ID: 961318739

View in Genome Browser
Species Human (GRCh38)
Location 3:126057895-126057917
Sequence CTGTGGGGACAGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1114
Summary {0: 1, 1: 1, 2: 15, 3: 118, 4: 979}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961318739_961318748 13 Left 961318739 3:126057895-126057917 CCCTCTTCCCTCTGTCCCCACAG 0: 1
1: 1
2: 15
3: 118
4: 979
Right 961318748 3:126057931-126057953 ACAAAGTGGAAGAGACGCTGTGG 0: 1
1: 0
2: 2
3: 20
4: 291
961318739_961318746 -1 Left 961318739 3:126057895-126057917 CCCTCTTCCCTCTGTCCCCACAG 0: 1
1: 1
2: 15
3: 118
4: 979
Right 961318746 3:126057917-126057939 GCTTAACCGAGAGAACAAAGTGG 0: 1
1: 0
2: 0
3: 5
4: 98
961318739_961318749 28 Left 961318739 3:126057895-126057917 CCCTCTTCCCTCTGTCCCCACAG 0: 1
1: 1
2: 15
3: 118
4: 979
Right 961318749 3:126057946-126057968 CGCTGTGGTAGTCAGTTTCTAGG 0: 1
1: 0
2: 0
3: 10
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961318739 Original CRISPR CTGTGGGGACAGAGGGAAGA GGG (reversed) Intronic
900193167 1:1360013-1360035 CCATGGGGAGAGAGGGAACAGGG - Intronic
900267873 1:1768626-1768648 ATGTGGGGACACAGAGAAGATGG + Intronic
900466023 1:2825887-2825909 CTGTGAGGACACAGAGAAGGCGG - Intergenic
900681674 1:3920129-3920151 ATGGAGGGAGAGAGGGAAGAAGG - Intergenic
900691442 1:3982921-3982943 CTGTGGGTACAGGGAGAAGATGG + Intergenic
900938846 1:5784800-5784822 CTGTGGGGCCAGGGGGACCAGGG - Intergenic
901193402 1:7425881-7425903 CTATGGGGGCAGGGAGAAGATGG - Intronic
901315392 1:8304034-8304056 CTGAGTGGACAGAGGGAGGCAGG + Intergenic
901862590 1:12084396-12084418 TGGTGGGGACAGAGGGAGTATGG + Intronic
902086818 1:13869016-13869038 TCGTGGGGACAGCGGGAGGAGGG + Intergenic
902112046 1:14089073-14089095 GTGTGGGTGCAGAGGGAATATGG - Intergenic
902392075 1:16112666-16112688 TTGGGGGGTCAGAGGGAAGGGGG + Intergenic
902444441 1:16452961-16452983 CTGTGGGGAGAGTGGCAGGAGGG + Intronic
902460233 1:16569410-16569432 CTCTGGGGACAGAGCAAAAATGG + Intronic
902533422 1:17105062-17105084 CTGTGGGGAGAGATGAGAGAGGG + Intronic
902672312 1:17983319-17983341 CTGCGGTGGCAGAAGGAAGAGGG + Intergenic
903277820 1:22232973-22232995 CTTGGGGGACAGGGGGAAGCTGG - Intergenic
903406336 1:23099927-23099949 GTGAGGGACCAGAGGGAAGAGGG - Intronic
903808210 1:26020445-26020467 GTATGGGGATAGAGGGATGAAGG + Intronic
904318708 1:29682661-29682683 CAGTGGGGTCAGAGGGAGCAGGG - Intergenic
904496690 1:30891228-30891250 CCATGGGGACAGAGGGCAGATGG - Intronic
904594416 1:31634116-31634138 CAGTAAGGACAGAGGGAAAAAGG + Intronic
904644878 1:31958185-31958207 CAGTGGAGACAGAGGGGAGAGGG - Intergenic
904793947 1:33044843-33044865 CTTAGGGAAGAGAGGGAAGAAGG + Intronic
904927344 1:34059371-34059393 ATGAGGGGGCTGAGGGAAGAGGG - Intronic
905284175 1:36868460-36868482 CTGTGGGCACAGGGTGCAGAGGG + Intronic
905361074 1:37420836-37420858 CTGTGGATACTGAGGGATGATGG - Intergenic
905427180 1:37895498-37895520 CTGTGGGGAGAGAGAGAGGGAGG - Intronic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
905774124 1:40657291-40657313 CAGTGGGGAAAGAGGCAGGATGG + Intronic
906793986 1:48682103-48682125 ATGTGAGGACAGGGGAAAGATGG + Intronic
906926300 1:50120871-50120893 ATGTGTGGCCAGAGAGAAGATGG + Intronic
907029137 1:51153429-51153451 CTGTGGGGACTGAGGTCAGCAGG - Intergenic
907032175 1:51183354-51183376 CTGCTGGGACCTAGGGAAGAAGG + Intergenic
907224016 1:52927911-52927933 CTGGAGGGACAGAGGGAGGCCGG - Intronic
907281750 1:53351581-53351603 CAGCGGGAACAGAGAGAAGAGGG - Intergenic
907379603 1:54075283-54075305 CTGTGGGAATACAGGGGAGACGG + Intronic
907394291 1:54178531-54178553 ATGTGGAGTCAGAGGGAGGAGGG + Intronic
907424846 1:54373146-54373168 CTGGAGGGGAAGAGGGAAGAAGG - Intronic
908389090 1:63669349-63669371 CTGTGGGAATAGAGGGATGAAGG + Intergenic
908644835 1:66266015-66266037 CTGTGGAGACAGAGAAAAGAAGG - Intronic
909681251 1:78294487-78294509 CTGTGGCTTCAGAGGGTAGAAGG + Intergenic
910438895 1:87232178-87232200 CTGTGGGTACAGATGGTAGTAGG - Intergenic
910479883 1:87646925-87646947 TTGTGGGGAAAGAGGAAAGGAGG + Intergenic
911825152 1:102474028-102474050 CAGTGGGGATAGAGAGAGGAAGG - Intergenic
912432984 1:109639285-109639307 CTGGGTGGACAGATGCAAGATGG + Intergenic
912517853 1:110227165-110227187 GTTTGGGGACAGAGGGAAGTGGG - Intronic
912659787 1:111517063-111517085 CACTTGGGACAGAGGGAGGAAGG - Intronic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
913367369 1:118055115-118055137 CTGTGGGCAGAAGGGGAAGATGG - Intronic
913369728 1:118084558-118084580 CTTTGAAGACAGTGGGAAGAGGG - Intronic
913498479 1:119449500-119449522 CTGAGGGCAAAGAAGGAAGAAGG - Intergenic
913605184 1:120459171-120459193 CTCTGGGGACAGAGCAAAAATGG - Intergenic
913642050 1:120821908-120821930 CTCTGGGGACAGAGCAAAAATGG - Intronic
913989982 1:143602123-143602145 CTCTGGGGACAGAGCAAAAATGG + Intergenic
914189378 1:145395315-145395337 CTCTGGGGACAGAGCAAAAATGG + Intronic
914276430 1:146128456-146128478 CTCTGGGGACAGAGCAAAAATGG + Intronic
914366387 1:146982732-146982754 CTCTGGGGACAGAGCAAAAATGG - Intronic
914448671 1:147771940-147771962 CTCTGGGGACAGTGGGTGGAGGG + Intronic
914486060 1:148110715-148110737 CTCTGGGGACAGAGCAAAAATGG + Intronic
914537474 1:148579411-148579433 CTCTGGGGACAGAGCAAAAATGG + Intronic
914586392 1:149065863-149065885 CTCTGGGGACAGAGCAAAAATGG + Intronic
914628452 1:149485934-149485956 CTCTGGGGACAGAGCAAAAATGG - Intergenic
915040145 1:152961481-152961503 CTCTGAGGAGAGAGGAAAGAGGG + Intergenic
915091376 1:153428659-153428681 ATGTGTGGGCAGAGGGAGGAGGG + Intergenic
915525981 1:156476566-156476588 CTGTGGGGACAGAGGTGTGGGGG - Intronic
915591690 1:156874548-156874570 CTGTAGGGACACAGGGCAGGAGG - Intronic
915720663 1:157983039-157983061 CAGTGTGGACAGAGGGCAGCGGG - Intergenic
915732749 1:158065834-158065856 CTGAGGGGAAAGAGGGCAGGCGG - Intronic
915934067 1:160080320-160080342 GTGTGGGGACAGGGGGCATACGG + Intergenic
915969923 1:160347427-160347449 CTGTGGGGACAGACGAAAGAAGG - Intronic
916841950 1:168609862-168609884 CTGAGGAGACAGAGGGGGGAGGG + Intergenic
916847869 1:168671601-168671623 ATGTGTGGCAAGAGGGAAGAGGG + Intergenic
916895892 1:169161625-169161647 CTGTGAGGCCAGAAGCAAGATGG - Intronic
916929130 1:169556680-169556702 CTGTGGGCCCAGAGGGAAAGTGG - Exonic
917134964 1:171781036-171781058 CTTTGCGGAGAGAAGGAAGAGGG + Intergenic
918081805 1:181213614-181213636 CTGTGGTCTGAGAGGGAAGAAGG + Intergenic
918329502 1:183444452-183444474 CTTTGGGGAAATAGGAAAGAAGG + Intergenic
918477336 1:184939381-184939403 TTGTGGGGACAGTAGGAATAGGG - Intronic
918637071 1:186789632-186789654 GTGTGAGGACAGAGGGTATATGG - Intergenic
918665407 1:187145033-187145055 GTGTGGGGTCAGGGGGAATATGG - Intergenic
919118236 1:193308127-193308149 GTGTGGGCACAGAGGGTATATGG - Intergenic
919866745 1:201788445-201788467 CTGGAAGGACAGAGGGAAGGGGG - Intronic
920008472 1:202850710-202850732 CTATGGGGACTGAGGGAAAGGGG + Intergenic
920060276 1:203222543-203222565 CTGAGGGGACAGTGGGGTGAGGG - Intronic
920877152 1:209847367-209847389 GAGTGGGGATAGAGAGAAGATGG - Intronic
920961984 1:210671590-210671612 TTGAGAGGACAGAGGGAAGAAGG + Intronic
921980808 1:221256818-221256840 TTGTGGAGCCAGAGGGAAGAGGG + Intergenic
921991798 1:221374779-221374801 CTGTTGGCACAGAAGGAAGTGGG - Intergenic
922165589 1:223113145-223113167 CTGTGGAGTCAGAGGAATGAAGG - Intronic
922212302 1:223495564-223495586 CTGTAGGGACAGAGTGCAGGGGG - Intergenic
922334129 1:224605359-224605381 CTGTGGGGCTAGAAGCAAGATGG - Intronic
922598360 1:226831202-226831224 CTGTGGGGATAGTGGGCACATGG + Intergenic
922598445 1:226832086-226832108 AAGTTGGGACAGAAGGAAGATGG + Intergenic
922698758 1:227745766-227745788 CTCTGGGGGCAGAGGTAAGCAGG - Intronic
922910688 1:229213697-229213719 CTGTGGGCAAGGAGGAAAGAAGG + Intergenic
