGGCTGATGG - Intergenic
919972129 1:202587870-202587892 GACACCAGGAGGCAGGCTGCGGG + Exonic
920211783 1:204333721-204333743 GAGAGCAGGACCTGGGCTGCAGG - Intronic
920255637 1:204652276-204652298 GAGGCAAGGAGGAAGGCGGCGGG - Intronic
920261982 1:204694548-204694570 GAGAGCAGGAAGTAGGCAGCAGG - Intergenic
920632815 1:207669319-207669341 CAGAGCATGGGGAGGGCTGCGGG - Intronic
922087782 1:222367742-222367764 GAGAGCAGGAGCAGGGCGGGTGG - Intergenic
922318816 1:224466275-224466297 GAGAACAGAAGAATGGCTGCTGG - Intronic
922832427 1:228610508-228610530 GGGAGCCGGGGGAAGGCCGCGGG - Intergenic
922832987 1:228612749-228612771 GGGAGCCGGGGGAAGGCCGCGGG - Intergenic
922833548 1:228614990-228615012 GGGAGCCGGGGGAAGGCCGCGGG - Intergenic
922834107 1:228617231-228617253 GGGAGCTGGGGGAAGGCCGCGGG - Intergenic
922834665 1:228619472-228619494 GGGAGCCGGGGGAAGGCCGCGGG - Intergenic
922835216 1:228621687-228621709 GGGAGCTGGGGGAAGGCCGCGGG - Intergenic
922835775 1:228623907-228623929 GGGAGCTGGGGGAAGGCCGCGGG - Intergenic
922836334 1:228626149-228626171 GGGAGCCGGGGGAAGGCCGCGGG - Intergenic
922836892 1:228628388-228628410 GGGAGCCGGGGGAAGGCCGCGGG - Intergenic
922837451 1:228630630-228630652 GGGAGCCGGGGGAAGGCCGCGGG - Intergenic
922838012 1:228632871-228632893 GGGAGCCGGGGGAAGGCCGCGGG - Intergenic
922838570 1:228635111-228635133 GGGAGCCGGGGGAAGGCCGCGGG - Intergenic
922839128 1:228637336-228637358 GGGAGCCGGGGGAAGGCCGCGGG - Intergenic
922839688 1:228639577-228639599 GGGAGCCGGGGGAAGGCCGCGGG - Intergenic
922840249 1:228641808-228641830 GGGAGCCGGGGGAAGGCCGCGGG - Intergenic
922840809 1:228644049-228644071 GGGAGCCGGGGGAAGGCCGCGGG - Intergenic
922841372 1:228646280-228646302 GGGAGCCGGGGGAAGGCCGCGGG - Intergenic
922878551 1:228960891-228960913 GCGTGCAGGAGGAAGGAAGCAGG + Intergenic
922894046 1:229087366-229087388 GGGAGCAGGAGGGAGCCTCCAGG - Intergenic
923000844 1:230005203-230005225 GAGGGCAGAAGGAGGCCTGCAGG - Intergenic
923142742 1:231175034-231175056 GGGAGCAGTAGCATGGCTGCAGG - Intronic
923163361 1:231337227-231337249 TTGAGAAGGTGGAAGGCTGCAGG - Exonic
923163727 1:231339505-231339527 TTGAGAAGGTGGAAGGCTGCAGG - Intronic
923287719 1:232512955-232512977 GGGAGCAGGAAGAGGGCTGACGG + Intronic
923401034 1:233615178-233615200 CAGAGTAGGAGGAAGGGTGAGGG + Intronic
923859457 1:237878443-237878465 GAGAGAAGTTGGAAGTCTGCTGG - Intronic
924270117 1:242323611-242323633 GGGAACTGGAGAAAGGCTGCAGG - Intronic
924577010 1:245289983-245290005 CAGAGCTGGAGGAAGGATGGAGG - Intronic
924598702 1:245469181-245469203 GAGTGCAGTAGGAAGACTCCAGG - Intronic
924853434 1:247853651-247853673 TAGAGAAGGAGGATGGTTGCAGG + Intergenic
1062832243 10:613770-613792 GAGATCAGGAGGGTGGCTGGGGG - Intronic
1062951454 10:1506921-1506943 GTGAGCAGGTGGCTGGCTGCAGG + Intronic
1063310937 10:4951096-4951118 TAGAGCAGAAGGATGGCTACTGG + Intronic
1063438395 10:6052905-6052927 GGGGGTAGAAGGAAGGCTGCAGG + Intronic
1063572897 10:7232883-7232905 CAAAGCTGGAGGAAGGCTGAGGG - Intronic
1063671652 10:8104214-8104236 GAGAGAAGGATGATGGCTGGTGG - Intergenic
1065101411 10:22335839-22335861 GAGAGGGAGAGGAAAGCTGCTGG - Intergenic
1065376657 10:25050053-25050075 GAGAGCAGGAGCAAGAGGGCAGG + Intronic
1066208585 10:33213871-33213893 CAGAGCAGGAGGAAGGTTTGAGG - Intronic
1066435932 10:35396782-35396804 GAGAGCACGAAGAGGACTGCAGG - Intronic
1066566983 10:36731081-36731103 GTGAGCTGAAGGAAGGTTGCTGG + Intergenic
1066714792 10:38275145-38275167 GGGAACTGGAGAAAGGCTGCAGG + Intergenic
1066783281 10:38975560-38975582 GGGAACTGGAGAAAGGCTGCAGG - Intergenic
1067520519 10:46998514-46998536 GATAGCAGGAGGAAGTCTTGTGG + Intronic
1067575158 10:47404174-47404196 GGGAGCTGGAGGAAGGCAGGAGG + Intergenic
1067693756 10:48520770-48520792 GAGAGCAGCAGGAAGGGTGAGGG + Intronic
1067766628 10:49091994-49092016 GGGAGCAGGAGCCAGGATGCAGG + Intronic
1068616508 10:59124236-59124258 GAGAGTAGGAGGGAGGCAGTGGG - Intergenic
1070084487 10:73223180-73223202 GAAAGCATGAGAAAGGCTTCTGG - Intronic
1070406846 10:76104851-76104873 GAGTGCAGGAGAAAGGCAGCAGG - Intronic
1070602254 10:77873972-77873994 GTGAGCTGGAGGAGGGCGGCAGG - Intronic
1070668181 10:78359984-78360006 GTGAGCAGGAGGGAGCCTGGGGG + Intergenic
1070689908 10:78516832-78516854 AACAGCAGGGGGAAGGCTGGAGG - Intergenic
1070716084 10:78722352-78722374 GAAAGCAGGAGCAAGGCTGTGGG - Intergenic
1070798664 10:79232050-79232072 GAGAGCAGGAGGCAAGCTCAAGG - Intronic
1070959484 10:80488554-80488576 GGGAGCAGGGGGATGGCTGCTGG + Intronic
1071653293 10:87418833-87418855 GAGAGGAGGAGGTACGCTACTGG - Intergenic
1072275280 10:93816708-93816730 GAGAGAAGGAGGAAGGCTCTTGG + Intergenic
1072430946 10:95369959-95369981 CAGAGCATGAGGAAGCCAGCAGG - Intronic
1072621753 10:97084307-97084329 GAGAGAATGAGGCAGGCAGCAGG - Intronic
1072706997 10:97687717-97687739 GAGAGGAGGGGGCAGTCTGCTGG + Intergenic
1073140710 10:101245614-101245636 GAAAGCAGGTGGAAGTCTGGAGG + Intergenic
1073193126 10:101666450-101666472 GGGAGTAGGAGGAGGGGTGCAGG + Intronic
1073215617 10:101834471-101834493 GAGAGTGGGAGGGAGGCTGCAGG - Intronic
1073327769 10:102652186-102652208 GGGAGCAGGAGGAAGTGTGGGGG - Intronic
1073448883 10:103597667-103597689 GAGAGCAAGAGGCAGGGAGCGGG - Exonic
1073984002 10:109187232-109187254 GTGAGGAGTAGGGAGGCTGCTGG + Intergenic
1074057947 10:109939420-109939442 CATAGCAGGAGGAAGGCTTGGGG - Intergenic
1074572995 10:114641783-114641805 GAGATCAGGAGGCAGACAGCAGG + Intronic
1074769421 10:116723752-116723774 GACTGCAGGAGCAGGGCTGCTGG - Intronic
1075410325 10:122223019-122223041 GAGAGGAGGAGGAAGGAGACAGG - Intronic
1075513770 10:123093503-123093525 GAGAGGAGGAGGAGGACAGCTGG - Intergenic
1075684260 10:124353129-124353151 GAGAGGAGAAGGAGGTCTGCAGG - Intergenic
1075699369 10:124459139-124459161 GAAAGCAGGAGGCAGCCTGATGG + Intergenic
1075798471 10:125137197-125137219 GACAACAGGAAGAAGGATGCAGG + Intronic
1076019170 10:127056426-127056448 CACAGCAGGAGGATGGCTTCAGG - Intronic
1076054848 10:127364091-127364113 GAGTGCAGGGGGCAGCCTGCAGG + Intronic
1076427046 10:130374223-130374245 GAGAGGAGGAAGGAGGCTTCAGG + Intergenic
1076865630 10:133164982-133165004 CAGAGCAGGGTGGAGGCTGCAGG + Intronic
1076991551 11:278666-278688 GAGAGCCTGAGGAAGTCAGCGGG - Intronic
1077319868 11:1936365-1936387 GGGGGCAGGAGGAAGGCTCCAGG - Intronic
1077402635 11:2366705-2366727 GAGAGCAGAGCGATGGCTGCAGG + Intergenic
1077714712 11:4569410-4569432 GAGGGCAGCAGGAGGGCGGCAGG + Intergenic
1078025018 11:7686910-7686932 GAGAGCAGAAAGATGGCAGCTGG + Intergenic
1078386580 11:10898362-10898384 GAGAGGAGGAGGAGGGGAGCAGG + Intergenic
1078757767 11:14227498-14227520 GAGAGCAGGAGGAGGGGTTTTGG - Intronic
1079129956 11:17741533-17741555 GAGAGCAGCTGGGGGGCTGCCGG - Intronic
1079238138 11:18704081-18704103 GAGAGCAGGATGAAGTCAGCAGG + Exonic
1080312512 11:30911595-30911617 GAGTGCTGGAAGAAGACTGCAGG + Intronic
1080603933 11:33848303-33848325 CAGAGCAGGAGGAAGGTGGCGGG - Intergenic
1080711073 11:34748562-34748584 GAGGGCAGGAGGAAGGCTGGAGG + Intergenic
1081068227 11:38575887-38575909 AAGAGCAGGAGCAAGGTTGGGGG + Intergenic
1081491816 11:43575297-43575319 GAGAGCAGGAGGGAGAGAGCGGG + Intronic
1081781599 11:45716819-45716841 GTGAGCCTGAGGAAGGCTTCAGG - Intergenic
1081912663 11:46710020-46710042 GAGAGCCGGAGGAAGCCAGATGG + Intergenic
1081999164 11:47383561-47383583 GAGAGCAGGGCGAAGGCAGATGG + Intergenic
1083180455 11:60981792-60981814 GAGGCCAGGAGGCAGGATGCAGG + Intronic
1083228498 11:61300068-61300090 GAGAGGAGGGGGAGGGCAGCAGG + Exonic
1083272161 11:61578041-61578063 GGGGGCAGAAGGGAGGCTGCAGG + Intronic
1083296850 11:61719637-61719659 CAGGGCAGGAGGAAGGCTGAAGG - Intronic
1084044473 11:66560766-66560788 GGGGGTGGGAGGAAGGCTGCAGG - Intronic
1084615644 11:70234116-70234138 GTCAGCAGGAGGCAGGCTCCTGG - Intergenic