922997587 1:229977000-229977022 TGGTGGTGACAGAGGGAAGTAGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924421599 1:243915016-243915038 CTGTGGGGGCTGAGGGACCAAGG - Intergenic
1063038614 10:2314760-2314782 CTCAGGGGATAGAGAGAAGAGGG + Intergenic
1063123298 10:3119849-3119871 TTGTGGGGCGAGAGGGAAGCTGG - Intronic
1063163833 10:3442054-3442076 GTGTGGGGACAGGGGGTATAGGG - Intergenic
1063619961 10:7637529-7637551 CTGTGGGGACTGAGGGAACCTGG - Intronic
1063780706 10:9319985-9320007 ATGTGGGGACAGATGAAAGTGGG + Intergenic
1064209632 10:13351340-13351362 CAGAGGAGACACAGGGAAGATGG + Intergenic
1064804689 10:19117124-19117146 GTGAGAGGAGAGAGGGAAGAAGG + Intronic
1064965099 10:21007198-21007220 CTGTGGGGAGAGAGGGTGAATGG - Intronic
1065205610 10:23355183-23355205 CTGTGGCCACAGAGGAGAGAAGG - Intergenic
1065359926 10:24879920-24879942 CTGTGGGGTGAGTGGGGAGAAGG + Intronic
1065438589 10:25726554-25726576 AAGTGGGGAGAGAGGAAAGAAGG - Intergenic
1065708733 10:28495208-28495230 CTGGGAAGACAGAGGGAAGGAGG + Intergenic
1065965458 10:30766918-30766940 CTGTGGCCACAAAGGAAAGATGG - Intergenic
1066205795 10:33188168-33188190 TTGAGGGGACAGAGGCACGATGG - Intronic
1066706335 10:38183053-38183075 CTTTGGGGACACAGGGAAAAGGG - Intergenic
1066983621 10:42443009-42443031 CTTTGGGGACACAAGGAAAAGGG + Intergenic
1067215818 10:44301810-44301832 CTTTGGGGACAGTGAGAAGTAGG + Intergenic
1067337934 10:45379432-45379454 CTGTGAGGACAGAGGGAGAGTGG - Intronic
1067419367 10:46133478-46133500 CTGGGGGGACACAGGGCACAAGG - Intergenic
1067476711 10:46572281-46572303 CTGCGGGGACAGTGGCTAGAAGG - Intergenic
1067504718 10:46840075-46840097 CTGGGGGGACACAGGGCACAAGG - Intergenic
1067514705 10:46928566-46928588 CTGGGGGCTCAGAGGGAAGCAGG - Intronic
1067517408 10:46963580-46963602 ATGTGTGTACAGAGGGATGAGGG + Intronic
1067521512 10:47010619-47010641 CAGTGGGGAGAGAGGGAGGGAGG - Intergenic
1067618026 10:47769499-47769521 CTGCGGGGACAGTGGCTAGAAGG + Intergenic
1067647551 10:48123247-48123269 CTGGGGGCTCAGAGGGAAGCAGG + Intergenic
1067672312 10:48334222-48334244 CTTAGGGGACAAAGGAAAGAGGG - Intronic
1068067876 10:52154802-52154824 CTTTGGGGACTCAGGGGAGAAGG - Intronic
1068231825 10:54177515-54177537 CTGTGGGGACAGTGAGTATATGG + Intronic
1068561512 10:58519929-58519951 ATGTGTGGACAGTGGGAGGAGGG - Intronic
1069052095 10:63805962-63805984 CTGTGGTGATAGAGGGGAGAAGG - Intergenic
1069252932 10:66294320-66294342 CTGTGGGTAGAGAGAGAAGAAGG + Intronic
1069311544 10:67044087-67044109 TTGGGGGGAAAGAGGGAGGAGGG - Intronic
1069547434 10:69338785-69338807 GTGTAGAGAGAGAGGGAAGAGGG + Intronic
1069842892 10:71351051-71351073 GTTTGGGGGCAAAGGGAAGAAGG - Intronic
1070495226 10:77015337-77015359 CTGTGGGGTCAAGGGGAAGGAGG - Intronic
1070920976 10:80186277-80186299 CTGTGGGGACTGAAGGGGGAAGG + Intronic
1070979077 10:80630096-80630118 GTGGAGGGAGAGAGGGAAGAAGG + Intronic
1071715571 10:88091976-88091998 CTGTGCAGACACAGGGAAGAAGG - Intergenic
1071752472 10:88496062-88496084 CAAAGGGGACAGAAGGAAGAGGG + Intronic
1072252420 10:93591959-93591981 TTATGGGAACTGAGGGAAGATGG + Exonic
1072578777 10:96722266-96722288 CTTTGGGGAGAGAAGGAAGAGGG - Intergenic
1072785036 10:98273562-98273584 CTGGGGGTGCAGGGGGAAGAGGG - Intergenic
1073214727 10:101829864-101829886 CTGTGGGGGCGGAGGGAGGCTGG + Exonic
1073583154 10:104685821-104685843 TTGTGGGGACAAAGGGAAGAGGG - Intronic
1074100038 10:110347707-110347729 CACTTGGGACAGAGTGAAGAGGG - Intergenic
1074898653 10:117798054-117798076 CTTTGGTGCCCGAGGGAAGAGGG - Intergenic
1075017109 10:118917951-118917973 GAGAGGGGACAGAGGGAACAGGG + Intergenic
1075065857 10:119288459-119288481 CTTTGGGGAAACAGGGAAGCAGG - Intronic
1075153623 10:119956338-119956360 GACTGGAGACAGAGGGAAGAAGG + Intergenic
1075278693 10:121119701-121119723 TTGTGGGGTGAGAGGGAAGAAGG - Intergenic
1075360354 10:121826760-121826782 GAGTGGGGAGAGAGGGAAGGTGG - Intronic
1075445820 10:122512110-122512132 CTGTGGGGGTAGCAGGAAGAGGG + Intronic
1075623734 10:123946983-123947005 GTCTTGGGAGAGAGGGAAGAGGG + Intergenic
1075639808 10:124056536-124056558 GTGTGGGGACAGGGGAAGGAAGG + Intronic
1075725140 10:124607134-124607156 CAGTGGGTACAGAGCGGAGAGGG - Intronic
1075781524 10:125020491-125020513 TTGTGGAGACAGACAGAAGAGGG + Intronic
1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG + Intergenic
1075832119 10:125420141-125420163 GTGTGGGGACAGGGGCAGGAAGG + Intergenic
1075909032 10:126107629-126107651 CTGTGGGGACAGTGTGAGAAGGG - Intronic
1076213500 10:128673365-128673387 CTCTGGGGATAGATGGAAAAAGG - Intergenic
1076307205 10:129473881-129473903 CAGTGGGGCCAGAGGAAAGATGG + Intronic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076470220 10:130713555-130713577 CTGTGTGGACAGAAGGACAAGGG + Intergenic
1076521674 10:131085120-131085142 CTGTGGGGACACAGCCAGGAGGG + Intergenic
1076607032 10:131695790-131695812 CTGGGGGGACAGAGAGATGCAGG + Intergenic
1076677136 10:132153034-132153056 CTGTGTGGACAGTCGGGAGAGGG + Intronic
1076726612 10:132416893-132416915 CTGTGGGCCCTGAGGGAAGGAGG + Intronic
1077022226 11:422480-422502 CTGTGGGGACAGGGAGCAGCTGG + Intronic
1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG + Intronic
1077046578 11:549350-549372 CTGTGGCTACAGTGGGAACAGGG + Intronic
1077222635 11:1424349-1424371 GTGTGGGGGCAAAAGGAAGAAGG + Intronic
1077223383 11:1427118-1427140 CTGTGGGGAGAGAGGGGATGGGG - Intronic
1077252575 11:1567125-1567147 CTGTGGGGGCACAGGGAAGATGG - Intronic
1077793111 11:5462355-5462377 CTGTGTGAACTCAGGGAAGAGGG + Intronic
1077906870 11:6541098-6541120 CTGTGTGGAGAGAGGGAGGTGGG + Intronic
1078513963 11:12007841-12007863 GTGGGGGCAGAGAGGGAAGATGG - Intronic
1078645595 11:13139071-13139093 CTGTTGGGGCAGGGGGCAGAGGG - Intergenic
1079098005 11:17523268-17523290 CTGTGGGGACAGAAGGACAGTGG + Intronic
1079103892 11:17558439-17558461 CTGTGGGGAGAGGGAGAGGAAGG - Intronic
1079327344 11:19505568-19505590 GAGTGGGGAGAGAGAGAAGAAGG + Intronic
1079467354 11:20743616-20743638 CTGTGGGGTAAGAGGAAAGCAGG - Intronic
1079642004 11:22817129-22817151 GAGTGGGGAGAGAGGGAGGAGGG - Intronic
1079660044 11:23025890-23025912 ATGTGGGGACTGATGGAATAAGG + Intergenic
1079685976 11:23360462-23360484 CTGTGGGAACAGAGTGTAGAGGG - Intergenic
1079931601 11:26569843-26569865 CTGTGGGGGCAGACAGAAGGTGG + Intronic
1080250460 11:30227694-30227716 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
1080428651 11:32178738-32178760 CTTTGGGAGCAGAGGGCAGAAGG - Intergenic
1080688716 11:34537725-34537747 CAGAGGTCACAGAGGGAAGACGG - Intergenic
1081734626 11:45394308-45394330 TTGTGGGCACAGAGGGTAGAGGG + Intergenic
1082102407 11:48183560-48183582 GTGTGGGCCCAGAGGGCAGAGGG + Intergenic
1083170865 11:60923517-60923539 CTGTGGGGGCAGTGTGAAGCTGG + Intergenic
1083397662 11:62402446-62402468 CGCTGTGGGCAGAGGGAAGAGGG - Intergenic
1083592234 11:63902581-63902603 CTGCTGGGCCAGAGGGAGGATGG - Exonic
1083708846 11:64535005-64535027 CTTTGGGGACAGCAGGCAGAAGG + Intergenic
1084043705 11:66557110-66557132 CTGTGGGGGGAGTGGGCAGAAGG - Intronic
1084101870 11:66955205-66955227 CTGAGAGGACAGAGGGAAGAGGG + Intronic
1084116323 11:67044937-67044959 CTGTGAGGGCAGAGTGAAGGGGG + Intronic
1084518622 11:69649696-69649718 CTGTGGGGCCAGAGGAATGAAGG + Intronic
1084539960 11:69780031-69780053 GTGTGGGGACAGAGGGTGTAAGG - Intergenic
1084605793 11:70170920-70170942 CAGTGGGGCCAGGGGGAAGGAGG - Exonic
1084751318 11:71205896-71205918 CTGGGGGGACACAGGGCTGAGGG - Intronic
1084902081 11:72317221-72317243 CTGTGGGGAGAGAGGGCAAATGG + Intronic
1085140876 11:74140250-74140272 CTATTGGAACAGAGGGATGAAGG - Intronic
1085771319 11:79328604-79328626 GTGTGGGGACCGAGGGAGGCGGG + Intronic
1085969741 11:81573477-81573499 TACTGGGGCCAGAGGGAAGATGG + Intergenic
1086203132 11:84227328-84227350 CTGTGTGATCAGAGGGAATAAGG + Intronic
1086245125 11:84742549-84742571 TTGTGGGGACAGAGGTATGTAGG - Intronic
1086559077 11:88146206-88146228 CAGTGGGGTCAGTGGTAAGATGG + Intronic
1087346535 11:96978717-96978739 CTGTTGGGAAAAAGGGAAGGTGG - Intergenic
1087353700 11:97066506-97066528 GAGTGGGGAGAGAGGGAGGATGG + Intergenic
1087942437 11:104115054-104115076 CTTTGGGGTCTCAGGGAAGAGGG - Intronic
1087958438 11:104318951-104318973 ATGTGGGGTCAGAGTGTAGAGGG - Intergenic
1088357837 11:108961709-108961731 CCGTGGGCACACAGGGCAGAAGG + Intergenic
1089125863 11:116176080-116176102 GTGTGGGGTCAGAGGAAAAAAGG + Intergenic
1089311648 11:117562000-117562022 GAGTGGGGACAGTGGGAAGCAGG + Intronic
1089569245 11:119392148-119392170 CTTTGGGGACTCAGGGAAAAGGG - Intergenic
1090171963 11:124613192-124613214 TGGTGGGGATAGAGGCAAGAGGG - Intronic
1090208672 11:124899936-124899958 CTGTGGGGCCAGAGTGATGAAGG + Intergenic
1090229078 11:125088855-125088877 CTGTGGGGAGAGTAGAAAGAGGG + Exonic
1090396661 11:126423865-126423887 CTGGGGGGAGGGAGGGAGGAGGG - Exonic
1090441539 11:126728937-126728959 CTTTCGGGGCAGAGGGAGGAGGG + Intronic
1090753207 11:129765420-129765442 CTTTGGGGACTCAGGGAAAAAGG + Intergenic
1090773566 11:129944080-129944102 CTGTGAGGACAGTGAGAAGGTGG + Intronic
1091440008 12:505392-505414 CAGTGGGAACAGAGGAAAGGGGG - Intronic
1091663719 12:2403397-2403419 CTGTGAGGACCCAGGGAGGAGGG + Intronic
1092059484 12:5536802-5536824 ATGTGAGAACAGAGGGAAAATGG + Intronic
1092256464 12:6928655-6928677 CTGTGGGGCCAGAGGGTATCCGG + Intronic
1092275552 12:7058371-7058393 CTGTGAGGGTAGAGGCAAGATGG - Intronic
1092629267 12:10361072-10361094 TTGTAGAGACAGAGGGAGGAGGG + Intergenic
1092947882 12:13473707-13473729 CTCTGGGGAGAGGAGGAAGATGG + Intergenic
1093800019 12:23361882-23361904 CTGTCGGAACATAGGGTAGAAGG - Intergenic
1093958826 12:25251052-25251074 CGGTGTGGGAAGAGGGAAGAGGG + Intergenic
1094466850 12:30762501-30762523 CAGAGGAGACACAGGGAAGAAGG + Intergenic
1095269250 12:40197136-40197158 GTGTTGGGAAAGAGGGCAGAGGG - Intronic
1096238454 12:49945560-49945582 CTTTGGGGACTGAGGGAGAAGGG - Intergenic
1096523179 12:52195442-52195464 GGGTGGGGGCAGAGGGAACAGGG + Intergenic
1097044574 12:56177973-56177995 ATGTGGGGACAGGAGGGAGAAGG + Intronic
1097291840 12:57923191-57923213 GTGTGGGGACAGGAGGCAGATGG + Intergenic
1097603415 12:61722998-61723020 TTGTGGAGACATTGGGAAGAAGG - Intronic
1097861715 12:64524406-64524428 CTTGGAGGACAGAGGGAAGAGGG - Intergenic
1098334305 12:69386642-69386664 ATGTGGGGAGAGAGGGTATAGGG + Intronic
1098524584 12:71471984-71472006 CTTTGGGGACTCAGGGAAAAGGG + Intronic
1098776147 12:74620259-74620281 TTGTGGGGAAGGAGGGATGAGGG - Intergenic
1098877015 12:75876455-75876477 TTGTGGGGACAGGTGGAAGGGGG + Intergenic
1098892798 12:76026948-76026970 CTGTTGGGACAAAGGAAGGAAGG - Exonic
1098955896 12:76689451-76689473 AGGTGGGGACAGAGGAAGGAAGG - Intergenic
1100527241 12:95431356-95431378 TTGTGGAGACAGAGTGAAGAGGG + Intergenic
1100706778 12:97209389-97209411 CTTTGGGGACTCAGGGAAAAAGG + Intergenic
1100874916 12:98951669-98951691 CTGTAGGCCCAGAGGGAAGAGGG - Intronic
1101012731 12:100467670-100467692 CAGTGGGGACAGAGGCCAGTTGG + Intergenic
1101323955 12:103698284-103698306 CTGTGGGGAAGGAGAGGAGAAGG - Intronic
1101452224 12:104790104-104790126 CTCTGGGGACAGAAATAAGAAGG - Intergenic
1101604560 12:106238321-106238343 CAGTGGGGACAGAGGGCACCGGG + Exonic
1102025271 12:109711133-109711155 CTGAGGGGGCAGGGGGCAGAGGG - Intergenic
1102119589 12:110429809-110429831 GTGTGGGCACAGGTGGAAGATGG + Intergenic
1102149224 12:110677295-110677317 GAGTGGGGACAGAGGTGAGAGGG - Intronic
1102159940 12:110760415-110760437 CTGTGAAGACAGGTGGAAGACGG + Intergenic
1102232099 12:111269785-111269807 CTTTGGGGAAAGAGGAGAGAGGG - Intronic
1102531733 12:113551666-113551688 GGGTGGGCACAGAAGGAAGAAGG - Intergenic
1102599733 12:114020707-114020729 CTCTGGGAACAGAGACAAGAAGG + Intergenic
1102640801 12:114364878-114364900 CTTTGGGGACAGAGAGATGCGGG - Intronic
1102728262 12:115084913-115084935 CTGGGGGGAGGGAGGGAAAAGGG + Intergenic
1103014478 12:117483024-117483046 CTGGGGAGTCAGAGGGAAGAAGG + Intronic
1103024550 12:117562996-117563018 CTCTGGAGACAGAGGGAAGAGGG + Intronic
1103239785 12:119403599-119403621 CAGAGGGCACAGGGGGAAGATGG - Intronic
1103270332 12:119668213-119668235 CTGCGGGGACACAGGGAAGGCGG - Exonic
1103844292 12:123890726-123890748 CACTGGGGACAGAGAGAAGTGGG + Intronic
1104160684 12:126177325-126177347 CTTTGGGGACTCAGGGAAAAGGG + Intergenic
1104553139 12:129775742-129775764 CTGTGGGGACAGAGTGTAGGAGG - Intronic
1104616437 12:130273694-130273716 CTGTGGATACAGAGGGTACATGG - Intergenic
1104962909 12:132496708-132496730 ATGTGGGGAAACAGGGAAGGAGG - Intronic
1104995340 12:132650750-132650772 GTGTGGGGGCAGACAGAAGAGGG - Intronic
1106129952 13:26931909-26931931 CTTTAAGGACAGAGGGAAGCTGG - Intergenic
1106286657 13:28323855-28323877 CTTTGGGGAAGGAGGGAACATGG + Intronic
1106353473 13:28956765-28956787 TGGCGGGGACAGAGGGAAGAAGG + Intronic
1106353487 13:28956825-28956847 TGGCGGGGACAGAGGGAAGAAGG + Intronic
1106353497 13:28956885-28956907 TGATGGCGACAGAGGGAAGAAGG + Intronic
1106353512 13:28956944-28956966 GTTGGGGGACAGAGGGAAGAAGG + Intronic
1106635980 13:31528837-31528859 GAATGGGGAGAGAGGGAAGAGGG - Intergenic
1106665557 13:31847084-31847106 GGGTGGGGACCGAGGGAAGCGGG + Intergenic
1106916392 13:34520059-34520081 CCCTGGAGACAGAGGGATGAAGG + Intergenic
1107682472 13:42866034-42866056 CTGTGGGCACCCTGGGAAGAGGG - Intergenic
1107727960 13:43318966-43318988 CTGGAGGGAGAGAGGGAGGAAGG + Intronic
1109945825 13:69430246-69430268 CTTTGGGGACTCAGGGAAAAGGG + Intergenic
1110182263 13:72631770-72631792 CTTTGGGGACTCAGGGAAAAGGG + Intergenic
1111115373 13:83769643-83769665 CTTTGGGGACTCAGGGAAAAGGG + Intergenic
1111681164 13:91443347-91443369 GTGAGGGCACAGAGAGAAGATGG + Intronic
1111829712 13:93311876-93311898 CTGAGGGTACAAAGGCAAGATGG + Intronic
1111893169 13:94108364-94108386 CTTTGGGGACTCAGGGAAAAAGG + Intronic
1111997380 13:95178092-95178114 CTGTATGGACAAAGGAAAGAAGG + Intronic
1112732334 13:102378289-102378311 CTGTGGGGGCAAAGGGTATAAGG + Intronic
1113528418 13:111000800-111000822 ATGTGAGGACAGTGGGAAGGTGG + Intergenic
1113737610 13:112689849-112689871 CCCTGGGGGCAGAGGGCAGAGGG - Intergenic
1114033541 14:18597938-18597960 CTGTGGGGTCAGTGGTAATATGG - Intergenic
1114078329 14:19177134-19177156 CTGTGGGGTCAGTGGTAATATGG - Intergenic
1114125160 14:19717413-19717435 CTGTGGGGTCAGTGGTAATATGG + Intergenic
1114270329 14:21097226-21097248 GAGTGAGGACAGAGGGAAGGAGG - Intronic
1115649759 14:35394526-35394548 CTGTGGGGACCATGGGTAGAGGG + Intergenic
1116195657 14:41722588-41722610 GAGTGGGGACAAAGGGAAAAGGG - Intronic
1116426814 14:44800440-44800462 GAGTGGGGAGAGAGGGAAGGGGG + Intergenic
1116469624 14:45271983-45272005 GTGTGGGGACAGGGGGCATATGG - Intergenic
1117051804 14:51867689-51867711 CTGTGGGGACAAAGTGTGGAAGG - Intronic
1117352048 14:54890899-54890921 CTGTGTAGTCAGAGGGAAGCTGG - Intronic
1117378473 14:55137105-55137127 TAGTGGGGACAGAGGGCAGATGG + Intronic
1117965048 14:61198460-61198482 CTTAGGGGACATAGGGAAGGAGG - Intronic
1118006419 14:61568098-61568120 CGGTGGGCACAGAGAGATGAGGG - Intronic
1118762893 14:68891287-68891309 TTGTGGGGACAGGGTCAAGAAGG + Intronic
1118796940 14:69152665-69152687 GGGTGGGGACAGAGGGCAGGAGG + Intronic
1119228498 14:72961979-72962001 CTGTTAGAACAGAGGGAAGTGGG - Intergenic
1119513275 14:75228350-75228372 CTGTGGGAACAAAGGGAAAAAGG - Intergenic
1119897234 14:78230580-78230602 GTGTGGGGACCCAGAGAAGAGGG + Intergenic
1120428987 14:84389834-84389856 CTGTGGGAACAGATGTAAGTTGG - Intergenic