1085203249 11:74714444-74714466 GAGGGCAGGAGGAAGGAACCAGG - Intronic
1085212222 11:74791506-74791528 GAGGACAGGAGGAAGGCTGTGGG - Intronic
1085250607 11:75141170-75141192 GTGAACAGGAGGAAGGCTGCAGG + Intronic
1085265645 11:75236446-75236468 GAAGGCAGCAGGAGGGCTGCTGG + Intergenic
1085300436 11:75455368-75455390 GAGGGCAGGAGGAAGGTGGGGGG + Intronic
1085325435 11:75602743-75602765 GAGAGCCCCAGGAAGACTGCAGG + Intronic
1085417690 11:76330167-76330189 GGGAGCAGCTGGTAGGCTGCTGG + Intergenic
1085461866 11:76698923-76698945 GACAGCAGCAGGCAGGCCGCAGG - Intergenic
1085554806 11:77410652-77410674 GAGGGGAGGAGGAAGGGTGAAGG + Intronic
1085600481 11:77851679-77851701 GAAAGCAGGAGCAAGGTTGGGGG - Intronic
1087171620 11:95054866-95054888 GGGAGCAGGAGGAAGGCCGGCGG - Intergenic
1087482545 11:98719528-98719550 GAGAGCAGAAGAATGGTTGCTGG + Intergenic
1087817919 11:102679387-102679409 GAGAGTAGGAGGAGGGTGGCGGG + Intergenic
1087917266 11:103825402-103825424 GGGAACAGGAGGCAGACTGCTGG + Intergenic
1088554096 11:111044017-111044039 AAGAGAAGGAGGAAGTCTGATGG - Intergenic
1089531466 11:119132589-119132611 GAGGGCAGGAGGGAGGCTGTGGG - Intronic
1089643625 11:119863983-119864005 GAGGGCAGGAGGAAGGCAGGGGG - Intergenic
1089748328 11:120632587-120632609 AAGAGCAGGAAGAAGGTGGCTGG - Intronic
1089759607 11:120713419-120713441 GAGAGCAGGAGGAAGACAGAGGG + Intronic
1090005874 11:123001846-123001868 AGGAGCAGGAGCAAGGTTGCTGG - Intergenic
1090029749 11:123196204-123196226 GAGGGCAGGAGGCTGGCGGCCGG + Intergenic
1090052412 11:123391281-123391303 GAGAGAAAGAGTAAGGCTGCAGG - Intergenic
1090084566 11:123640083-123640105 GAGAGCAGTCCGAAGGCTCCAGG + Intronic
1090854609 11:130600691-130600713 CAGAGCAGGAGGAAGGGGGCAGG + Intergenic
1090982737 11:131737755-131737777 GTGAGCAGGAGGCAGGATGGGGG + Intronic
1091179422 11:133590024-133590046 AAGAGCAGGAATAAGGCTGGTGG - Intergenic
1092080202 12:5709750-5709772 GAGAGCAGGAGTGAGGCTAATGG - Intronic
1092534406 12:9374824-9374846 AAGGCCAGGAGGCAGGCTGCTGG - Intergenic
1093242504 12:16695550-16695572 GAGAGGAGGAGGAAGGGGGGAGG + Intergenic
1093435397 12:19129928-19129950 GAGGGCAGGAGGCGGGCGGCTGG + Intronic
1094008640 12:25783107-25783129 GTGACCAGGAGGAAACCTGCAGG - Intergenic
1094428072 12:30336668-30336690 GAGAGCAGGAGTAGGGCTTGGGG + Intergenic
1094498619 12:31004757-31004779 GAGGGCAGGAGGAAGGAAGAAGG + Intergenic
1094769553 12:33638300-33638322 CAGCCCATGAGGAAGGCTGCTGG + Intergenic
1096534382 12:52261792-52261814 GAGAGCAGGGGGAAGGAGGCTGG + Intronic
1096747446 12:53738132-53738154 TAGAGCAGCAAGAAGGCTGAAGG + Intergenic
1096837329 12:54359116-54359138 GAGAGGAGGAGGGACGCGGCGGG + Intergenic
1097240611 12:57572533-57572555 GGGAGCAGGAGGATGGCAACAGG + Intronic
1097688572 12:62713375-62713397 GAGAGCTGAAAGAAGGCTGCTGG + Intronic
1098391099 12:69970917-69970939 CAGAGCAGGAGGAAGGGAGGGGG - Intergenic
1098460770 12:70730846-70730868 GAGAGCAGAAGGAAGGAGGAAGG + Intronic
1098558957 12:71851174-71851196 TAGAGCAGGAGGAAGGGGGAGGG + Intronic
1100225559 12:92552373-92552395 GATAGGTGGAGGAAGGTTGCAGG - Intergenic
1100921661 12:99494891-99494913 GGGAGCAAGAGGAAGGTTACAGG + Intronic
1101336194 12:103799218-103799240 GAGGGCAGGAGGATGTCTGATGG - Intronic
1102061558 12:109935992-109936014 GAGGGCAGGAGTGAGGCTGGAGG + Intronic
1102251117 12:111388178-111388200 GAGTGAAGGAGGAAGCCTCCTGG - Intergenic
1102499354 12:113340774-113340796 GAGCCCAGGAGTAAGGCTGCAGG + Intronic
1102764724 12:115422925-115422947 GAGAGAAGGAGGAAGGGAGGAGG + Intergenic
1102924977 12:116819547-116819569 GGGAGGAGGAGGCAGGCGGCCGG + Intronic
1103043268 12:117713759-117713781 GAGAGCTGGAGAAGGGCTTCTGG + Intronic
1103211363 12:119169239-119169261 GGGAGCAGGAGGAAGACTGGAGG - Intergenic
1103239074 12:119398126-119398148 GAGGGGAGGAGGAAGGCGGGGGG + Intronic
1103739002 12:123078691-123078713 CAGAGGAGAAGGGAGGCTGCTGG + Intronic
1103954355 12:124567929-124567951 GAGAGGAGGAGGAGGGCCCCCGG - Intergenic
1104886281 12:132110828-132110850 GGGAGCAGGATGCAGGCTGTGGG + Intronic
1104985180 12:132592523-132592545 GCGAGCGGGAGGAAGGGGGCGGG + Intergenic
1105356362 13:19663478-19663500 TGGAGCAGCAGGGAGGCTGCTGG + Intronic
1105850187 13:24327723-24327745 GGGAGGAGGAAGATGGCTGCGGG + Intergenic
1106036945 13:26051840-26051862 GAGAGCCGGCCGGAGGCTGCCGG - Intergenic
1106125183 13:26895453-26895475 CAGAGGGGAAGGAAGGCTGCCGG - Intergenic
1106136550 13:26977887-26977909 GGGAGCAGAAGGAAGCCTTCAGG - Intergenic
1106999599 13:35527502-35527524 GAGCTCAGGAGGGAGGCTGGGGG - Intronic
1107425656 13:40290095-40290117 GGGAGCAGGAGGAAGAGTGAAGG + Intergenic
1107885621 13:44872265-44872287 GAGAGCTAGAGGCAGACTGCTGG + Intergenic
1108825081 13:54403564-54403586 GAGGGCAGGAAGAATGCAGCAGG - Intergenic
1109103777 13:58222317-58222339 GTTAGCAGGAGGAAGGATCCAGG + Intergenic
1109220915 13:59640021-59640043 CAGAGCAGGAGGAAGAGAGCAGG - Intergenic
1109334220 13:60971780-60971802 GAGAACAGAAGGAAGGGTGGGGG - Intergenic
1110719822 13:78748557-78748579 GAGAGGAGGAGAAAGGATGGAGG - Intergenic
1111243694 13:85508117-85508139 AAGTGCAGGAGGGAGGCTGGGGG + Intergenic
1111955928 13:94758471-94758493 GTGGGGAGGACGAAGGCTGCTGG - Intergenic
1112105095 13:96231499-96231521 CAGAGCAGGAGGAAGGCGGGAGG + Intronic
1112286247 13:98107077-98107099 GAAAGCAGGAGCAAGGCGGCGGG + Intergenic
1112610806 13:100952931-100952953 GAGGGCAGCAGGAAGACTGCTGG - Intergenic
1113091273 13:106619372-106619394 GAGACCAGGAGGAAGGCCACTGG - Intergenic
1113388503 13:109873461-109873483 GAAACCAGGAGTCAGGCTGCGGG - Intergenic
1113791508 13:113031296-113031318 GAGAGCACGAGGGAGGCAGAGGG + Intronic
1113813277 13:113154478-113154500 GGGAGGAGGAGGAAGGGTTCTGG + Intergenic
1113861393 13:113490079-113490101 CAGCGCAGGAGGGAGGCTGCTGG - Intronic
1114004968 14:18302418-18302440 GTGAGCTGAAGGAAGGTTGCTGG + Intergenic
1114040414 14:18673139-18673161 GAGGGAAGGAGGAAGGGTGGAGG + Intergenic
1114426578 14:22628923-22628945 GAAAGGAGGAAGAAGCCTGCAGG - Intergenic
1114454468 14:22846145-22846167 GAGAGAAGCAAGGAGGCTGCGGG - Exonic
1114688914 14:24562232-24562254 GGGAGCAGGAGCAAGGCAGGAGG - Intergenic
1115134468 14:30091978-30092000 GAGAGCAGGAGGAAGAGCGTAGG + Intronic
1115504745 14:34082753-34082775 GATAGCAGGAGAAAGGAAGCAGG - Intronic
1116018512 14:39433510-39433532 GAAAGAAGGAAGAAGGCTGAAGG + Intergenic
1116945236 14:50830496-50830518 GAGCGCTGGAGGCGGGCTGCCGG - Exonic
1117496668 14:56312492-56312514 CAGAGCAGGAGGAAGGTGGAGGG + Intergenic
1118321828 14:64757892-64757914 GAGAGCAGGAAGAGGGCTGAGGG - Intronic
1118327008 14:64788126-64788148 GAGAGGAGGATTAAGGCAGCTGG + Intronic
1119695609 14:76711004-76711026 TAGAGCACGAGGAATGTTGCAGG + Intergenic
1119745498 14:77040834-77040856 GGGAGCAGGAAGAAAGCTGGGGG - Intergenic
1120369728 14:83617660-83617682 TGGAGCAGGAGGAAGGGGGCTGG + Intergenic
1120489685 14:85161512-85161534 GAGAGAAGGTGTAAGGCTGAAGG - Intergenic
1120546707 14:85820575-85820597 GAGAGCAGGGAGAAGGCCACTGG + Intergenic
1121102341 14:91258570-91258592 GACTCCAGGAGGAAGGCTTCAGG + Intergenic
1121132909 14:91464980-91465002 CACAGCAGGAGGTAAGCTGCTGG - Intronic
1121168816 14:91836298-91836320 GAGACCCGGAGGAGGGCGGCGGG - Intronic
1121464588 14:94106800-94106822 AAGAGCAAGAGGAAGGCAGGAGG + Intronic
1121991608 14:98563119-98563141 AAGAGCAGGTGGATGGCTGAGGG + Intergenic
1122148008 14:99705442-99705464 GAGAGCAGGAGGATTGCTTGCGG - Intronic
1122246512 14:100406984-100407006 CGGAGCAGGAGCGAGGCTGCAGG + Intronic
1122402779 14:101477081-101477103 AGGAGCAGGAGAAAGGCAGCAGG - Intergenic
1122468603 14:101950774-101950796 GAGAACAGCAAGAAAGCTGCTGG - Intergenic
1122809564 14:104281336-104281358 GTGAGCAGGGGGAGGGCGGCAGG - Intergenic
1122832053 14:104403181-104403203 CAGAGAAGGAGGAAGGGTGGGGG - Intergenic
1122890346 14:104729323-104729345 AGGAGCAGGACGATGGCTGCAGG + Intronic