1120862456 14:89267067-89267089 CTGTAGGGAAGAAGGGAAGAAGG - Intronic
1120953860 14:90064340-90064362 CAGTGGGCACAGAGGCAGGAAGG + Intronic
1121112574 14:91322220-91322242 CTGTGGGTACAGGGGGGTGATGG + Intronic
1121440307 14:93944699-93944721 CTTGGGGGACAGAGGGAAATGGG + Intronic
1121510697 14:94510923-94510945 CTTTGGGGACTCAGGGAAGAAGG + Intronic
1121600383 14:95198993-95199015 CTGGGGGAAGAGGGGGAAGATGG + Intronic
1121651814 14:95564367-95564389 TTGTGGGGTCAGAGTGATGATGG + Intergenic
1121656668 14:95601993-95602015 CTGTGGAGACAAAGAGAAAAAGG + Intergenic
1121709464 14:96026843-96026865 CTGAGGGTGCAGAGGGAACATGG + Intergenic
1121711987 14:96045358-96045380 CTGTGTGCACAAAGGCAAGAAGG + Intronic
1121760638 14:96441898-96441920 CAGTGGGGACAGAGGGGTGATGG - Intronic
1121775035 14:96584754-96584776 CTGTGAGGACTGAGGGAGGGTGG + Intergenic
1121782567 14:96631344-96631366 CTGAGAGGACAGAGAGCAGATGG + Intergenic
1122122288 14:99561009-99561031 CTGTGGAGACTGAGGGAGGCAGG - Intronic
1122170891 14:99874300-99874322 GTGTGCGGACAGAGAGCAGAAGG + Intronic
1122262633 14:100531900-100531922 CTGTGGGGAAAGGGGGCTGAGGG - Intergenic
1122297620 14:100714136-100714158 CTGTGGTTGCAGAGGGAAGCCGG - Intergenic
1122696787 14:103558167-103558189 CGGTGGGGTCAGAGGGCAGTCGG - Intronic
1123039130 14:105483246-105483268 AGGTGTGGAAAGAGGGAAGAAGG - Intergenic
1123043662 14:105500835-105500857 CTATGGGGACAGAGGGGATGGGG - Intergenic
1202921539 14_KI270723v1_random:33461-33483 AGCTGGGGACAGAGGGACGAAGG + Intergenic
1202923377 14_KI270724v1_random:4119-4141 AGCTGGGGACAGAGGGACGAAGG - Intergenic
1123476054 15:20593138-20593160 GTGTGGGGACAGGGAGAAAAGGG + Intergenic
1123641958 15:22407226-22407248 GTGTGGGGACAGGGAGAAAAGGG - Intergenic
1124685167 15:31776399-31776421 CTGTGGGGAGAGTGGGAGCAAGG + Intronic
1124700134 15:31905404-31905426 CTCTGCGGCCAGAGGGAACATGG - Intergenic
1125200072 15:37095431-37095453 CTCTAGGGAGAGAGGGAGGAAGG - Intronic
1125758480 15:42081757-42081779 CTGTGGGGACAGTGAGAGGCGGG - Intronic
1125831296 15:42718731-42718753 CCCTGGGGACAGAGGGAAATGGG - Exonic
1125885196 15:43224170-43224192 CCGCGTGGACACAGGGAAGAGGG - Intergenic
1126365440 15:47889507-47889529 CTGTGGAGATAGAGAGTAGAAGG + Intergenic
1126599540 15:50415142-50415164 AAATGGTGACAGAGGGAAGAGGG - Intergenic
1126693027 15:51302611-51302633 CTGTGAGGACAGTGGGGAGAGGG - Intronic
1126757150 15:51935955-51935977 CTGAGGGAACATAGGGACGAGGG + Intronic
1127226464 15:56935633-56935655 CTTTGGGGACTCAGGGAAAAGGG - Intronic
1127489396 15:59447998-59448020 CTGTGGGGAGAAAGGGAAGAGGG + Intronic
1127827287 15:62715861-62715883 AGGTGGGGACAGAGGGAAGAGGG - Intronic
1127856771 15:62960017-62960039 CTGTGGGGAGAGGGGGATGGGGG + Intergenic
1128116889 15:65113364-65113386 CTGTGGGGACTGAGAGACCATGG - Intronic
1128145689 15:65331299-65331321 CCGGGGGGACAGCGGGGAGAAGG + Intronic
1128255645 15:66194649-66194671 CTTTGGGGACTCAGGGAAGAAGG + Intronic
1128291014 15:66478208-66478230 CTGTGAGGACAGAGAGAGTAAGG - Intronic
1128403563 15:67311902-67311924 ATGAGTGGACAGAGAGAAGAGGG + Intronic
1128479182 15:68022740-68022762 CTGTAAGGAGAGAGGGATGAGGG + Intergenic
1128547416 15:68577839-68577861 CTGGGGGAACAGAGAGGAGATGG - Intergenic
1128609922 15:69065268-69065290 CTTTAGGGGCAGAGGGCAGAAGG + Intergenic
1128793679 15:70450087-70450109 ATGGGTGGACAGAGGGATGAGGG + Intergenic
1128919058 15:71593980-71594002 CTGATGAGAAAGAGGGAAGAGGG + Intronic
1129142384 15:73611840-73611862 GTGTGGGGACAGGGGGTACATGG + Intronic
1129174826 15:73832463-73832485 CTTTGGGAGCAGAGGGAATATGG - Intergenic
1129239443 15:74242816-74242838 CAGTGGGGACTCAGAGAAGACGG - Intronic
1129360114 15:75019329-75019351 CAGAGGGGCCAGAGGCAAGAGGG - Exonic
1129773602 15:78218483-78218505 CAGTGGGGACACAGAGCAGAAGG + Intronic
1129879557 15:78997885-78997907 GGGTGGGGAGAGAGGAAAGAAGG + Intronic
1130172657 15:81531692-81531714 CAGTGGGCACTGAGGGAGGAGGG - Intergenic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1130960558 15:88656061-88656083 CTGTGGAGTCAGAGAGAAGTAGG + Exonic
1131407090 15:92174124-92174146 CTGAGAGGACATTGGGAAGAGGG - Intergenic
1131863038 15:96674972-96674994 CTGAAGGAACAGAGGGAAGGAGG + Intergenic
1132083934 15:98891302-98891324 CTGTGGAGAGAGAGGAGAGACGG - Intronic
1132121639 15:99180935-99180957 CTGGAGGGACACAGGGAAGGAGG + Intronic
1132279155 15:100597725-100597747 TTGTGGGGGCAGATGGAAAAGGG - Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1133255079 16:4511749-4511771 CAGTGAGGACACAGGGCAGACGG + Exonic
1133304144 16:4799520-4799542 CTGTGGGGTCAGGGGCAAGCTGG - Intronic
1133883801 16:9807320-9807342 GTGGGGGGAGAGAGGGAGGAAGG + Intronic
1134219903 16:12345721-12345743 ATGTGGGCACAGTGGGAAGGTGG + Intronic
1134365485 16:13573772-13573794 CTGTGGAGACAGTGGGATAATGG + Intergenic
1134444474 16:14320458-14320480 CTGTGGGCGCTTAGGGAAGAAGG - Intergenic
1134682381 16:16135311-16135333 AAGTGGGGACAGATGGAGGAGGG - Intronic
1134784835 16:16932655-16932677 TTGAGGGGATAGAGGGAACATGG - Intergenic
1134847872 16:17456097-17456119 CTGTGTGCACAGAGTGAAGCTGG - Intronic
1135007497 16:18839592-18839614 CTGGAGGGACAGAGGAAGGAAGG + Intronic
1135222777 16:20627247-20627269 CACTGGGGACAGAGGTAAGATGG - Exonic
1135695328 16:24581361-24581383 CGGTGGGGGGAGGGGGAAGATGG - Intergenic
1135910890 16:26559611-26559633 CTGAGGGGGGATAGGGAAGAGGG - Intergenic
1136109695 16:28057076-28057098 CTGTGGGGGCAGAGAGGAGTGGG + Intronic
1136296519 16:29307159-29307181 CTGTGGGGACTGAGGAAATGAGG + Intergenic
1137248961 16:46729358-46729380 CTGTGGGGCCTGGGGCAAGAAGG - Intronic
1137316629 16:47331324-47331346 AGGGAGGGACAGAGGGAAGAGGG + Intronic
1137547276 16:49413106-49413128 CTAGGGGGACTGATGGAAGAAGG - Intergenic
1137746494 16:50824281-50824303 GTGTGGGGAGAGAGGGAAGAGGG + Intergenic
1138182135 16:54948595-54948617 GAGTGGGGTCAGATGGAAGAAGG - Intergenic
1138306671 16:55983170-55983192 TTGTGGGGGCAGAGGGTATATGG - Intergenic
1138631996 16:58303890-58303912 CTTTGGGGACTCAGGGAAAAGGG - Intronic
1139377433 16:66508982-66509004 ACGTGGGGGCAGAGGGGAGAGGG + Exonic
1139476050 16:67203096-67203118 CTGCGTGGAGAAAGGGAAGAGGG - Intronic
1139477922 16:67212133-67212155 CTCTGGGGAGAGGGAGAAGAGGG + Intronic
1139532457 16:67549057-67549079 CTGAGGGGACAGATGGAAGTGGG + Intergenic
1139592929 16:67943364-67943386 CTGGGGGGACAGCAGGGAGAGGG - Intronic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1140417624 16:74787412-74787434 GAGTGGGAACAGGGGGAAGAAGG - Intergenic
1140477661 16:75247086-75247108 AGGTGGGGGCAGAGGGGAGAAGG - Intronic
1140914668 16:79483088-79483110 AAGTAGGGACAGAGGGAGGAAGG - Intergenic
1141100615 16:81195181-81195203 CTCTGGGGACACAGAGATGAAGG + Intergenic
1141489540 16:84362884-84362906 CTGTGGGTACGGCGGGAGGACGG - Intergenic
1141501473 16:84447416-84447438 TGGTGGGGAGGGAGGGAAGAAGG - Intronic
1141838978 16:86562162-86562184 AGGTGGGGTCAGAGGGGAGAAGG - Intergenic
1141842651 16:86584049-86584071 CTGAGGGGGCAGAGGCAGGATGG - Intergenic
1142073615 16:88104756-88104778 CTGTGGGGACAGGCAGAAAACGG - Intronic
1142124541 16:88403632-88403654 CTGTGGGGGCCGAGGGCAGGAGG - Intergenic
1142142672 16:88479542-88479564 CGGTGGGGACAGAGAGGAGACGG - Intronic
1142323303 16:89398961-89398983 CTGATGGGAGAGAGGGATGATGG - Intronic
1143239680 17:5433518-5433540 AGGTGGGGAGTGAGGGAAGAGGG - Intronic
1143449825 17:7029454-7029476 ATGGGGAGAAAGAGGGAAGAGGG - Exonic
1144350278 17:14388595-14388617 AGGTGGGGATAGAAGGAAGAGGG + Intergenic
1144703917 17:17355162-17355184 CTGTGGGGAAAGAAGGGGGAAGG + Intergenic
1144878013 17:18412353-18412375 CTGCGGGGAGAGGGGGAGGAGGG + Intergenic
1145154217 17:20532072-20532094 CTGCGGGGAGAGGGGGAGGAGGG - Intergenic