1123121205 14:105917945-105917967 GAGACCAGGGTGTAGGCTGCAGG + Intergenic
1123142052 14:106089377-106089399 GAGAGCAAGAGGAATCCTGAGGG - Intergenic
1123200524 14:106658987-106659009 AAGAGCAAGAGGAATGCTGAGGG - Intergenic
1123389426 15:19854652-19854674 GTGAGCTGAAGGAAGGTTGCTGG + Intergenic
1123977034 15:25563484-25563506 GTGACCAGGGGGCAGGCTGCTGG - Intergenic
1124076779 15:26453831-26453853 TCAAGTAGGAGGAAGGCTGCTGG + Intergenic
1124165034 15:27318768-27318790 GAGAGGAGGAGGGAGGCAGAAGG - Intronic
1124197451 15:27644806-27644828 GGGAGGAGGAGCAAAGCTGCTGG - Intergenic
1124420673 15:29518629-29518651 AAGGGCAGGAGGAAGGCCACAGG + Intronic
1124612268 15:31216330-31216352 GGGAGGAGGAGGAGGGGTGCGGG + Intergenic
1124683755 15:31760184-31760206 GAGAGAAGGATGAAGGATGAGGG - Intronic
1125303901 15:38288488-38288510 GAGAGAAGGTGGATGGATGCTGG + Intronic
1125756626 15:42069644-42069666 TAGGGCAAGTGGAAGGCTGCAGG + Intronic
1125935668 15:43633431-43633453 GTGAGCAGGGGGAAGAGTGCTGG - Intronic
1125948439 15:43729895-43729917 GTGAGCAGGGGGAAGAGTGCTGG - Intergenic
1126695701 15:51323669-51323691 CAGAGGAGGAGGCAGGGTGCTGG - Intronic
1127126761 15:55819596-55819618 GACATCAGAAGGGAGGCTGCCGG - Intergenic
1127284644 15:57521826-57521848 AAGAGGAGGAGAAAGGCTGGGGG + Intronic
1127556078 15:60088982-60089004 GAGAGGAGAAGGAAGGGAGCAGG + Intergenic
1127832216 15:62760935-62760957 GAGAGCATAAGGAAAGCTTCTGG - Intronic
1127939626 15:63681850-63681872 GAGAACAGAAGGAAGCCTACAGG + Intronic
1128083466 15:64870467-64870489 CAGAGGAGGAGGAAGGGAGCTGG - Intronic
1128355620 15:66924397-66924419 GAGAGCAGGACGTAGGATGGTGG - Intergenic
1128933392 15:71725544-71725566 GAGAGCAGGAGGAAAGCAAGGGG + Intronic
1129622681 15:77163135-77163157 GAAAGCAGAAGGAACGCTGAAGG - Intronic
1129670383 15:77604581-77604603 GAGGGCAGGAGCGAGGCTTCCGG + Intergenic
1129750542 15:78059765-78059787 GAGAGCTGGTGGGAGGCTGAGGG - Intronic
1129823529 15:78620125-78620147 GAGAGCGGGAGGAAGACAGGAGG + Intronic
1130052596 15:80496289-80496311 GGGAGCAGGGAGAAGGGTGCTGG - Intronic
1130398242 15:83523733-83523755 GAGAGAAGGAGGGAGGCAGGGGG - Intronic
1130871202 15:87973671-87973693 GAGAGGAGGAGGAGAGCTCCAGG + Intronic
1130878155 15:88032150-88032172 CACAGCAGGAGGAACCCTGCTGG + Intronic
1131158960 15:90091924-90091946 CACAGCAGGAGGAGAGCTGCAGG + Intronic
1131372867 15:91897838-91897860 GTGAGCATGAGGATGGGTGCGGG + Intronic
1131749940 15:95495428-95495450 GAGAGCTGGAGGAAAGCAGGAGG + Intergenic
1131952012 15:97691452-97691474 GACACCAGGAAGAAGTCTGCAGG + Intergenic
1132649519 16:1014220-1014242 CAGGGCAGGAGGGGGGCTGCAGG - Intergenic
1132865534 16:2091194-2091216 GAGGGCGGGAGGGACGCTGCCGG + Intronic
1133055729 16:3144611-3144633 GAGAGCAGCAGGAAGACTTTGGG - Exonic
1133479105 16:6152302-6152324 GAGAGCAGGAGAAAAGATGAGGG - Intronic
1133883804 16:9807327-9807349 GAGAGAGGGAGGAAGGGTGGAGG + Intronic
1133902285 16:9988451-9988473 GGGAGCTGGAGGAAGGTTTCTGG - Intronic
1133976972 16:10606416-10606438 GAATGCAGTAGGAAGCCTGCAGG - Intergenic
1134037564 16:11042413-11042435 GAGGACAGGAGGGAAGCTGCTGG + Intronic
1134041715 16:11073701-11073723 TGGAGCAGGAGGAAGGAGGCTGG - Intronic
1134409622 16:13993152-13993174 CAGGGAGGGAGGAAGGCTGCCGG + Intergenic
1134710918 16:16326607-16326629 GAGAGAAGGAGGAGGGCAGAAGG - Intergenic
1134948666 16:18342002-18342024 GAGAGAAGGAGGAGGGCAGAAGG + Intergenic
1135435018 16:22420909-22420931 AAGAGCAGGAGGGAGGACGCGGG + Intronic
1135468918 16:22712095-22712117 AGGTGCAGGAGGAAGGCTGCAGG + Intergenic
1135990507 16:27216079-27216101 GTGAGTAGGAGGGAGGCAGCAGG + Intronic
1136059286 16:27714023-27714045 GAGGGCAGGCCCAAGGCTGCTGG - Intronic
1136073892 16:27805075-27805097 GGGAGCAGGGGGAGGGCTGTGGG + Intronic
1136380789 16:29894402-29894424 GAGAGAAGGAGGGAGGCAGATGG - Intronic
1137244109 16:46688962-46688984 GACAGCAGGAGGAAGGCCGCGGG - Intronic
1137421814 16:48341414-48341436 CAGAGCAGGAGCAAGAGTGCAGG + Intronic
1138074564 16:54028331-54028353 GAGAGGAGGAGGGAGGATCCTGG - Intronic
1138294786 16:55876861-55876883 TAGAGGAGGAGGAAGGCAGGGGG + Intronic
1138338288 16:56269854-56269876 CAGAGAAGGAGAATGGCTGCTGG + Intronic
1138346880 16:56325629-56325651 GAAACCAGGGGGAAGGCGGCTGG + Intronic
1138355205 16:56372267-56372289 GACAGCAGAATGATGGCTGCAGG - Intronic
1139631422 16:68234168-68234190 GAGGGTAGGAGGAAGGAGGCAGG + Intronic
1139744649 16:69064476-69064498 GGGAGCAGCAGAAAGGCTGGTGG - Intronic
1139751708 16:69112923-69112945 GAGACCAGTAATAAGGCTGCTGG - Intronic
1139810829 16:69615898-69615920 GAGAGCAGGAGGACAGCCCCAGG - Intronic
1139926844 16:70493153-70493175 GTGAGCTGGAGAGAGGCTGCTGG - Intronic
1140221998 16:73050312-73050334 AAGTGCAGGAGGCAGGTTGCAGG - Intronic
1140252276 16:73304616-73304638 GAGGGCTGGAGGAAGGGGGCAGG - Intergenic
1140912634 16:79467852-79467874 GAGAGGGGGAGAAAGGATGCAGG + Intergenic
1141017354 16:80463109-80463131 CAGAGCAGGAGGCGGGCTGGTGG + Intergenic
1141335946 16:83155527-83155549 AAGAGCAGGAGGAGAGCTGGAGG - Intronic
1141427140 16:83951880-83951902 GAGAGAAGGAGGAAGGAGGAAGG - Intronic
1141656318 16:85418549-85418571 GGGAGGGGCAGGAAGGCTGCTGG - Intergenic
1141891434 16:86929200-86929222 AAGAGCAGCAGGAAGGCAGGAGG + Intergenic
1142044204 16:87914684-87914706 GAGAGCAGGAGGGAGGACGTGGG + Intronic
1142278205 16:89133920-89133942 GAGAGCAGGAGGGTGGCAGTGGG - Intronic
1142386838 16:89770676-89770698 GGGAGCAGCAGGAAGGAAGCCGG + Intronic
1142414335 16:89933368-89933390 GTGAGCAGGAGGATGGCAGGCGG + Intronic
1142524201 17:527165-527187 GAGAGCATGAGGAAGGCTTCAGG - Intronic
1142741641 17:1935034-1935056 GACAGCAGGAGGGAGGCGTCGGG - Exonic
1142982447 17:3679946-3679968 GAGAGCAGGGTGGAGGATGCAGG - Intronic
1143583184 17:7838272-7838294 GGGAGGAGGAGGGAGCCTGCTGG + Intergenic
1144029576 17:11307454-11307476 GAAAGCAAGAGGAAGGAAGCAGG + Intronic
1144219351 17:13086092-13086114 GGGGGCAGGAGGAGGGCTGAGGG - Intergenic
1144451477 17:15383455-15383477 GAGAGCTGCGGGCAGGCTGCTGG - Intergenic
1144724819 17:17496529-17496551 GAGAGCAGGAGCCCGGCAGCGGG - Intergenic
1144802161 17:17937075-17937097 GGGAGCAGAAAGAAGGCTGGAGG + Intronic
1144872061 17:18377809-18377831 GAGGGCAGGTGGGAGGCAGCGGG - Exonic
1145404007 17:22570068-22570090 GAGAGCAGTAGGAGGGCAGCCGG - Intergenic
1146224000 17:31050285-31050307 GAGTTCTGGAGGCAGGCTGCCGG + Intergenic
1146341324 17:32021847-32021869 GAGTTCTGGAGGTAGGCTGCCGG - Exonic
1146624293 17:34424169-34424191 GAGAGAAGCGGGCAGGCTGCAGG - Intergenic
1146938243 17:36825878-36825900 GAGAGCTGGAGGAAGGAAGAGGG + Intergenic
1146948433 17:36889929-36889951 GGGAGGAGGAGGGAGGCGGCTGG - Intergenic
1147575136 17:41594619-41594641 GAGAGCAGGAGGAAGGGAAAGGG + Intergenic
1147922448 17:43926332-43926354 GAGTTCTGGAGGCAGGCTGCCGG + Intergenic
1147970999 17:44219124-44219146 GAGGGCGGGAGGACGGCGGCCGG + Intronic
1147977340 17:44255344-44255366 TAGGGCAGGAGGAAGGCAGGAGG - Intronic
1148233504 17:45951924-45951946 GAGAGAGGGAGGAAGGCTGATGG + Intronic
1148611908 17:48970275-48970297 GAGAGGAGGAGGAGAGCTGGAGG + Intergenic
1148759936 17:49994409-49994431 GAGAGGAAGGGGAAGGCTGTGGG - Intronic
1148857553 17:50587027-50587049 GTGAACAGCAGGAAGGATGCAGG + Intronic
1149894043 17:60415207-60415229 GAGGGCTGGATGTAGGCTGCTGG + Intronic
1150141971 17:62737820-62737842 CAGATCAGGAGGAAGGCTATAGG + Intronic
1150784514 17:68151722-68151744 GAGTTCTGGAGGCAGGCTGCTGG + Intergenic
1151060285 17:71084359-71084381 GGGAGCAGTGGGAAGGCTACTGG + Intergenic
1151327381 17:73387720-73387742 GAGAGCTGGGGGCAGGCTGGAGG + Intronic
1151385614 17:73753537-73753559 CAGAGGGGGAGGAAGGCTGGGGG + Intergenic
1151388650 17:73770845-73770867 GAGGGCTGGAGGAGGGCTGGGGG + Intergenic
1151393602 17:73804307-73804329 GAGGGGAGGAGGCAGGCTGAAGG + Intergenic