1146534481 17:33638379-33638401 CTGTGAGGATAGAAGCAAGATGG + Intronic
1146558674 17:33849400-33849422 CTGTGGAGACTGAGGAATGAGGG + Intronic
1146596416 17:34173000-34173022 CTGTGAGGCTAGAAGGAAGATGG + Intronic
1146624032 17:34422522-34422544 TCCTGGGGACAGAGGGATGAGGG - Intergenic
1146833636 17:36091946-36091968 TTGTGGGTTCAGAGGAAAGAGGG + Intergenic
1146835429 17:36106869-36106891 CTGCGGGGACTGAGAGAAGGAGG + Intergenic
1147167908 17:38603159-38603181 CTGGCGAGAGAGAGGGAAGAGGG + Intronic
1147205587 17:38835186-38835208 CTGTTAGAACAGAGGGAAGTGGG + Exonic
1147362931 17:39942964-39942986 CCTTGGGGAGTGAGGGAAGATGG + Intronic
1147370901 17:39992361-39992383 GTGTGAGGGCAGAGGGCAGAGGG - Intronic
1148019202 17:44542317-44542339 CTAGGGGGACAGTGGGCAGAAGG + Intergenic
1149658113 17:58320707-58320729 GGGTAGGGAGAGAGGGAAGAGGG + Intronic
1150271569 17:63869311-63869333 CTGTGGGGAGGGATGGAATAGGG - Intergenic
1150275104 17:63892192-63892214 CTGTGGGGAGGGATGGAATAGGG - Intergenic
1150277243 17:63906953-63906975 CTGTGGGGAGGGATGGAATAGGG - Intergenic
1150321382 17:64217256-64217278 CTGGGAGGACAGAGAGAAGAGGG - Intronic
1150434726 17:65144966-65144988 ATGTGAGAACAGAGAGAAGACGG - Intronic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1151324163 17:73368594-73368616 CTGTGGGAACAGAAGGATGTGGG + Intronic
1151509609 17:74550200-74550222 CTCTGGGGTCTGGGGGAAGAGGG - Intergenic
1151518675 17:74613530-74613552 CTGTGGGGTCTGTGGGGAGATGG - Intronic
1151630738 17:75309261-75309283 CAGTGGGGAGAGGGGGACGAAGG + Intergenic
1152158099 17:78648104-78648126 CTGTGGAGTCAGAAGGAAGCCGG + Intergenic
1152430526 17:80246220-80246242 CTGCGGGCACAAGGGGAAGATGG - Intronic
1152469606 17:80483354-80483376 CTGAGGGTGCAGAGGGAGGACGG + Intergenic
1153282207 18:3425229-3425251 CTGTGAGGATAGAAGCAAGATGG - Intronic
1153364326 18:4237095-4237117 GTGTTAGGACAGAGGGAAGTCGG + Intronic
1153532529 18:6062992-6063014 CTCTGGGGACTCAGGGAGGAAGG - Intronic
1153666268 18:7369911-7369933 GTGTGGGGACAGAGGGCATGAGG + Intergenic
1154326769 18:13396865-13396887 CTGTGGATACAGAGGGCTGACGG + Intronic
1155074187 18:22340734-22340756 CTGTGGGGACAGACGGCACTGGG + Intergenic
1155276193 18:24189829-24189851 CTGTGAGGACTGAGGACAGAAGG - Intronic
1155374478 18:25140646-25140668 ATGGGGAGACAGAGGGGAGAAGG + Intronic
1155433185 18:25783357-25783379 ATGTGGGGACTCAGGGAAAAGGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156474703 18:37398137-37398159 CTGTTGGGAGAGAGTGAAGGAGG + Intronic
1156540918 18:37909449-37909471 TTGTGGGGAGAGAAGGAGGAAGG + Intergenic
1156625303 18:38901070-38901092 GTGTGGGGAGAGAGAGAAGAAGG + Intergenic
1157074472 18:44449996-44450018 CTGTGGGAACAGAAAGCAGAAGG - Intergenic
1157328079 18:46683518-46683540 CTGAGGGCAGAGAGGGAAGAAGG + Intronic
1157449717 18:47776277-47776299 CAGTTGGGACACAGGCAAGAAGG + Intergenic
1157749755 18:50167845-50167867 CCGTGGGGCCAGAGGGCAGATGG - Intronic
1158882337 18:61792535-61792557 CTGTGGGGAGTGAGACAAGATGG - Intergenic
1158933239 18:62341499-62341521 CTGAGGGGAGAGAGGGAAAAGGG - Intronic
1159435709 18:68414402-68414424 CTGTAGTGACAGAGGTAACAAGG + Intergenic
1159579427 18:70218612-70218634 CTGAGGACACAGAGAGAAGATGG - Intergenic
1159849770 18:73514317-73514339 ATGGAGGGACACAGGGAAGAAGG - Intergenic
1160191878 18:76721506-76721528 CAGTAGGGGCAGGGGGAAGATGG + Intergenic
1160937955 19:1606186-1606208 CGGTGTGGGCAGAAGGAAGAGGG + Intergenic
1161204436 19:3033721-3033743 CTGTGCTTAGAGAGGGAAGAGGG - Intronic
1161231336 19:3176531-3176553 CTGGGGGGACAGAGGGCAGGTGG + Intronic
1161258896 19:3324720-3324742 TAGTGGGAAGAGAGGGAAGAAGG - Intergenic
1161282259 19:3452459-3452481 CTGCGGAGACAGTGGGAAGCGGG - Intronic
1161421959 19:4180910-4180932 CTGTGGGGGGAGAGAGCAGACGG + Intronic
1161465731 19:4429255-4429277 CTGAAGGGACAGATGGAGGAGGG - Intronic
1161576697 19:5058401-5058423 CTCTGAGGACTGAGGGAGGAGGG + Intronic
1161727404 19:5937793-5937815 CTGTGGGGAGAGAGACAGGAGGG + Intronic
1161878967 19:6933792-6933814 GTGTGGGGGCAGCGGGGAGAAGG - Intronic
1161913912 19:7214848-7214870 AGGTGGGGACGGAGGGAAGAAGG - Intronic
1162059429 19:8085841-8085863 CAGAAGGGACAGAGGGAAGAGGG + Intronic
1162131769 19:8530366-8530388 CTGCGGGGACAGAGGGTGGAGGG + Intronic
1162327107 19:10005986-10006008 CTGGGTGGGCAGAGGGAACAAGG + Intronic
1162823025 19:13234846-13234868 CTATGGGAACAGAAGGATGAAGG + Intronic
1163021210 19:14481886-14481908 CTGTGGGGATAGATGGGAGGGGG - Intronic
1163169229 19:15519163-15519185 ATGTGGGCACAGAGGAAAGGGGG + Intronic
1163283938 19:16334455-16334477 TTGTAGAGACAGAAGGAAGAAGG - Intergenic
1163311394 19:16517044-16517066 CTGTGGGAACACAGGGTAGAGGG - Intronic
1163801443 19:19368155-19368177 CAGTGGGGGCAGAAGGATGATGG - Intergenic
1163989256 19:20983139-20983161 CTGTGGACACAGAGTAAAGAAGG - Intergenic
1164536172 19:29087898-29087920 CTGTGGGGCCAGGGGGAACAAGG + Intergenic
1164581704 19:29438980-29439002 ATGTAGGGAGAGAGAGAAGAAGG + Intergenic
1164629801 19:29754768-29754790 CTGTGAGCACAGTGGGGAGAGGG - Intergenic
1164659523 19:29950260-29950282 CTGGGGGGAAAGGGGGAAGAAGG + Intronic
1164727515 19:30476184-30476206 CTGGGGCCACAGAGGGAAGAAGG - Intronic
1164744478 19:30601073-30601095 CTGTGGGAACACAGGGAATATGG - Intronic
1165142970 19:33713447-33713469 CTGTAGGAAAAGAGGGAAGTGGG - Intronic
1165407046 19:35637419-35637441 CTGTGGAGACAGAGGGTTCAAGG - Intronic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165449661 19:35874672-35874694 CCGTGGGGGCAGAGAGCAGAGGG + Intronic
1165793590 19:38506280-38506302 CTGAGAGGACAAGGGGAAGATGG - Intronic
1165834086 19:38743883-38743905 CTCTGGGGTCTGAGGGAGGAGGG - Intronic
1165924454 19:39318628-39318650 CTCTTGGGTCAGAGGGAAGAGGG - Intergenic
1166230660 19:41424415-41424437 CTGTGGGGACATGGGGCAGTGGG - Intronic
1166875357 19:45893633-45893655 CTGGGGGAAGACAGGGAAGATGG + Intronic
1166915241 19:46190972-46190994 CTGAGGGGCCTGAGGGGAGATGG - Intergenic
1167248814 19:48390263-48390285 CTCTTGGGTCTGAGGGAAGAAGG - Intronic
1167414537 19:49363144-49363166 CTTTGGTGCCTGAGGGAAGATGG + Intronic
1167600482 19:50451678-50451700 CTGTAGGGTCTGAGGGAGGAGGG + Intronic
1167634966 19:50649100-50649122 ACGTGGGGACAGAGGGGAGGAGG + Intronic
1167660535 19:50793661-50793683 CTGTGGGGAGACAGGACAGATGG - Intronic
1167668901 19:50838702-50838724 CTGGGGGGTCTGAGGGAGGAGGG + Intergenic
1167669194 19:50839630-50839652 CTGGGGGGTCTGAGGGAGGAGGG + Intergenic
1168153607 19:54461589-54461611 CACTGGGGGCAGAGGGAGGAGGG - Exonic
1168174248 19:54611927-54611949 GAGTGGGGAGAGAGGGAGGAGGG + Intronic
1168238521 19:55078266-55078288 CTCCTGGGTCAGAGGGAAGAGGG + Intronic
1168238559 19:55078377-55078399 CTCCTGGGTCAGAGGGAAGAGGG + Intronic
1168238573 19:55078414-55078436 CTCCTGGGTCAGAGGGAAGAGGG + Intronic
1168238587 19:55078451-55078473 CTCCTGGGTCAGAGGGAAGAGGG + Intronic
1168238601 19:55078488-55078510 CTCCTGGGTCAGAGGGAAGAGGG + Intronic
1168238615 19:55078525-55078547 CTCCTGGGTCAGAGGGAAGAGGG + Intronic
1168238629 19:55078562-55078584 CTCCTGGGTCAGAGGGAAGAGGG + Intronic
1168238654 19:55078636-55078658 CTCCTGGGTCAGAGGGAAGAGGG + Intronic
1168238668 19:55078673-55078695 CTCCTGGGTCAGAGGGAAGAGGG + Intronic
1168238682 19:55078710-55078732 CTCCTGGGTCAGAGGGAAGAGGG + Intronic
1168238710 19:55078784-55078806 CTCCTGGGTCAGAGGGAAGAGGG + Intronic
1168238739 19:55078858-55078880 CTCCTGGGTCAGAGGGAAGAGGG + Intronic
1168241573 19:55091620-55091642 CTGTGGGGGCTGTGGGCAGAGGG - Intronic
1168309098 19:55451836-55451858 ATGTGGAGACAGAGGGGTGACGG - Intergenic
1168666605 19:58209539-58209561 GTGGGAGGAGAGAGGGAAGAAGG + Intronic
1202676665 1_KI270711v1_random:13138-13160 CTCTGGGGACAGAGCAAAAATGG + Intergenic
925516987 2:4693501-4693523 CTGCGTGGGGAGAGGGAAGACGG + Intergenic
925612218 2:5711181-5711203 GGGTGGGGACAGGGGAAAGAGGG + Intergenic
925878261 2:8329966-8329988 TTCTGGGCACAGAAGGAAGATGG + Intergenic
926007532 2:9384308-9384330 CTGTGAGGCCAGAAGCAAGATGG + Intronic
926854770 2:17242939-17242961 GAGTGGGGAAAGTGGGAAGAAGG - Intergenic
927244470 2:20945916-20945938 CTGAGGGGCCTGGGGGAAGAGGG - Intergenic
927658846 2:24974583-24974605 CTGTTTGTAGAGAGGGAAGAGGG - Intergenic
927704197 2:25286882-25286904 CTGTGGAGACAGGGGAAAGGAGG - Intronic
927862371 2:26568191-26568213 CTGTGGGGACAGGGCCAAGAGGG - Intronic
928196833 2:29222294-29222316 CTTTGGGGGCAGAGGGGAGTTGG + Intronic
928331313 2:30360025-30360047 GAGTGTGGACAGAGGGCAGAGGG + Intergenic
928948070 2:36789934-36789956 CAGTGGTAACAGAGGGGAGAAGG - Intronic
929051823 2:37843546-37843568 TTGTGTGGAAAAAGGGAAGAGGG - Intergenic
929107793 2:38380948-38380970 TTGTAGGGACAGAGGGAAATCGG + Intergenic
929524911 2:42693113-42693135 GTGTGGGGAGAGAAGGAAGGAGG - Intronic
929557120 2:42932384-42932406 CAGTGGGGACAGAGGGACGATGG - Intergenic
929624929 2:43396659-43396681 CTGTGGGGACAGGGGGGTGCAGG + Intronic
929920605 2:46168761-46168783 GTTTGAGGACAGAGAGAAGAGGG + Intronic
929954084 2:46442312-46442334 CTATGGGGAGAAAGGGAAGAGGG - Intronic
930415844 2:51090347-51090369 CTGTTGGGACATAGGGAGAAAGG - Intergenic
930655303 2:54001906-54001928 GTGTGGGGACAGGGGAAATATGG - Intronic
930751984 2:54943242-54943264 CTCTGAGAAGAGAGGGAAGAAGG - Intronic
931170621 2:59799877-59799899 CTGTGGAGATAGATGGAGGACGG + Intergenic
931441111 2:62291259-62291281 CTGTGAGGCCAGAAGCAAGATGG - Intergenic
931464845 2:62477015-62477037 CTGGGGAGAGAGAGGGAAGGAGG + Intergenic
931683079 2:64768734-64768756 GTGTAGGGAGAGAGGGAAGGAGG - Intergenic
931893311 2:66700100-66700122 CTGTGGTGACTGAGAAAAGAGGG + Intergenic
932103617 2:68923544-68923566 GAGTGGGGCCAGATGGAAGACGG - Intergenic
932524288 2:72446620-72446642 GAGTGGGGAGAGTGGGAAGAAGG + Intronic
933191535 2:79339117-79339139 CTGTAGGGAGAGAGTGAACAGGG + Intronic
933400274 2:81787693-81787715 CTAAGGGGACAGAGGAAACAAGG - Intergenic
933758910 2:85661318-85661340 CTGTGCGGTGAGAGGGAGGATGG + Intronic
933783860 2:85822563-85822585 ATGTGGAGAGAGAGGGAGGAAGG - Intergenic
933834976 2:86238690-86238712 CTGTGGGTGCACAGGGCAGAAGG + Intronic
934563317 2:95324102-95324124 CTGTGGGGAATGAGGAGAGATGG + Intronic
935075949 2:99744040-99744062 GGGTGGGGGCAGAGGGCAGAAGG - Intronic
935156266 2:100486214-100486236 CTGTGGGGTTAGAAGCAAGATGG + Intergenic
935552698 2:104475227-104475249 CTGTGGGGACAGAGGGAATATGG - Intergenic
936925782 2:117735307-117735329 AAGTGGGGAGAGAGGGAAGGAGG + Intergenic
937044332 2:118843287-118843309 GGGTGGGGACCGAGGGCAGAAGG + Intronic
937226481 2:120373267-120373289 CTCTGGGGAGGGAGAGAAGAAGG + Intergenic
937251200 2:120524894-120524916 CTGTGAGGTCAGAGGGAACCAGG - Intergenic
937273684 2:120671023-120671045 CTCTGGGGGCAGGGGGAGGAGGG + Intergenic
937324418 2:120981785-120981807 AGGTGGGGAGAGAGGGAAGAAGG - Intronic
937639766 2:124198559-124198581 GAGTGGGGAGAGAGGGAGGAGGG - Intronic
937907745 2:127060641-127060663 CTGTGGGGACGGACGGGAGGTGG + Intronic
937985715 2:127637266-127637288 CTGTGGGTGCAGAGGGCAGGTGG - Intronic
938904539 2:135825816-135825838 CTGTGGGCTGCGAGGGAAGAGGG - Intronic
939005811 2:136785421-136785443 GTGTGGGGACAGTGAGATGAGGG + Intronic
939167080 2:138651757-138651779 GTGTGAGGACAGAGGCAGGAAGG + Intergenic
939548797 2:143588020-143588042 CTGTTTGGAAAGAAGGAAGAGGG - Intronic
939994324 2:148906125-148906147 CCTTGGGGCCAGAGGGAAAAAGG + Intronic
940039920 2:149349328-149349350 CTGTAGGTACAGAGAGAAGTAGG + Intronic
940279819 2:151977580-151977602 TTGTTTGGACAGAGAGAAGAAGG + Intronic
940368040 2:152870520-152870542 CCGTGGGGAAAAAGAGAAGAGGG + Intergenic
941273244 2:163457150-163457172 CTGAGGGTAAAGAGAGAAGAGGG - Intergenic
942526323 2:176856733-176856755 TTCAGGGGACAGAAGGAAGAGGG - Intergenic
942587809 2:177503536-177503558 TTGTGGGGACAGCAGGAAGTAGG + Intronic
942650616 2:178163553-178163575 AAGTGGGGAAAGAGGGAAGGAGG + Intergenic
942709341 2:178815007-178815029 ATGTGGAGACAGGAGGAAGATGG + Intronic
942961039 2:181829937-181829959 CTGTTGGGAGAGAAGGAGGAGGG - Intergenic
943137293 2:183929865-183929887 CTGTGGGGACAGAGACACCAAGG - Intergenic
943744923 2:191452265-191452287 CTGTGAGGCCTGAGGAAAGAAGG + Intergenic
943790621 2:191928312-191928334 CTGTGGCTACAGAAGGAAGTTGG - Intergenic
944083065 2:195811855-195811877 CTGTGAGGCCAGAAGCAAGATGG - Intronic
944176160 2:196831177-196831199 CCTAGGGGACAAAGGGAAGAGGG - Intergenic
944663007 2:201936819-201936841 TTGTCAGAACAGAGGGAAGAGGG + Intergenic
944782012 2:203028886-203028908 GTGTGGGGACAGGGGGTATATGG - Intronic
944837567 2:203595046-203595068 GTGTGGGGATAGGGGGAATATGG + Intergenic
944938047 2:204590179-204590201 CTGTGAGGACAGAGAGATGATGG - Intronic
945224464 2:207519397-207519419 TTATGGGGAAAGAGGGAGGAAGG - Intergenic
946165926 2:217863829-217863851 GTCTGGGGATAGAGGGAGGAAGG + Intronic
946247874 2:218397693-218397715 CTGTAGAGACAGAGGGCAGCTGG + Intergenic
946325136 2:218981150-218981172 GTGTGGGGACAGGAGGAAGGGGG + Exonic
946519034 2:220446500-220446522 AAGTGGGGAAAGAGGGAAGGAGG - Intergenic
946715529 2:222551287-222551309 ATGTGAGGCCAGAGGGAAAACGG - Intronic
947544275 2:231000343-231000365 CTGTGGGGACAGAAGGAGAGAGG - Intronic
947551768 2:231051451-231051473 ATGGGAGGTCAGAGGGAAGAAGG + Intergenic
948078267 2:235183924-235183946 CTGTGGAGAGACAGGGAGGAAGG - Intergenic
948098970 2:235358658-235358680 CTGAGGAGACACGGGGAAGAAGG - Intergenic
948266309 2:236637682-236637704 GTGTGGGGGCAGGGGGAAGATGG - Intergenic
948467563 2:238159463-238159485 CTTTTGGGACAGAAGGAAGTTGG + Intronic
948596329 2:239082026-239082048 CTGTGGGGGCACGGGGCAGACGG - Intronic
948674388 2:239588545-239588567 ATGTGGGGACAGAGAGGAGTGGG - Intergenic
948698175 2:239744262-239744284 CAGTGGGCACAGATGGAAGGAGG + Intergenic
948814361 2:240502357-240502379 ATGTTGGGCCAGAGGGGAGAAGG - Intronic
949040963 2:241849839-241849861 CTGTGGGGGCAGTGGGCAGGAGG - Intergenic
949042102 2:241854216-241854238 CCATGGGCACAGAGGGAACAGGG - Intronic
1168812660 20:715858-715880 ATGTGGGGAAAGTGGGGAGAGGG + Intergenic
1169137102 20:3203949-3203971 ATGGGGGGAAAGAGGGAGGATGG + Intronic
1169339268 20:4783787-4783809 CTGTGTTTAGAGAGGGAAGAGGG - Exonic
1169408933 20:5350514-5350536 CTGAGGGGACAGGGTGGAGAGGG - Intergenic
1169423474 20:5477952-5477974 GAGCTGGGACAGAGGGAAGAAGG - Intergenic
1169427525 20:5508326-5508348 GAGCTGGGACAGAGGGAAGAAGG + Intergenic
1169969718 20:11256380-11256402 CTGTGGGGACTCAGGGGAAAGGG - Intergenic
1170001702 20:11621790-11621812 CTCTGGGGTCAGGGGGAAAATGG - Intergenic
1170226530 20:13996272-13996294 CTGGGGGGACAGGGGCGAGAAGG - Intronic
1170470254 20:16661528-16661550 CTTTCGGGACTGAAGGAAGAAGG - Intergenic
1170926352 20:20727944-20727966 CTGGAAGGACAGAGGGAAGAGGG + Intergenic
1170938122 20:20827198-20827220 CAGTGGGAACTCAGGGAAGAGGG + Intergenic
1171289010 20:23969493-23969515 CATTGAGGCCAGAGGGAAGATGG + Intergenic
1172115371 20:32570507-32570529 CTGTGGGGACAGGAGGGGGAAGG - Intronic
1172547474 20:35772679-35772701 CTTTGGGGGCTGACGGAAGAGGG - Intronic
1173317886 20:41961395-41961417 CTGTGGAGACACAGGGAGGCAGG - Intergenic
1173619514 20:44426067-44426089 CTGTGGAATCAGGGGGAAGATGG + Intronic
1173642590 20:44614511-44614533 CTGTGGGGACAGAAGGCAAGGGG - Intronic
1174020826 20:47526771-47526793 CCATGGGGAGAGAGGGGAGAGGG + Intronic
1174357112 20:50005845-50005867 CTGTGGGGACTGAAGGAAGTGGG + Intergenic
1174628400 20:51935108-51935130 CTGGGAGGACAATGGGAAGAGGG + Intergenic