1151499795 17:74481442-74481464 CAGAGCAGGACGAATGATGCTGG + Intronic
1151749226 17:76027253-76027275 GAGGGCAGGTGGGAGGCAGCGGG + Exonic
1151874807 17:76861561-76861583 AGGAGCAGGAGGAAGGCGGTGGG + Intergenic
1152285845 17:79412966-79412988 GAGAGCAGAAGGGAGGCTGGAGG - Intronic
1152315780 17:79579572-79579594 GAGAGGAGGAGGCAAGCTCCGGG + Intergenic
1152630319 17:81408076-81408098 GGCAGCAGGAGGAAGGGGGCCGG - Intronic
1152640721 17:81448180-81448202 CAGAGCAGGAGGCAGGCGGCAGG - Intronic
1152724973 17:81940707-81940729 GCGAGCAGGAGGGAAGCCGCGGG - Exonic
1152888494 17:82866593-82866615 GAGGGCAGGAGAAAGGCCCCAGG + Intronic
1152912199 17:83011192-83011214 GAGAGGAGGAGGAAGGACGGGGG + Intronic
1153126299 18:1796031-1796053 TAGGGCAGGAGGAAGGCTTCTGG + Intergenic
1153343748 18:4004374-4004396 GAGAGCAGGAGGAAGGCAGAGGG - Intronic
1153788628 18:8557252-8557274 GGAAGCAGGAGGAAGGTTGGAGG - Intergenic
1154031403 18:10756870-10756892 GAGATGAGGAGGAAGGATGCAGG + Intronic
1154332240 18:13439723-13439745 GGAAGAGGGAGGAAGGCTGCAGG + Intronic
1154373765 18:13791458-13791480 GAGTGCATGAGGGAGGCTTCTGG - Intergenic
1154532455 18:15361461-15361483 GTGAGCTGAAGGAAGGTTGCTGG - Intergenic
1156073013 18:33236781-33236803 GAGAGCAGCACGAAGGCACCTGG + Intronic
1157166051 18:45359370-45359392 CAGAGGAGGAGGAGGGGTGCTGG - Intronic
1157529825 18:48410557-48410579 GAGGGGAGGAGGAAGGGTCCTGG + Intronic
1157621530 18:49020125-49020147 TACAGCAGGAGCCAGGCTGCTGG - Intergenic
1157867348 18:51197737-51197759 GAAAGGAGTTGGAAGGCTGCGGG - Intronic
1159073157 18:63648475-63648497 GAGAGCAGGAGGAAGGGATGAGG - Intronic
1159626663 18:70703153-70703175 GAGATCAAGATGAAGGCTGCAGG + Intergenic
1160003911 18:75053958-75053980 GAAAGCAGGAGAAAGGGTGCAGG - Intronic
1160019922 18:75172495-75172517 GAGAGTAGGAGGAAGGAAGCGGG + Intergenic
1160074437 18:75658783-75658805 AGGAGCAGGAGGAAGACTTCAGG + Intergenic
1160316973 18:77857486-77857508 GAGAGCAGGTACAAGGCTGGTGG + Intergenic
1160695824 19:483823-483845 GAGGGAAGGAAGATGGCTGCAGG - Intergenic
1160695983 19:484751-484773 GAGAGCAGGAGGAGGGAGGGCGG + Intergenic
1160798583 19:956808-956830 GAGAGGGGCAGGACGGCTGCAGG + Intronic
1160991384 19:1861737-1861759 GAGAGCAGGAGGGCGGGTGGGGG - Intronic
1161058307 19:2201406-2201428 GACAGCAGGAGCGAGGGTGCGGG - Intronic
1161234298 19:3190273-3190295 GGGAGCAGGGGTGAGGCTGCTGG + Intronic
1161266341 19:3366467-3366489 GAGAGCAGGAGGGAGGAGGAGGG + Intronic
1161362077 19:3856034-3856056 GAGAGCAGAAGGAAGCGTGAAGG + Intronic
1162054120 19:8052674-8052696 GAGAGGAGGAGGAAGGGAGGAGG + Intronic
1163327760 19:16616103-16616125 GAGACCAGGAGGAAGGCCATGGG + Intronic
1163496142 19:17647648-17647670 GAGAGGAGGTGGAAGGGTGAAGG - Intronic
1164180174 19:22811420-22811442 GTGAGCAGGGTGAAGGCAGCAGG - Intergenic
1164508688 19:28880065-28880087 GAGAGCAGAAGGATGGTTACAGG - Intergenic
1164583520 19:29450206-29450228 GAGATTGGGAGGAAGGCTGTTGG - Intergenic
1164625502 19:29724892-29724914 GAGCGCAGCAGAAAGGCCGCTGG - Intergenic
1164630793 19:29760288-29760310 GGCAGCAGGAGGCAGGCGGCGGG + Intergenic
1164757347 19:30700055-30700077 GAGAGAAGGAGGGAGGCGGAGGG - Intronic
1164950250 19:32330982-32331004 GGGAGCAGGAGGAAGAGAGCAGG + Intergenic
1165306447 19:35005574-35005596 GAGACCAGGGAGGAGGCTGCTGG + Intronic
1165413011 19:35673784-35673806 GAGGTCAGGAGCTAGGCTGCCGG - Intronic
1165940122 19:39410653-39410675 GAGAGCAGGAGGGAGGCTTGAGG - Intergenic
1166082361 19:40452036-40452058 GAGACCAGGGAGTAGGCTGCTGG - Intronic
1166719293 19:44988227-44988249 GAGGGGAGGAGGAAGGGGGCAGG - Intronic
1166767872 19:45263187-45263209 GAGAGCAGGAGCCAGGCTTCCGG + Intronic
1167497152 19:49826421-49826443 GAGAGCAGGAAGAAGGCTCAGGG + Intronic
1167609582 19:50500768-50500790 GGGAGCAGGAGGAGGTCAGCTGG + Intergenic
1168016558 19:53578294-53578316 GAGAGCAGGAGTAGTGATGCTGG + Exonic
1168224009 19:54981528-54981550 GAGAAAAGGAGGCAGGCTGATGG - Intronic
1168276880 19:55283882-55283904 GAGAGGAGGTGGGAGGATGCAGG - Intronic
1168294293 19:55371085-55371107 GAGAGCGGGAGGAAGACAGCAGG + Intergenic
1168319983 19:55503454-55503476 GAGAGCACGCGGGAGACTGCAGG - Intronic
1168353716 19:55689918-55689940 GAGAGCAAGAGGGAGACTGGGGG + Exonic
1168707208 19:58476977-58476999 GAGAGCAGGAGGAAGCCTCAGGG - Intronic
924962726 2:47788-47810 GAGAAGAGAAGGAAGGATGCGGG + Intergenic
924963002 2:50863-50885 AAGTACAGGAGGAAGGCTGGAGG + Intergenic
924971880 2:135898-135920 CAGAGCAGGAGGAAGGGAGGAGG - Intergenic
925301242 2:2814267-2814289 CAGAGCAGGATGAAGGGTGAGGG - Intergenic
925516522 2:4689642-4689664 GAGAGCAGGGGCAAGGATGGAGG + Intergenic
925822731 2:7816238-7816260 AAGAGCAGGAGGAAGTGTGATGG + Intergenic
926163101 2:10501862-10501884 GAGGGAAGGAGGCTGGCTGCCGG - Intergenic
926347164 2:11957762-11957784 GAGAGGAGGAGGAAGGGTGGAGG + Intergenic
926630524 2:15131866-15131888 GAGAGCAGGAGCAAGGGAGGGGG + Intergenic
926644946 2:15280374-15280396 GGGAGAAGGGAGAAGGCTGCCGG + Intronic
926963066 2:18380011-18380033 CACAGCAGGAGGTAAGCTGCAGG + Intergenic
927014895 2:18949556-18949578 TGGAGCAGGAGGAAGGTGGCAGG - Intergenic
927018744 2:18995911-18995933 CTGAGCAGGATGAAGTCTGCAGG + Intergenic
927266537 2:21159190-21159212 GGGAGCAGGAAGAAGGCAGCAGG + Intergenic
927448947 2:23189762-23189784 GAGACCAGGAGGGCGCCTGCTGG - Intergenic
927915769 2:26935213-26935235 GAGATCTGGAGGAAGGGTGTGGG - Intronic
928161273 2:28927671-28927693 GAGAGCAAGAGGAAGTCAGGGGG + Exonic
928312240 2:30220621-30220643 AACAGCTGGAGGCAGGCTGCTGG - Intergenic
928925938 2:36579553-36579575 TGGAGCAGGAGGAAGGGGGCTGG - Intronic
929030204 2:37643277-37643299 GAGAGCAGGTGGACTGCTGGTGG - Exonic
929474081 2:42227685-42227707 CAGAGGAGGAGGAAGGGGGCGGG - Intronic
929560099 2:42951141-42951163 CTCAGCAGGAGGAAGCCTGCAGG + Intergenic
929569828 2:43015328-43015350 TAGAGCAGAAGTGAGGCTGCAGG - Intergenic
929938823 2:46314968-46314990 GGGAGAAGGAGGCAGGCTGCTGG + Intronic
930582922 2:53233976-53233998 GATAGCAGGAAGAAGACTTCTGG + Intergenic
930601865 2:53453058-53453080 GAGAGCAGCAGGATGGCCTCGGG + Intergenic
930721499 2:54642263-54642285 GAGAGCCGCACAAAGGCTGCTGG - Intronic
930911846 2:56638320-56638342 GAGACCAGGAGGAAGAAGGCTGG + Intergenic
931634283 2:64327818-64327840 AAGGGAAGGAGGAAGGCTGTGGG + Intergenic
931649594 2:64455237-64455259 GTGTGCATGTGGAAGGCTGCTGG + Intronic
932144112 2:69304240-69304262 GGGAGGAGGAGGCAGGCAGCAGG - Intergenic
932275741 2:70451103-70451125 GATAGCAGAAGGAAGGCAGATGG + Intronic
932355076 2:71061688-71061710 GAGAACTGGAGGAATACTGCTGG + Intergenic
932366409 2:71156224-71156246 GAGAGCAGGTGGAAGGATCAGGG + Intergenic
932720823 2:74138062-74138084 GAGAGCAGGGAGAAGGCATCAGG - Intronic
934068267 2:88360011-88360033 GAGAGCAGGAGGAGAGCCGTGGG + Intergenic
934151505 2:89151926-89151948 GAGACCTGGGGGAAGGCTGTGGG - Intergenic
934215754 2:90029980-90030002 GAGACCTGGGGGAAGGCTGTGGG + Intergenic
934646930 2:96064248-96064270 GAGAGCAGGAGGAGAGCAGGAGG + Intergenic
934731457 2:96661271-96661293 GGGAGAAGGAAGGAGGCTGCAGG + Intergenic
935324739 2:101925823-101925845 CAGAGCAAGAGGAAGGGTGTTGG - Intergenic
935353682 2:102178085-102178107 CAAAGGAGGAGGAAGGGTGCAGG - Exonic
935598722 2:104900525-104900547 GAGAAGAGTAGGAAGGCTGGGGG - Intergenic
935626657 2:105177262-105177284 GAGAGAAGGAGGAAGGAAGGAGG - Intergenic
935689443 2:105717394-105717416 GAAAGCAGGAGGAATGCAGCTGG + Intergenic
935717621 2:105952947-105952969 GAAGGCAGGAGGAAGGGAGCTGG - Intergenic
937446422 2:121962571-121962593 GGAAGAAGGAGGAAGGCAGCTGG + Intergenic
937926685 2:127173273-127173295 GAGAACATGAGGAAGCCAGCTGG - Intergenic
938097971 2:128475621-128475643 GGGAGCAGGAGGAGGGGTGAGGG + Intergenic
938339191 2:130524039-130524061 AAGAGCAAGAGGGAGGCTGGGGG - Intronic
938350646 2:130596711-130596733 AAGAGCAAGAGGGAGGCTGGGGG + Intronic
938531555 2:132192681-132192703 GTGAGCTGAAGGAAGGTTGCTGG - Intronic
939966362 2:148614162-148614184 GAGAGAGGGAGGAAGGCACCAGG - Intergenic
940316788 2:152335399-152335421 GAGAGCATGAGGGAGGCCGGGGG + Exonic
940694326 2:156959673-156959695 GAGCACAGGAGGGAGGCTGAGGG - Intergenic
942181876 2:173387946-173387968 CAGAGCAGAAGGGAGGCTGGGGG + Intergenic
942570965 2:177313843-177313865 AAGAGCTGGAAGAAGGCTGAGGG - Intronic
942961038 2:181829930-181829952 GAGAGAAGGAGGAGGGCTCTTGG - Intergenic
943783391 2:191849471-191849493 GAGAGTAGAAGCAAAGCTGCAGG + Intergenic
943792387 2:191948053-191948075 GAGAGTTGCAGGAAGGCTGTGGG + Intergenic
943859268 2:192838807-192838829 GAGAGAAGGAATAAGGCTTCTGG + Intergenic
943932125 2:193868001-193868023 GAGCACATGAGGAAGGCTGATGG + Intergenic
944087827 2:195869727-195869749 GAGAGCAGGAGGCAGCCTGAGGG + Intronic
944235237 2:197436275-197436297 GAAAGAGGGAGCAAGGCTGCAGG - Intergenic
946001413 2:216485622-216485644 GGGAGCAGGGGGAAGGGAGCAGG - Intergenic
946253727 2:218429095-218429117 GAAACCAGGGGGAAGGCAGCTGG - Intronic
946556565 2:220865033-220865055 GAAAGCAGCAGGAATGCTTCTGG + Intergenic
947606357 2:231488541-231488563 GAGGACAGGAGGTAGGATGCTGG + Intergenic
947816087 2:233038127-233038149 CACAGCAAGAGGGAGGCTGCTGG + Intergenic
948003604 2:234589442-234589464 GAGAGTAGGATGATGGTTGCAGG - Intergenic
948099089 2:235359461-235359483 GTGCCCAGGAGGAGGGCTGCTGG - Intergenic
948233218 2:236366794-236366816 GAGAGGAGGAGGAAGGAGGGAGG - Intronic
948384478 2:237573009-237573031 GAGAGCAGAAGGAAGCCCGGAGG + Intergenic
948417564 2:237824649-237824671 TAGAGCAAGAGGAAGAATGCGGG - Intronic
948934758 2:241156104-241156126 GAGAGGAGGAGCCAGGCTGGAGG + Intronic
948947616 2:241229048-241229070 GACAGCAGGAGGCAGGTTCCTGG - Exonic
1168895644 20:1321571-1321593 GAGAGCAGCAGGACGGCAGGAGG - Intronic
1169357768 20:4922367-4922389 GACAGCAGGATGAAGGCAGGGGG + Intronic
1169777669 20:9273907-9273929 AAGAACAGGAGGAAGACTGCTGG + Intronic
1170794413 20:19533855-19533877 GACAGCTGGGGGAAGGCAGCTGG - Intronic
1171161082 20:22924420-22924442 GGGAGCAGGAGGTAGGAAGCAGG + Intergenic
1171562145 20:26135548-26135570 TAGAGCAGTAGGAGGGCGGCGGG - Intergenic
1171778034 20:29389059-29389081 GAGAGAAGGAGGAGGGCAGAGGG - Intergenic
1172071634 20:32261630-32261652 GAGACCAAGGGGAAGGCTGCTGG - Intergenic
1172785465 20:37465465-37465487 GAGAAGAGGAGGAAGGAGGCGGG - Intergenic
1173153194 20:40585311-40585333 CTGAGCAGGAGGTGGGCTGCTGG - Intergenic
1173202055 20:40961486-40961508 GATGGCAGGGGGAAGGCTGAGGG - Intergenic
1173475180 20:43353660-43353682 GTGAGCAGAAGAATGGCTGCCGG + Intergenic
1173792141 20:45834471-45834493 GAGTGCAGGAGGACGGAGGCGGG + Intronic
1173837429 20:46135041-46135063 GAAAGCAGGAAGGAGGGTGCGGG - Intergenic
1173885755 20:46457614-46457636 GTGGGCAGGAGGCCGGCTGCGGG - Intergenic
1174417098 20:50374732-50374754 GAGAGCAGGGAGGAGGCAGCAGG - Intergenic
1175172018 20:57087284-57087306 AAGGGCAGGAGCAAGGCCGCAGG - Intergenic
1175199284 20:57266709-57266731 GAGGGCAGGTGGGAGGCCGCCGG - Intergenic
1175445335 20:59015915-59015937 GTGAGCAGGATCCAGGCTGCTGG - Intergenic
1175480005 20:59304048-59304070 GAGGGCAGGAGGAAGTTTGGAGG - Intronic
1175636858 20:60591662-60591684 GAGAGCAGGCTGGGGGCTGCAGG + Intergenic
1175877885 20:62238868-62238890 GACCGCAGGGGGAAGGGTGCGGG - Intronic
1175946232 20:62560129-62560151 CAGAGCAGGGGGCAGGCTGGGGG - Intronic
1176423789 21:6535411-6535433 GGGAGCCGGAGGGAGGCAGCTGG - Intergenic
1176764905 21:13006749-13006771 GTGAGCTGAAGGAAGGTTGCTGG + Intergenic
1178617160 21:34144496-34144518 GAGAGCATTAGGAAGGAGGCTGG + Intergenic
1179023509 21:37660023-37660045 GAGAGCTGCAGGAATGCTGGAGG + Intronic
1179111407 21:38448968-38448990 AAGAGGAGGAGCCAGGCTGCAGG - Intronic
1179197426 21:39178540-39178562 GAAAGGAGAAGGAAGGCTGCCGG + Exonic
1179580315 21:42339125-42339147 GTGAGCAGGTGGAATGCTGAGGG + Intergenic
1179591642 21:42413065-42413087 GAGAGCTGGAGACAGGCTCCTGG + Exonic
1179699282 21:43143726-43143748 GGGAGCCGGAGGGAGGCAGCTGG - Intergenic
1180229901 21:46421021-46421043 GAGAGCAGCATGAAGGCCTCAGG - Intronic
1180429480 22:15233208-15233230 GTGAGCTGAAGGAAGGTTGCTGG + Intergenic
1180512091 22:16101542-16101564 GTGAGCTGAAGGAAGGTTGCTGG + Intergenic
1181293806 22:21818929-21818951 GAGGGGAGGCTGAAGGCTGCAGG + Intronic
1181671924 22:24429601-24429623 CACAGCAGCAGGAAGGCTCCTGG - Intronic
1181681193 22:24496851-24496873 GAGGACAGCAGGAAGTCTGCTGG + Intronic
1181737293 22:24892087-24892109 GAGACCTGGATGGAGGCTGCTGG + Intronic
1182476740 22:30580672-30580694 CAGCGCAGGAGGAAGACCGCAGG - Exonic
1182680729 22:32077416-32077438 GAGAGTAGGGGGAAGGATGGAGG - Intronic
1182697637 22:32207309-32207331 CAGAGCAGTAGGAGGGCGGCTGG + Intergenic
1182767158 22:32765707-32765729 AAGGGGAGGAGGAAGGCTGGGGG + Intronic
1183259930 22:36788134-36788156 GGGAGAAGGAGGAAGGCAGAAGG + Intergenic
1183279010 22:36922373-36922395 GGGAGCAGGAGGAGGGCTGGCGG - Intronic
1183279133 22:36922833-36922855 GAGAGGAGGTGGGAGGTTGCAGG + Intronic
1183333225 22:37232440-37232462 GAGAGGTGGAGGATGCCTGCAGG - Intronic
1183732714 22:39627719-39627741 GAGAGCAGAAGGAAAGCTACTGG + Intronic
1183786018 22:40029683-40029705 GAGGCCAGGACGGAGGCTGCAGG - Exonic
1184254755 22:43280580-43280602 GGTAGCAGGAGGATGTCTGCAGG - Intronic
1184388073 22:44187571-44187593 GAGAGAAGCAGGGAGTCTGCAGG + Intronic
1184479519 22:44738418-44738440 GCGAGCGCGTGGAAGGCTGCGGG - Intronic
1184489204 22:44799503-44799525 AAGAACTGAAGGAAGGCTGCTGG + Intronic
1184768484 22:46584880-46584902 GGAAGGAGGAGAAAGGCTGCCGG + Intronic
1184847909 22:47100370-47100392 GAGCACAGGAGTAAGGCTGTGGG + Intronic
949828223 3:8185420-8185442 GTGAGCAGGAGGAGGCCTGAGGG - Intergenic
950046061 3:9949270-9949292 CTCAGCAGGAGGAAGGCTTCTGG + Exonic
950094015 3:10317697-10317719 GACAGCAGGAGGAAGACAGGTGG + Intronic
950183984 3:10933869-10933891 AAGAGCAGCAGGAGGGATGCTGG - Intronic
950290382 3:11779323-11779345 GAGAGGAGGAGGAAGGTGCCAGG + Intergenic
950553454 3:13681444-13681466 GAGCTCAGGAGGGAGGCTGGGGG + Intergenic
950566184 3:13771028-13771050 GTGAGCAGGAGGGAGACTGGAGG - Intergenic
950737819 3:15024893-15024915 CAGATGAGGAGGAAGCCTGCAGG - Intronic
950895822 3:16449941-16449963 AGCAGCAGGAGGAGGGCTGCAGG + Intronic
951508937 3:23480155-23480177 GAGTGCAGGAGGGAGGCCGGGGG - Intronic
952067376 3:29587292-29587314 GAGATCAGGAGGAAGGAAGAAGG + Intronic
952069536 3:29617475-29617497 AGGAGCATGAGGAAGGCTTCTGG + Intronic
953867437 3:46596361-46596383 GAGAAGAGGAGGAGGCCTGCAGG - Intronic
954036974 3:47856093-47856115 GAGACCAAGGGGAAGGGTGCGGG + Intronic
954273234 3:49525524-49525546 CGGAACAGGAGGAAGGCTGGGGG + Intronic
954628035 3:52033378-52033400 GAGAGCAGGGAGAGGGGTGCAGG - Intergenic
954806268 3:53222713-53222735 GAGAGGAGGGTGAAGGCTGTTGG - Intergenic
956170247 3:66427769-66427791 GACAGGAGGAGGGAGGCTTCTGG - Intronic
956768557 3:72505300-72505322 AGGAGAAGGAGGAAGGCAGCAGG + Intergenic
957170885 3:76735435-76735457 TAGAGGGGGAGGAAGGCAGCGGG + Intronic
957354409 3:79062828-79062850 GTCAGCAGGTGGAAGGCTGGAGG + Intronic
959583028 3:108001383-108001405 GAGAGCAGGAGGCAGGTAGAGGG - Intergenic
960951973 3:123005182-123005204 GACAGGTGGAGGAAGGCTGTGGG - Intronic
961317816 3:126052483-126052505 GAGAGCAGGAGGAAGGCTGCTGG - Intronic
962403396 3:135080328-135080350 GAGAGAAGGGGGAGGGGTGCAGG + Intronic
962554514 3:136533571-136533593 GAGAGAAGGAGCAAGGGGGCAGG + Intronic
963336400 3:143978795-143978817 GAGAGTGGGAGGAAGGGTGGAGG + Intronic
964620708 3:158717722-158717744 CAGAGCAGGAGGCTGGCTGAGGG + Intronic
964831846 3:160892313-160892335 GAGAGCAGGAGCAAGGCTGGGGG + Intronic
967213977 3:187194500-187194522 GAGGGCAGGAGGTAGGATGGAGG - Intergenic
967933062 3:194704537-194704559 GACATGAGGATGAAGGCTGCTGG + Intergenic