1174848348 20:53966462-53966484 CTTTGGGGACTCAGGGGAGAAGG + Intronic
1175039198 20:56029863-56029885 CTGTGGATACAGAGAAAAGATGG + Intergenic
1175245031 20:57577095-57577117 ATGTGGGGAGAGTGGGTAGATGG - Intergenic
1175869091 20:62199097-62199119 CCTGGGGGAAAGAGGGAAGACGG - Exonic
1175869851 20:62203703-62203725 CCCTGGGGACAGAAGGTAGACGG - Intergenic
1175889335 20:62309474-62309496 CTCTGGGGGCACAGGGAAGATGG + Exonic
1176070147 20:63222087-63222109 GTGTGGGCACAGAGGGATCAGGG - Intergenic
1176132353 20:63501716-63501738 CTGCGGGGACAGAGGCTACAAGG + Intergenic
1176357860 21:5967278-5967300 CTGCGTGGACAGAGGGCGGAGGG + Intergenic
1176382698 21:6121121-6121143 CTGTGGGAACAGAGGACAGGTGG - Intronic
1176457823 21:6928780-6928802 CTCTGGGGACGGAGAGCAGAGGG + Intergenic
1176835995 21:13793864-13793886 CTCTGGGGACGGAGAGCAGAGGG + Intergenic
1177022211 21:15876042-15876064 CTGTTGGGTGAGTGGGAAGAAGG + Intronic
1177763202 21:25426080-25426102 CTTTGGGGACTTAGGGGAGAAGG - Intergenic
1177823074 21:26053012-26053034 GTGTGGGGACAGGGGGTACACGG + Intronic
1178582795 21:33850392-33850414 CGGTGGGCACAGAGGTGAGAGGG - Intronic
1179410943 21:41162774-41162796 CTTTGGGACCAGAGGGAAGTAGG - Intergenic
1179740771 21:43417118-43417140 CTGTGGGAACAGAGGACAGGTGG + Intronic
1179765658 21:43571273-43571295 CTGCGTGGACAGAGGGCGGAGGG - Intronic
1179819018 21:43925644-43925666 CTGAGGGGACAGAGCGGAGCTGG - Intronic
1180106772 21:45623762-45623784 CAGTGATGAGAGAGGGAAGAAGG - Intergenic
1180457655 22:15524997-15525019 CTGTGGGGTCAGTGGTAATATGG - Intergenic
1180624231 22:17183402-17183424 CTGTGGGGTCAGAGAGACGAAGG - Intronic
1180785887 22:18547564-18547586 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1180926120 22:19556165-19556187 CTGCAGGGCCAGAGGCAAGATGG - Intergenic
1181131173 22:20733289-20733311 CTGTGGGCAGTGAGGGAGGAGGG - Intronic
1181242812 22:21487118-21487140 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1181463050 22:23096571-23096593 AGGTGGGGGCAGAGGGAACAGGG + Intronic
1181467388 22:23117519-23117541 ATGCTGGGACAGAGGGAAGCAGG + Intronic
1181530152 22:23512815-23512837 AGGTGGGGTCAGAGGGCAGATGG + Intergenic
1181530517 22:23514536-23514558 CTGGGTGGGCAGAGGGGAGAGGG - Intergenic
1181712693 22:24700541-24700563 ATTTGGTGACAGAGGGAAGGAGG - Intergenic
1182332192 22:29559018-29559040 TTTAGGGGACAGTGGGAAGAGGG - Intronic
1182359538 22:29738442-29738464 CTGTGGGGACAGGGAGACAAAGG + Intronic
1182446588 22:30393242-30393264 CTGTGGTGCCAGGGGGAAGGGGG - Intronic
1182464730 22:30507325-30507347 ATGGGAGGACAGAGGGAACAGGG - Intergenic
1182760859 22:32721273-32721295 GGGTGGGCACAGAGGAAAGAGGG + Intronic
1182916505 22:34037672-34037694 CTGAGGGGACAGAGAAGAGATGG + Intergenic
1183094169 22:35542209-35542231 CTGTGGTGTCAGAGACAAGATGG + Intronic
1183219718 22:36504771-36504793 AGGCGGGGACAGAGGAAAGATGG + Intronic
1183354545 22:37351162-37351184 CTGGGAGGAGAGAGGGGAGAAGG - Intergenic
1183399348 22:37592871-37592893 CTGTGGGGATTGAGAAAAGAGGG - Intergenic
1183467298 22:37986193-37986215 CTGGATGGACAGAGGGACGAGGG + Intronic
1183499312 22:38168944-38168966 CTATATGGACAAAGGGAAGAAGG - Intronic
1183502845 22:38191402-38191424 CTGTGGCGAGACAGGGAGGAAGG - Intronic
1183614900 22:38938101-38938123 CTGTGGGGACAGAGATTAGCAGG + Intergenic
1183989900 22:41590683-41590705 ATGTGTGGACAGAAGGAATAAGG - Intergenic
1184212502 22:43044120-43044142 CAGCGGGGACAGGGAGAAGATGG - Intronic
1184257919 22:43297472-43297494 CTGTGAGGACCGAGTGGAGATGG - Intronic
1184515140 22:44957096-44957118 CTGTGAGCTCAGAGGGAGGAGGG - Intronic
1184694982 22:46134082-46134104 CTGTGGGGAGAGGGGGCAGCAGG - Intergenic
1185177316 22:49335237-49335259 CTGTGGGGACCGATGGGAGCAGG + Intergenic
1185212364 22:49577476-49577498 CTGTGGGGAGAGAGGGACTGTGG - Intronic
949749086 3:7330391-7330413 CAAGGGGGACAGAGAGAAGAGGG - Intronic
949918923 3:8986247-8986269 CTGGGGGCTCAGAGGGATGAGGG - Intronic
950158180 3:10739502-10739524 CTGTGAGGACAGAGGGGCAAGGG - Intergenic
950166862 3:10807554-10807576 CTGTGAGGACACAGGGAAAAAGG - Intergenic
950266246 3:11575213-11575235 CTGTGGTGCGAGAGGGAAGGCGG + Intronic
950426557 3:12927630-12927652 CTCAGAGCACAGAGGGAAGAGGG + Intronic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
951781522 3:26368596-26368618 GTGGGGGGACAGAGAGAAGCTGG + Intergenic
951965727 3:28382322-28382344 ATGTGAGGACAGGGAGAAGATGG - Intronic
952083357 3:29787670-29787692 CTTTGGGGACTCAGGGAAAAAGG + Intronic
952083997 3:29795711-29795733 CTGGGAGGAAGGAGGGAAGAGGG + Intronic
952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG + Intergenic
952846433 3:37691410-37691432 CAGTGAAGACAGTGGGAAGATGG + Intronic
953920675 3:46949261-46949283 CAGTGGGGACAGAGGGACGGAGG + Intronic
953925570 3:46980770-46980792 CTGTGGGTACAGAAGGAAAATGG - Intronic
953980409 3:47410521-47410543 CGGTGGGGGCACAGGGAAGCAGG - Exonic
954400145 3:50315236-50315258 CTGTGGGGAAAGCGGGGAGTGGG - Intergenic
954776774 3:53026591-53026613 CTGTGGGGGCACAGGGAGGGAGG - Intronic
955122553 3:56075303-56075325 ATGTGAGGGCAGAGGAAAGAGGG + Intronic
955193894 3:56787223-56787245 ATGTTGGGGCAGAGGGAAGGAGG - Intronic
955527447 3:59836013-59836035 CTATGGGGAGTGAGGGAAAATGG - Intronic
955536078 3:59925106-59925128 CTGTGGGGAGAGAGAAAAGAAGG - Intronic
956210854 3:66799767-66799789 CTATGGGGCCAGCAGGAAGAAGG - Intergenic
956744182 3:72298568-72298590 TTGTGGGGAGAGAGTGATGAGGG + Intergenic
959143659 3:102517263-102517285 GTGAGGGGACAAAGAGAAGATGG + Intergenic
959336397 3:105070581-105070603 ATGGAGGGACAGAGGGAAGTGGG + Intergenic
960029548 3:113043407-113043429 CTTCAGGGACACAGGGAAGAGGG + Intergenic
960124806 3:113986810-113986832 GTTTGGAGACAGAGGGGAGAGGG - Intronic
960923678 3:122774737-122774759 CTGTGGAGACAGACAGAAGCAGG + Intronic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961341477 3:126224935-126224957 CGGTGGTGACCAAGGGAAGAAGG + Intergenic
961450004 3:126998409-126998431 CTGTGGGGACACAGGCAGCAGGG - Intronic
961471460 3:127115754-127115776 GAGTGGGGACAGGGGCAAGAAGG + Intergenic
961666804 3:128497821-128497843 CTCTGGGGAGATAGGGAAAATGG - Intergenic
961677689 3:128577684-128577706 CTGTTGGGGCAGAGGGCAGGTGG - Intergenic
962038530 3:131680827-131680849 CTGTGGGGACGCAGGGGAAAGGG - Intronic
962313419 3:134342092-134342114 CAGAGGAGACACAGGGAAGAAGG + Intergenic
962850558 3:139305579-139305601 GTCTGAGGACAGAGGGGAGATGG + Intronic
963613715 3:147507493-147507515 TTGGGGGGAGGGAGGGAAGAAGG - Intronic
963990326 3:151645961-151645983 CTCTGTGAACAGAGGGAATAGGG - Intergenic
964580327 3:158227293-158227315 TCTTGGGGGCAGAGGGAAGAGGG - Intronic
964691669 3:159456598-159456620 TTTGGGGGACAGAAGGAAGAGGG + Intronic
964800698 3:160554366-160554388 GGGTTGGGACAGAGGGAAAAGGG - Intronic
965722153 3:171673844-171673866 ATGTGGGGACAGAAGTAGGATGG - Intronic
966220943 3:177550472-177550494 CTTTGGGGACTCAGGGAAAAGGG + Intergenic
966476524 3:180354609-180354631 CTGTGGGGACAAAGGCAAAATGG - Intergenic
966562387 3:181337407-181337429 ATGTGGGGCCAGAGGGTATATGG + Intergenic
966774660 3:183533379-183533401 CTGGGGAGCCTGAGGGAAGAGGG - Intronic
966811986 3:183855135-183855157 CTGAGGGGAAGGAGGGAAGGAGG + Intronic
967072139 3:185971497-185971519 CAGTGGGGAGAGGGGGTAGAGGG + Intergenic
967214913 3:187201568-187201590 CAGTGGGGTCAGGGGGCAGAAGG - Intergenic
967525353 3:190486523-190486545 GTGTGGGGGCAGTGGAAAGAGGG + Intergenic
967631050 3:191743214-191743236 CCTAGGGGACAAAGGGAAGAGGG - Intergenic
968077645 3:195825226-195825248 CTCTGGGGCCAGAGGGAAGCTGG - Intergenic
968538263 4:1148783-1148805 CTGTGGAGACTGAGGCAGGAGGG - Intergenic
968905791 4:3449956-3449978 CTGTGGGGGCTGAGGGAGGGAGG + Intergenic
969276698 4:6140535-6140557 CTGCAGGGTCAGAGGGAAGTCGG + Intronic