967947076 3:194812461-194812483 GAGATCATGAGGAAAGATGCAGG + Intergenic
967972251 3:195007773-195007795 GAAGGAAGGAGGAAGGCTGGGGG + Intergenic
968489989 4:884791-884813 CAGAGCAGGCCGGAGGCTGCGGG + Intronic
968728984 4:2261053-2261075 GGGAGGAGGGGGCAGGCTGCAGG - Intronic
968938075 4:3624051-3624073 GAGGGGAGTGGGAAGGCTGCGGG - Intergenic
969054427 4:4392762-4392784 GGGAGCAGGCAGAGGGCTGCTGG - Intronic
969249010 4:5955030-5955052 GAGCTCAGGAGGAAGACAGCAGG - Intronic
969288735 4:6225019-6225041 GAGACAAAGGGGAAGGCTGCAGG - Intergenic
969619686 4:8272845-8272867 GAGTGCAGGTGGGAGGCTGCTGG + Intronic
969687351 4:8683088-8683110 AGGAGCAAGAGGAGGGCTGCTGG + Intergenic
969694306 4:8726001-8726023 GAGTGCAGGAGGGAGGCCGTTGG + Intergenic
971105263 4:23517563-23517585 GAGAGCAAGAGGCAGGCTCTTGG - Intergenic
972379826 4:38509442-38509464 GAGAGGAGAAGGAACGCTGGAGG + Intergenic
972578364 4:40372818-40372840 GAGAACAGGAGGAAGGTTTAGGG - Intergenic
972697819 4:41465143-41465165 GCCAGCAGGAGAAAGACTGCTGG - Intronic
975521438 4:75305844-75305866 GAGAGAAGGAAGGATGCTGCAGG + Intergenic
975673107 4:76801711-76801733 GACAACAGGAGGAGGGCTGTTGG + Intergenic
975835638 4:78419827-78419849 CAGAGCAGGAGGAAAGCGGGTGG + Intronic
976014991 4:80542151-80542173 GAGAGCCGCTGGGAGGCTGCTGG - Intronic
976068076 4:81212879-81212901 GTGAGTAGGAGGAACACTGCAGG + Intronic
976097863 4:81528248-81528270 GAGTACAGGAGGAAAGCTGAGGG - Intronic
976378398 4:84371692-84371714 GAGATCAGGAGTCAGACTGCCGG + Intergenic
977423494 4:96834655-96834677 GAGAGCAGCAAAAAGACTGCAGG + Intergenic
978347230 4:107784445-107784467 CACAGCAGGAGGTAGGCTGCAGG + Intergenic
978354662 4:107858660-107858682 GATAGCAGCAGCAAAGCTGCAGG - Intronic
979665090 4:123302652-123302674 CAGAGCAGGACCAAGGCTGCAGG + Intronic
979786573 4:124722348-124722370 GAGAGCAAGAGGAAGACTGAGGG - Intergenic
979967777 4:127096407-127096429 AAGAGCAGGAGCAAGGCTGGTGG + Intergenic
981093498 4:140756387-140756409 AAGAGGAGGAGGAAGGGAGCGGG + Intergenic
981227777 4:142317206-142317228 GAGTTCAGGGGGAAGGGTGCAGG + Intronic
981784500 4:148462169-148462191 CACAGCAGGAGGTAGGCAGCGGG + Intergenic
981837581 4:149073021-149073043 GAGAGCAGGAGAAAGGGAGATGG + Intergenic
982227020 4:153175561-153175583 AATAGCAGGAGGAAGGCGGATGG + Intronic
982567834 4:157009056-157009078 GAGAGCAGGAAGAAGGATGAGGG + Intergenic
982678118 4:158399526-158399548 AAGAGCAGGAGGCAGGCTGAAGG - Intronic
982771559 4:159401472-159401494 GTGAGCAGCAGGAAGCCTTCAGG - Intergenic
982868459 4:160546694-160546716 GAGAGGAGGAGGAAGGCAGATGG - Intergenic
983228584 4:165107816-165107838 GAGTGCAGTAGGAATGATGCTGG - Intronic
983238475 4:165206513-165206535 GAGGTCAGGAGGACGGCGGCAGG - Intronic
983676690 4:170302842-170302864 GAGAACAGGAGGTAGGGTGCTGG + Intergenic
984179506 4:176464321-176464343 GGGAGCAGGAGGATGGTTTCGGG + Intergenic
984480679 4:180297421-180297443 GAGAGCAGAGGGAGGGCTCCGGG + Intergenic
984667374 4:182443560-182443582 GAGAGCAGGAGAGAGGCAGGAGG - Intronic
985320890 4:188709635-188709657 GAGAACAGGAGGAAAGAAGCTGG + Intergenic
985573988 5:665304-665326 AGGAGCAGGAGGAAGGGGGCAGG + Intronic
985704094 5:1390636-1390658 AGGAGCAGCAGTAAGGCTGCAGG + Intergenic
985994856 5:3592260-3592282 GAGCGCAGGGGGCAGGCTGTGGG - Intergenic
986018358 5:3777956-3777978 TAGAGCATGAGGTATGCTGCTGG + Intergenic
986062996 5:4209338-4209360 GGGAGAAGGATGATGGCTGCCGG + Intergenic
986212783 5:5689922-5689944 TAGGGCAGGAGGGAGCCTGCAGG + Intergenic
986295969 5:6438907-6438929 GAGAGCAGTATGAGGGCTTCAGG - Intergenic
986566777 5:9123505-9123527 GAGAGGAGGAGGAAGAGTGAAGG + Intronic
987136755 5:14906936-14906958 CAGAGCAGGAGTAAGACAGCGGG - Intergenic
988470683 5:31534039-31534061 GGGGGCAGCAGGAAGGCCGCTGG + Intronic
988656334 5:33215907-33215929 GAGAGCAGGAGCAAGGGTGAGGG + Intergenic
988791895 5:34616115-34616137 GAGAGAGGGAGGGAGACTGCTGG + Intergenic
989165943 5:38433676-38433698 GAGGAAAGGAGGAAGGATGCAGG - Intronic
989549913 5:42722367-42722389 TACAGCAGGAGGCAGGATGCAGG + Intergenic
990144041 5:52738471-52738493 GAGAGCATGAGAAAGTCTGTAGG - Intergenic
990566657 5:57036539-57036561 AAGAGCAGGAGTAAAGCTCCAGG + Intergenic
990789481 5:59460838-59460860 GAGAGCAAGAGGCATGATGCAGG + Intronic
990822433 5:59857858-59857880 GAGAGCAGAAGGAAGGAAGGTGG + Intronic
990845123 5:60128576-60128598 GTGACCAGGTGGAAGGCAGCTGG + Intronic
991009701 5:61870268-61870290 GAGAGGAGGAGGGAGGCTGCTGG - Intergenic
991133033 5:63147930-63147952 GAGAGCATAAGGATGGCTTCTGG + Intergenic
991238418 5:64426806-64426828 GAGAGCAGAAGGATGGCTAAAGG + Intergenic
992312176 5:75511747-75511769 GAGAGCCGGAGGTAGGGTTCGGG - Exonic
992797578 5:80266783-80266805 AAAAGCAGGTGGGAGGCTGCAGG - Intergenic
993520065 5:88889509-88889531 GCGAGCAGGAGGCAGGCTCTGGG + Intronic
993852074 5:93023173-93023195 GAGAGCAGCAGGAAGGAGGCAGG - Intergenic
993859988 5:93124418-93124440 CAGAGCAGGAGGTGAGCTGCCGG + Intergenic
994546867 5:101177645-101177667 CAGAGCAGGAGGAAGGTGGGTGG - Intergenic
995356553 5:111243692-111243714 GAGAGGATGAGGAAGGATTCAGG + Intronic
996713733 5:126569056-126569078 CACAGCAGGAGGTAGGCAGCAGG + Intronic
997300177 5:132797980-132798002 GAGAGCAGGAGGAATTCAGGAGG + Intronic
997346333 5:133195151-133195173 GGGAGTCGGAGGGAGGCTGCGGG + Intergenic
997564134 5:134874359-134874381 GCCAGCCGGAGGAAGGCTGGGGG - Exonic
998205280 5:140153199-140153221 GAGAGGAGGAGGGAGGGGGCTGG - Intergenic
998267518 5:140677281-140677303 GAGGGCAGTGGGACGGCTGCTGG + Intronic
998618815 5:143771853-143771875 GGGAGGAGGAGGAAGGGAGCAGG + Intergenic
999182940 5:149682834-149682856 CAGAGCAGGAGGGAGGCTGAGGG + Intergenic
999383415 5:151137689-151137711 GGGAGCAGGAGCAAGGCGGGAGG - Intronic
999906806 5:156149974-156149996 GAGAGAACAAGGATGGCTGCAGG - Intronic
999928589 5:156406361-156406383 GAGTGCACAAGGATGGCTGCAGG - Intronic
1000736949 5:164915420-164915442 GAGAGTAGGAGGAAGGATATGGG + Intergenic
1001097935 5:168790322-168790344 GAGAGCAAGAGGGATGCTGTGGG + Intronic
1001244788 5:170098086-170098108 GAAACCAGGAGGAAGGCTTTTGG + Intergenic
1001254841 5:170175692-170175714 GAGAGCAGGAGCAAAGGTGAGGG + Intergenic
1001588389 5:172849005-172849027 CAGAACAGGAGTAAGGCAGCCGG + Intronic
1001684515 5:173583528-173583550 TAGCCCAGGAGGAAGGCAGCTGG + Intergenic
1001786649 5:174419331-174419353 GAAAGAAGGAGAAAGGATGCTGG - Intergenic
1001965690 5:175908528-175908550 GGGTGCAGGAGGACGGCTGGGGG - Intergenic
1002160339 5:177311070-177311092 GAGAAGAGGAGGAAGCCAGCGGG + Intronic
1002251255 5:177930667-177930689 GGGTGCAGGAGGACGGCTGGGGG + Intergenic
1002619970 5:180481261-180481283 GGGAGCTGCAGGAAGGCTGGTGG - Intergenic
1003263233 6:4543166-4543188 GGGATGAGGAGGAAAGCTGCTGG + Intergenic
1003438942 6:6121940-6121962 GAGCACAGGAGGGAGGCTGGGGG + Intergenic
1003773631 6:9335715-9335737 GAGAGGAGGAGGGAGGGAGCTGG - Intergenic
1004284805 6:14311364-14311386 GAGAGCAGCAGGTGGGGTGCTGG + Intergenic
1004328112 6:14695668-14695690 GAGAGGAGGTGGAGGGGTGCTGG - Intergenic
1005083454 6:21980596-21980618 CAGAGCAGGAAGAAGGAGGCAGG - Intergenic
1006017566 6:31094447-31094469 GAGAGCAGGAGCAGGGGTGAGGG + Intergenic
1006303741 6:33207310-33207332 GAGAGCAGGAGGGAGGGGGCTGG + Intergenic
1006446299 6:34081648-34081670 GAGAGTGGGACGCAGGCTGCTGG + Intronic
1006449017 6:34095321-34095343 GAGCTGAGGAGGGAGGCTGCGGG - Intronic
1006574129 6:35031523-35031545 GGGAGGAGGAGGAAGGGTTCTGG - Intronic
1006793481 6:36718130-36718152 GTGGGAAGGAGGCAGGCTGCCGG - Intronic
1007248300 6:40478124-40478146 GAGAGGAAGAGGATGGCAGCAGG - Intronic
1007941377 6:45784827-45784849 GAAAGAAGGAGGAAGGAAGCAGG - Intergenic
1007957909 6:45933928-45933950 CAGAGCAGCAGGAAGTCAGCAGG + Intronic
1007959781 6:45948268-45948290 GAGAGGAGTAGGAAGGGTTCAGG - Intronic
1008013672 6:46493533-46493555 GAGAGCAGGAGTGAGGCTAAAGG + Intergenic
1008453152 6:51676045-51676067 CAGAGGAGGAGGAAGGAGGCAGG + Intronic
1009870996 6:69451867-69451889 CAGAGGAGGAGGAAGGCCGGGGG - Intergenic
1011084900 6:83529037-83529059 GAGCCCAGGAGGAAGGCTTCAGG - Intergenic
1011322258 6:86108670-86108692 GAGAGCAGAAGGAGTGGTGCTGG + Intergenic
1011502525 6:88006853-88006875 GGCAGCAGGAGGAAGGTTCCCGG + Intergenic
1011855717 6:91688373-91688395 GAGGGAAGGAGGAAAGCTTCAGG - Intergenic
1012533556 6:100268065-100268087 GAGAGGAAAAGGAAGGCTGGTGG - Intergenic
1013006644 6:106080422-106080444 GGGAGGAGAAGGAAGGATGCTGG - Intergenic
1013545342 6:111151533-111151555 GAGATTGGGAGGAAGGCAGCTGG - Intronic
1014141780 6:117952005-117952027 CACAGCATGAGGCAGGCTGCCGG - Intronic
1015141592 6:129940475-129940497 TAGAGCAGGAGGAAGGCTCTGGG - Intergenic
1016824682 6:148377266-148377288 GAGACCAGGAGGAATGCCACTGG - Intronic
1016995923 6:149962585-149962607 GGGAACAGGAGGAAGGCAGAAGG - Intergenic
1017002660 6:150006583-150006605 GGGAACAGGAGGAAGGCAGAAGG + Intergenic
1017638766 6:156469806-156469828 GAGAACAGGGGAAAGGCTTCAGG + Intergenic
1017753407 6:157509906-157509928 GAGAGCAGAGTGGAGGCTGCAGG - Intronic
1018008631 6:159647677-159647699 GAGAGAAGGAAGAAGGATGGAGG + Intergenic
1018578903 6:165290440-165290462 CACAGCAGGAGGAAGGCTCAGGG + Intronic
1018608379 6:165622960-165622982 AAGAGCAGGAGTAAGGGTGGGGG - Intronic
1018735490 6:166684627-166684649 GAGAGCAGGGTGAAGGCTTGAGG - Intronic
1018916654 6:168136541-168136563 CAGAGCATGGGGAAGGTTGCAGG + Intergenic
1019013337 6:168860904-168860926 GAGAGGAGGAGGCAGGATGGAGG + Intergenic
1019127752 6:169852264-169852286 GAGAGCCGGCGGGAGGCAGCCGG - Intergenic
1019388930 7:774400-774422 GAGAGCGGGAGCCAGGCCGCGGG + Intronic
1019419099 7:942457-942479 GAGAGGAGGAGGAAGGGAGGAGG + Intronic
1019419140 7:942618-942640 GAGAGGAGGAGGAAGGGAGGAGG + Intronic
1019419156 7:942677-942699 GAGAGGAGGAGGAAGGGAGGAGG + Intronic
1019419175 7:942745-942767 GAGAGGAGGAGGAAGGGAGGAGG + Intronic
1019419191 7:942804-942826 GAGAGGAGGAGGAAGGGAGGAGG + Intronic
1019419205 7:942854-942876 GAGAGGAGGAGGAAGGGAGGAGG + Intronic
1019419244 7:943013-943035 GAGAGGAGGAGGAAGGGAGGAGG + Intronic
1019419325 7:943328-943350 GAGAGGAGGAGGAAGGGAGGAGG + Intronic
1019419378 7:943530-943552 GAGAGGAGGAGGAAGGGAGGAGG + Intronic
1019419443 7:943774-943796 GAGAGGAGGAGGAAGGGAGGAGG + Intronic
1019419457 7:943824-943846 GAGAGGAGGAGGAAGGGAGGAGG + Intronic
1019757966 7:2787446-2787468 GAGTGCAGCAGGGAGGCTGACGG - Intronic
1019918120 7:4146113-4146135 GAGAGCAGGTGTGAGGCTGAAGG - Intronic
1019918123 7:4146162-4146184 GAGAGCAGGTGTGAGGCTGAAGG - Intronic
1019918141 7:4146507-4146529 GAGAGCAGGTGTGAGGCTGAAGG - Intronic
1020113414 7:5461056-5461078 GACACCAGGAGAAAGGCTGGCGG - Intronic
1020210444 7:6154456-6154478 GAGAGCAGGAGCAAGACTGAGGG + Exonic
1020952066 7:14692293-14692315 GAGAGAAGGAGGGAAGATGCAGG - Intronic
1021123311 7:16821432-16821454 GACAGCAGGAGGGAAGCTGATGG + Intronic
1021758770 7:23882629-23882651 CAGAGCAGGAGGAAGGTGGAGGG + Intergenic
1021799234 7:24287455-24287477 GAGTGCAGGGGGAATGCTGGTGG - Intronic
1021877596 7:25063119-25063141 GACAGCAGGAGGTGAGCTGCGGG + Intergenic
1021932960 7:25599703-25599725 GAGGGGAGGAGGAAGGCCCCTGG + Intergenic
1022045429 7:26618763-26618785 GAGAGCAGAGGGAAAGCTGAAGG + Intergenic
1022192600 7:28031479-28031501 GAGAGCAGGAGGAATGTAGCTGG + Intronic
1022476748 7:30716036-30716058 GAGAGGAGGAGGACGCCTGAGGG - Intronic
1022494637 7:30845116-30845138 GAGGCCAGGAGGAAGGCTGAGGG + Intronic
1022532112 7:31073646-31073668 GAGAGGAGGTGGGAGCCTGCTGG + Intronic
1022570737 7:31451138-31451160 CAGAGCAGGAATAAGGGTGCTGG - Intergenic
1022800520 7:33772636-33772658 CAGAGGAGGAGGAAGGGTGGAGG - Intergenic
1022844079 7:34192398-34192420 GAGAGAAGGAGGAAGTTTGAAGG - Intergenic
1023184204 7:37516156-37516178 GAGAGGAGGAGAAAGGGTGAGGG + Intergenic
1023387223 7:39671137-39671159 AAGAACAGGTGGAAGGCTACAGG - Intronic
1023853328 7:44163020-44163042 CAGAGCATGAGTAAGGGTGCAGG + Intronic
1024059814 7:45689481-45689503 GAGAGCAGGAGCAAGGGGGTGGG + Intronic
1024300887 7:47886638-47886660 GAGAGAAGGAGTGAGGCGGCAGG - Intronic
1024627580 7:51221171-51221193 CAGAGCGGGAGGGAGGCAGCGGG - Intronic
1024759377 7:52576187-52576209 CAGAGAACCAGGAAGGCTGCTGG - Intergenic
1024971768 7:55078179-55078201 GGGAGAAGGAGCAAGGCGGCAGG + Intronic
1025078395 7:55962847-55962869 GAGGGCAGGAGGAAGGAAGCTGG - Intronic
1025253543 7:57367807-57367829 GAGAGCAGGGGGGAGGCAGTAGG + Intergenic
1025258159 7:57399307-57399329 GAGAGGAGGGGGAGGGCTGGGGG + Intergenic
1025709024 7:63890868-63890890 GAGAGGAGGAGGAGGGCTGAAGG + Intergenic
1026837883 7:73650133-73650155 GAGCGCAGGGGGAAGGCCGGGGG + Intergenic
1026980068 7:74521175-74521197 GAGAGAAGGAAGAAGGTTCCAGG - Intronic
1027187591 7:75981356-75981378 CAGAGCATCAGGAAGGCTCCAGG - Intronic
1027727000 7:81819354-81819376 GAGAGCATGTGGAATGATGCTGG - Intergenic
1028814894 7:95132578-95132600 GTGAGCAGGAGGGAGGATTCCGG + Intronic
1029055033 7:97732758-97732780 GAGCCCAGGAAGAAGGGTGCGGG - Intronic
1029477326 7:100792697-100792719 CAGAGAAGGAGCCAGGCTGCCGG - Intronic
1029906501 7:104098637-104098659 GGAAGCAGGTGGAAGGCGGCAGG + Intergenic
1030277993 7:107740379-107740401 CAGAAAAGAAGGAAGGCTGCAGG + Intergenic
1030857385 7:114577624-114577646 GAGATCAGGAGGAAGTCTGGTGG - Intronic
1031449086 7:121891916-121891938 GGGAGCTGGAAGAAAGCTGCTGG - Intronic
1031777027 7:125918015-125918037 AAGAGCAGGAGGAAGGATAAGGG - Intergenic
1031924031 7:127621012-127621034 GCGACCAGGAGGAAGCCTGTGGG + Intergenic
1031973412 7:128079365-128079387 GAGGGGAGGAGGCAGGCAGCAGG - Intronic
1032433267 7:131880137-131880159 GGGAGCAGGAGGAGGGCTGCAGG + Intergenic
1032782471 7:135175031-135175053 GATACCAGGAGGAAGGTGGCAGG - Intergenic
1032991955 7:137403546-137403568 GGGCTCAGGAGTAAGGCTGCAGG + Intronic
1033121279 7:138668796-138668818 GGGAGCAGGAGGAATTCTTCTGG + Intronic
1033423352 7:141221747-141221769 GAGGGCAGCAGGAAGGTGGCTGG + Intronic
1033705533 7:143882479-143882501 GAGAGGAGGAGCAATGCGGCAGG + Intronic
1033826670 7:145199551-145199573 AAGAGCGGGAGGAAGGGTGCAGG - Intergenic
1034263321 7:149770379-149770401 GAGGGCAGGAGGAAAGCAGGGGG + Intronic
1034422043 7:150995573-150995595 GGGAGAGGGAGGAAGGGTGCAGG - Intronic
1034422184 7:150995926-150995948 GGGAGAGGGAGGAAGGGTGCAGG - Intronic
1034422196 7:150995958-150995980 GGGAGAGGGAGGAAGGGTGCAGG - Intronic
1034422262 7:150996124-150996146 GGGAGAAGGAGGAGGGGTGCAGG - Intronic
1034422287 7:150996189-150996211 GGGAGAAGGAGGAAGGGTACAGG - Intronic
1034900583 7:154905837-154905859 GGGATCAGGAGGGAGGGTGCAGG + Intergenic
1035246996 7:157569093-157569115 GAGAGGGGGAGGAAGGACGCGGG + Intronic
1035285315 7:157802258-157802280 GAGAGGAGGATGGAGGCTGCCGG - Intronic
1035386938 7:158479339-158479361 GAGAGAGGGAGGGAGGCTGTCGG - Intronic
1035451496 7:158980022-158980044 GAGCTCAGGAGGAAGCCTGCAGG + Intergenic
1035565438 8:637709-637731 GGGAGCAGGAGGAAAGCTGGGGG + Intronic
1036692403 8:10952088-10952110 GAGAGGGGCAGGAGGGCTGCAGG - Intronic
1037333231 8:17765250-17765272 CACAGCAGGAGGTAGGCTTCAGG - Intronic
1037451678 8:19022080-19022102 GAGAGCAGGAGAAGGGTTGGGGG + Intronic
1037598595 8:20374659-20374681 GAGAGCAGGGAGAAGGAGGCAGG - Intergenic
1037612107 8:20484458-20484480 GTCAGCAGGGGGAAGGCTGAAGG - Intergenic
1037774468 8:21823819-21823841 GAGAGGAAGAGGAAAGGTGCAGG + Intergenic
1038114971 8:24543571-24543593 GAGAGCAAGAGAAAGTTTGCTGG - Intergenic
1038350821 8:26774808-26774830 GAGAGCAGGAGGAGGGTTTGGGG - Intronic
1038376042 8:27041488-27041510 CAGAGCAGGAGGAAGTGTGGGGG - Intergenic
1038515886 8:28187411-28187433 GAGAACAGAATGAAGGCTCCAGG - Intronic
1038729778 8:30116562-30116584 CAGAGCAGGAGGTAAGCAGCTGG - Intronic
1039048504 8:33472283-33472305 GGGAGCAGGGGGCAGGCTGTTGG + Intronic
1039280310 8:35977203-35977225 TAGAGCAGGAAGATGGCTGAGGG + Intergenic
1039391090 8:37181209-37181231 GAGAGGAGGAGGAAGGCAAGGGG + Intergenic
1039838984 8:41280145-41280167 GAGTGCAGGGGGAGGGCTGACGG + Intronic
1040301433 8:46189993-46190015 GAGAGAAGGCGCAAGACTGCAGG + Intergenic
1040383944 8:46900670-46900692 GAGACCAGGAGGAAGGTGGTGGG + Intergenic
1040818159 8:51530403-51530425 GAGAGAAGGAGGAAGACTAGAGG - Intronic
1040877816 8:52171185-52171207 AAGAGCAGGGGGAATGCTCCAGG + Intronic
1041215529 8:55596382-55596404 CAGGGCAGGAGGAAGGAGGCAGG - Intergenic
1041609913 8:59833516-59833538 GAGGGCAGTTGGAAGGCTACTGG + Intergenic
1042783747 8:72523139-72523161 CACAGCAGGAGGTAAGCTGCAGG - Intergenic
1043011246 8:74884388-74884410 GAGATGAAGAGGAAGGCTGAGGG - Intergenic
1045109437 8:98926206-98926228 GAGAGCAGCTGGAACTCTGCAGG + Intronic
1045510011 8:102806697-102806719 GAGCGAGGGAGGAAGGGTGCGGG + Intergenic
1045796797 8:106055853-106055875 AAAAGCAAAAGGAAGGCTGCTGG - Intergenic
1045987403 8:108264567-108264589 GAGAGCAGGAGGAAGGTGGCAGG - Intronic
1046520672 8:115321053-115321075 TAGAGCAGGAAGAAGGGGGCTGG - Intergenic
1047426109 8:124748453-124748475 AAGAGCAGGAGGAAGGTGGGTGG + Intergenic
1047818857 8:128495948-128495970 GAGTGTAGGAGGTAGGCTGAAGG - Intergenic
1048165925 8:132061379-132061401 GAGAGAAGGAGGAAGGGAGAGGG - Intronic
1048317914 8:133375563-133375585 GAGGGCAGTGGGAAGGCTGAAGG + Intergenic
1048581908 8:135735821-135735843 GAAAGCACAGGGAAGGCTGCTGG - Intergenic
1049000007 8:139819024-139819046 GAGAGCAGGAGGTGAGCGGCGGG + Intronic
1049217142 8:141413385-141413407 GGGCCCAGGAGGAAGGCAGCAGG + Intronic
1049306463 8:141906823-141906845 TGGAGCAGGAGGAAGGCTGAGGG - Intergenic
1049306474 8:141906865-141906887 TGGAGCAGGAGGAAGGCTGAGGG - Intergenic
1049306487 8:141906907-141906929 TGGAGCAGGAGGAAGGCCGAAGG - Intergenic
1049420337 8:142513627-142513649 GTGGAAAGGAGGAAGGCTGCGGG + Intronic
1049596308 8:143485184-143485206 GAGAACAGGAGGGAGGCAGGCGG + Intronic
1049770178 8:144376406-144376428 GTGAGCATGAGCAAGGCTGCTGG + Intronic
1049814433 8:144591566-144591588 GGGAGCAGGATGAAGGCTCCGGG + Intronic
1049841284 8:144774410-144774432 GAGAGCAGCAGGGAGTCTGGGGG - Exonic
1050180385 9:2916617-2916639 GGGAGCAGGAGGAAGCTGGCAGG - Intergenic
1050267478 9:3906088-3906110 GGGAGCAAGAGGAAGGGTGCAGG + Intronic
1050305343 9:4300025-4300047 GAGGGAGGGAGGAAGGCAGCCGG + Intronic
1051108479 9:13607956-13607978 GACAGCATTTGGAAGGCTGCTGG + Intergenic
1051845038 9:21442178-21442200 GAGAGCAAGAGGAAGGGTAGGGG - Intergenic
1052300343 9:26946776-26946798 GAGAGCAGAGGGAAGGCTGGGGG + Intronic
1052502004 9:29304026-29304048 TAGAGCAGGAGGAAGAGTGAAGG + Intergenic
1052597078 9:30574827-30574849 GAGAACGTGAGGGAGGCTGCGGG + Intergenic
1052982928 9:34461952-34461974 TAGAGCAGCAGAAAGGCTTCAGG + Intronic
1053347395 9:37387865-37387887 GAGAGGGGCAGGAAGGCTGGGGG - Intergenic
1053435124 9:38069149-38069171 GAGCGACGGAGGAAGGCAGCCGG + Exonic
1053459189 9:38255500-38255522 TAGACCAGGATGAAGGATGCAGG + Intergenic
1053710164 9:40799177-40799199 GTGAGCTGAAGGAAGGTTGCTGG - Intergenic
1054420068 9:64919972-64919994 GTGAGCTGAAGGAAGGTTGCTGG - Intergenic
1054906904 9:70420247-70420269 GAGAGGAGGAGGGAGGCGGCGGG - Intergenic
1054920880 9:70541182-70541204 GAGTGAAGAAGGATGGCTGCAGG + Intronic
1055102250 9:72478179-72478201 GAGAGCAGCAGGAAAGCTGAGGG - Intergenic
1056404821 9:86263404-86263426 GAGAGGAGCAGTAAGGCTGGAGG - Intergenic
1057299134 9:93866291-93866313 GAAGGCAGGAGTGAGGCTGCAGG - Intergenic
1057518143 9:95738658-95738680 AAGGGCAGGAGGAAGGGTGGTGG - Intergenic
1057565079 9:96160193-96160215 GAGAGAAGGAGGAAGGGAGGGGG + Intergenic
1057830135 9:98399942-98399964 GACAGCAGGAGGATCGCTTCAGG + Intronic
1058539105 9:105993414-105993436 GAGCCCAGGAGGAGGGCAGCTGG + Intergenic
1059191843 9:112333871-112333893 GAACGCAGGAGGGAGGCTGGGGG - Intergenic
1059241462 9:112809969-112809991 GAGAGTAGGATGGAGGCTCCTGG + Intronic
1059296557 9:113275871-113275893 GGGCTGAGGAGGAAGGCTGCGGG + Intronic
1059425030 9:114215645-114215667 GAGTGCAGCAGGAAGGATGCAGG + Intronic
1060458436 9:123823744-123823766 GGGAGCAGAAGGAAGTCAGCCGG + Intronic
1061049000 9:128183129-128183151 GAGGGAGGGAGGGAGGCTGCAGG - Intronic
1061257352 9:129460440-129460462 GAGAGCGGGAGGGAGGGAGCGGG - Intergenic
1061371153 9:130198285-130198307 GAGCCCTGGGGGAAGGCTGCTGG + Intronic
1061778835 9:132984208-132984230 GTGAGCAGGAGGAGGACTGGGGG - Intronic
1062140533 9:134955424-134955446 CAGAGCAGAGGGAAGGCAGCTGG + Intergenic
1062501747 9:136854755-136854777 GAGACCAGGAAGGAGCCTGCGGG - Exonic
1185667088 X:1774500-1774522 CAGAGCAGGAGGTGGGCAGCAGG - Intergenic
1186788535 X:12975184-12975206 GACGGCAGGAGGAAGGAGGCAGG - Exonic
1187221326 X:17328974-17328996 GATAGCAGCAGGAAGGCAACAGG - Intergenic
1187409933 X:19042351-19042373 GGGAGCAGGATGAAGGCACCTGG + Intronic
1188041055 X:25369968-25369990 CAGAGCAGGATGCAGTCTGCTGG + Intergenic
1189314196 X:40042173-40042195 GACAGCAGGAAGGAAGCTGCTGG - Intergenic
1189586192 X:42464420-42464442 GAGAGCAGGAGGAAAGGGGTGGG + Intergenic
1189595732 X:42563629-42563651 AAGAGAAGGAGGAAGACAGCAGG + Intergenic
1190437041 X:50435825-50435847 GAGAGCAGGAGGAAAGTGTCAGG + Intronic
1191840749 X:65512228-65512250 GAGAACAGCAGGAAGCCTGCTGG + Intergenic
1192173610 X:68872323-68872345 GAGACCAGCCGGCAGGCTGCAGG + Intergenic
1192496683 X:71620920-71620942 GACAGCAGGAGGTAAGCTGCAGG - Intergenic
1192634397 X:72804131-72804153 GAGAACAGTCGGAAGACTGCTGG - Intronic
1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG + Intronic
1193278506 X:79620467-79620489 CAGAGCAGGAGGTAGGCGGCAGG + Intergenic
1193312132 X:80022405-80022427 GAGAGAAGGAGCAGCGCTGCAGG + Exonic
1194041109 X:88943045-88943067 GAGAGTAGAAGGATGGCTACAGG + Intergenic
1194669183 X:96708908-96708930 GAGAGCAGCAGAGAGGCTTCCGG + Intronic
1194922483 X:99783315-99783337 GAGATCAAGTGGAAGGCTGCGGG - Intergenic
1195915350 X:109930040-109930062 GAGAGAAAGAGGAAGCCTCCAGG + Intergenic
1195920507 X:109978679-109978701 GAGATCAGCTGGAAGGCTGTTGG + Intergenic
1195921628 X:109989611-109989633 AAGAGATGGAGGAAGGCAGCAGG + Intergenic
1196170576 X:112584038-112584060 GAGAGCAGGAGCAAGAGTGAGGG + Intergenic
1196191377 X:112798431-112798453 GAGAGCAGGAGGGATGTAGCGGG + Intronic
1196740103 X:119017212-119017234 GAGAGAAAGAGGAAGGCAGAGGG + Intronic
1196862274 X:120039551-120039573 GAGACCACCAGGAGGGCTGCAGG + Intergenic
1196880828 X:120196793-120196815 GAGACCACCAGGAGGGCTGCAGG - Intergenic
1196950174 X:120869080-120869102 GAGGGCAAGAGCAAGGATGCAGG - Intergenic
1197303241 X:124806832-124806854 GAGAGCAGGAGCAAGGGTGGGGG + Intronic
1197654451 X:129101430-129101452 GAGAGGAGGAGAAAGGCAGAGGG + Intergenic
1197674398 X:129313968-129313990 GAGAGCAGGAGAAAGGTGGGGGG + Intergenic
1197698565 X:129577590-129577612 TAGACCAGCAGGCAGGCTGCTGG + Intronic
1199038104 X:143077846-143077868 GAGAGCAGGAGCAAGGTGGGAGG + Intergenic
1199289374 X:146089292-146089314 GGGAGCAGGAGCAAGGCAGAGGG - Intergenic
1199405373 X:147452268-147452290 CAAAGCAGGAAGAAGGCAGCCGG + Intergenic
1199819728 X:151432779-151432801 GAGAGAAGGATGAATGGTGCTGG + Intergenic
1199991855 X:152991907-152991929 CACAGCAGGAGGAAGTCAGCAGG - Exonic
1200061738 X:153486816-153486838 GTGTGCTGGAGGAAGGCGGCAGG - Exonic
1200184927 X:154175978-154176000 AGGAGCTGGAGGAAGGCTGCAGG - Intergenic
1200190580 X:154213116-154213138 AGGAGCTGGAGGAAGGCTGCAGG - Intergenic
1200196331 X:154250918-154250940 AGGAGCTGGAGGAAGGCTGCAGG - Intergenic
1200201986 X:154288036-154288058 AGGAGCTGGAGGAAGGCTGCAGG - Exonic
1201765542 Y:17570823-17570845 GAGAGGAAGAGGAAAGCTGCCGG + Intergenic
1201836010 Y:18335166-18335188 GAGAGGAAGAGGAAAGCTGCCGG - Intergenic