969354468 4:6617357-6617379 CTTTGGGGACAGAAGGAAGGTGG - Intronic
969443524 4:7231692-7231714 CGGTGGGGACACAGAGGAGAGGG + Intronic
969525443 4:7701793-7701815 ATGGAGGGGCAGAGGGAAGACGG + Intronic
969664344 4:8548468-8548490 CTATGGGTGCAGAGGGAACAAGG + Intergenic
969872963 4:10116281-10116303 CGGCGGGGACAGAAGGGAGAAGG + Intronic
969882642 4:10187790-10187812 CTGAGGGGACAGTTGGAAGGTGG + Intergenic
970011784 4:11467634-11467656 CTGAGGGGTGAAAGGGAAGAAGG + Intergenic
970326557 4:14930941-14930963 ATGTGAGGACACAGCGAAGATGG + Intergenic
970436928 4:16044827-16044849 CTGAGGGGACAGGGGGAAGTAGG + Intronic
970764561 4:19532014-19532036 TTGTGGAGACAAAGGAAAGAAGG + Intergenic
972579682 4:40384240-40384262 TAATGGGGATAGAGGGAAGAGGG + Intergenic
972639391 4:40911886-40911908 GTGTAGGGGCAGAGGGAGGAGGG - Intronic
972662865 4:41133737-41133759 CAGTGGGGAGAGAGGGACCAAGG - Intronic
974514380 4:62890145-62890167 GTGTGGGGCAAGAGGAAAGAGGG - Intergenic
975581630 4:75912004-75912026 CTGTGAGGCTAGAAGGAAGATGG + Intergenic
976144947 4:82033033-82033055 CTCAGGGGACAGAGGGAAAGAGG + Intronic
976261467 4:83148948-83148970 ATGTGGGTAGAGAGGGAAGAGGG + Intergenic
976322192 4:83728376-83728398 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
976444566 4:85116023-85116045 CTGGGGGGACAGAGAGAGGCAGG - Intergenic
976609587 4:87016191-87016213 TTGTGGGGAAAGAGGGAAGAGGG + Intronic
976818297 4:89175404-89175426 AGGTTGGGAAAGAGGGAAGATGG - Intergenic
976837010 4:89386116-89386138 ATGGAGGGACAGAGGGAAGAAGG + Intergenic
977172898 4:93784562-93784584 CTATGGAGACAGACAGAAGATGG + Intergenic
977390158 4:96399020-96399042 CTGTGTGGACAGGGGAAAGAAGG - Intergenic
977637788 4:99320205-99320227 CTTTGGGGACTGAGGGAAAAGGG - Intronic
977662233 4:99603231-99603253 CAGTGGAGACACAGGAAAGATGG + Intronic
978049016 4:104172096-104172118 GAGTGGGGAGAGTGGGAAGAGGG - Intergenic
978318525 4:107466974-107466996 CTGTGGGGGCCGAGGGAGGCTGG - Intergenic
978685077 4:111431190-111431212 ATGTGGGGGCTGAGGGAAGAGGG + Intergenic
978822977 4:112987262-112987284 CAGTGGGGACAGAGGGATGGTGG + Intronic
978843932 4:113249486-113249508 CTGTGTGGACAGAGGGTCAATGG - Intronic
978990492 4:115076080-115076102 TTGTTGGGAAAGAGGGAACAAGG - Exonic
979392754 4:120146003-120146025 ATGTTGGGGCAGTGGGAAGAAGG - Intergenic
979408606 4:120345445-120345467 CTGTGAGGACCGTGGGAAGCAGG + Intergenic
979458525 4:120953322-120953344 CTGTGAGGCTAGAGGCAAGATGG - Intergenic
979848867 4:125551801-125551823 CTGTGGTGACAGTGGAAATAAGG + Intergenic
980467224 4:133201934-133201956 CTTTGGGAGCAGAGTGAAGAAGG + Intronic
980569731 4:134598675-134598697 CTTTGGGGACTCAGGGAAAAGGG + Intergenic
980586383 4:134821948-134821970 CTTTGGGGACTCAGGGAAAAGGG - Intergenic
982150432 4:152449349-152449371 CTTTGAGGACTGATGGAAGAGGG + Intronic
982807300 4:159782413-159782435 GTGTGGGGATAGAGGGCATATGG - Intergenic
983809872 4:172048462-172048484 CTGTGGTGACTGAGGGAAAATGG - Intronic
984040649 4:174728854-174728876 GTGTTGGGACAGAGGGAGGATGG + Intronic
984580269 4:181502705-181502727 CCATAGGGAAAGAGGGAAGAAGG + Intergenic
984943629 4:184954643-184954665 CTGTGAGGACACCGGGGAGACGG - Intergenic
985100482 4:186453257-186453279 CTGTGGGGCTAGAAGCAAGATGG + Intronic
985477728 5:89216-89238 GTGTGTGGACAGAGGGGAGGAGG - Intergenic
985589434 5:756976-756998 CTGTGGGGGCACTGGGGAGAGGG + Intronic
985746893 5:1652903-1652925 CTGGGGGGACACGAGGAAGATGG + Intergenic
985762187 5:1755006-1755028 GTGTGAGGACACAGGGAGGAGGG + Intergenic
986007794 5:3682841-3682863 CTCTGGGGACTCAGGGGAGAGGG - Intergenic
986259485 5:6131782-6131804 CTTTGGGGACTGAGGGGAAAGGG + Intergenic
986333940 5:6738855-6738877 CTGTGGTTACAGAGGGAAATTGG + Intronic
986669864 5:10133243-10133265 GTGTGGGGACAGAGGGGATAAGG - Intergenic
987096199 5:14552597-14552619 ACGTGAGGACACAGGGAAGATGG + Intergenic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
987245163 5:16041525-16041547 CTGTGGGGGCAGAGGGGAGGGGG - Intergenic
987878336 5:23710274-23710296 GTGAGGGGACAGAGCCAAGATGG + Intergenic
988011963 5:25500438-25500460 TAGAGGGGAGAGAGGGAAGAAGG - Intergenic
988352364 5:30126751-30126773 ATGTGGGGGCAGAGGGTATATGG - Intergenic
989185141 5:38616517-38616539 CTGTGGGGAAACTGGGAAGAAGG - Intergenic
989209701 5:38846533-38846555 GTGTTGGGAGAGAGGAAAGAGGG - Intronic
989623835 5:43410678-43410700 CTGTGGGGACAGGTGGGAGTAGG + Intronic
990112844 5:52349273-52349295 CTTTGGGGACTCAGGGAAAAGGG - Intergenic
990544967 5:56814459-56814481 GAGTGGGGACAGAGGGAACCCGG + Intergenic
992846606 5:80755647-80755669 CTGAGGGAACAGATGGAAAAAGG + Intronic
993857348 5:93092951-93092973 CTGTGGAGACAGATAGAAAAGGG - Intergenic
994182519 5:96783090-96783112 CCGTGCGTACAGAGGGCAGAAGG - Exonic
995126935 5:108586885-108586907 GGGTGGGGAGAGAGGGAAGGGGG + Intergenic
996424335 5:123296468-123296490 ATTTGGGGACAGAAGGGAGAGGG + Intergenic
997174514 5:131760855-131760877 CAGGAGGGAAAGAGGGAAGAAGG + Intronic
997212458 5:132085493-132085515 CTGTGGGGAGAGAAGCAGGAAGG - Intergenic
997466266 5:134090106-134090128 ATGTGGGGACTGATGGAAGGAGG - Intergenic
997517503 5:134501463-134501485 CTGTGGGGACAGAGGAAAAGAGG + Intergenic
997976853 5:138445941-138445963 CTGTGGGGGTTGAGGGTAGAGGG + Exonic
998114703 5:139527281-139527303 CTGTGGGGAGAGGGGGAAGGGGG - Intronic
998318816 5:141210029-141210051 CTCTGGGGACAACGGAAAGATGG + Exonic
999217165 5:149944889-149944911 CTGTGGGGCCAGATGGGAGAAGG + Intergenic
999582190 5:153051182-153051204 CTATGGAGACAGACAGAAGAGGG - Intergenic
999961816 5:156764041-156764063 TTCTTGGGACAGGGGGAAGAGGG - Intronic
1000646179 5:163762963-163762985 TTGTGGAGAGAGAGGGAGGAGGG + Intergenic
1000926691 5:167202827-167202849 CTGCAAGGACACAGGGAAGAGGG - Intergenic
1001170038 5:169410584-169410606 ATGTGGGGACAGAGGTATGCAGG + Intergenic
1001515716 5:172354006-172354028 CTGTGGGGACAAAAGGAAGCTGG + Intronic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1002133126 5:177093309-177093331 CTGTCGGGCCAGAGGGAAGCGGG - Exonic
1002359377 5:178658588-178658610 CTGTGTGCACACAGGGAAGATGG + Intergenic
1002460164 5:179369347-179369369 GTGTGGGGACAGAGCGAAGGCGG - Intergenic
1002484400 5:179524431-179524453 CCGTGGGGACACATGGAAGCTGG - Intergenic
1002500175 5:179643057-179643079 CCGTGGGGACACATGGAAGCTGG + Exonic
1002501797 5:179651704-179651726 CCGTGGGGACACATGGAAGCTGG - Intergenic
1002679771 5:180952066-180952088 CTGTGTGGGCAGAGGGTATATGG - Intergenic
1002839484 6:893749-893771 CTGTGGGGACAGAGGAAGAAAGG - Intergenic
1003214327 6:4095221-4095243 CTGTGGCCACAGAGAAAAGAGGG - Intronic
1003242120 6:4353927-4353949 GTGAGGGCAGAGAGGGAAGAAGG - Intergenic
1003252249 6:4440304-4440326 CTTTGGGGACTCAGGGAAAAAGG - Intergenic
1003586188 6:7391038-7391060 GTCTGGGGAAAGAGGGATGAAGG + Intronic
1003860669 6:10319389-10319411 CCGTGGGGATAGAGGGACGTGGG + Intergenic
1003972173 6:11310306-11310328 CAGTGGGCAGAGAGGGAAGTGGG - Intronic
1004785168 6:18960531-18960553 CTTTGGGGAGAGAGAGAAAAAGG - Intergenic
1005127880 6:22469845-22469867 CTGTGGGGAGGGAGGCAATAGGG + Intergenic
1005332614 6:24764410-24764432 CTGTGGAGAAGGAGGTAAGAGGG - Intergenic
1005805227 6:29468320-29468342 CTGTGGAGCCAGAGGAAAGGAGG - Intergenic
1005878224 6:30032030-30032052 TTCTGGGGACAAAGGGAAGGTGG + Intergenic
1005979338 6:30824431-30824453 GAGTGGGGACAGATGGGAGATGG + Intergenic
1006054063 6:31367524-31367546 CTGGGTGCTCAGAGGGAAGATGG + Intergenic
1006150433 6:31984050-31984072 CTGTCGTGGCAGAGAGAAGAGGG - Intronic
1006156734 6:32016788-32016810 CTGTCGTGGCAGAGAGAAGAGGG - Intronic
1006751594 6:36381268-36381290 CTGTGGGGTCTGAGGGATGCCGG + Intronic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1006871571 6:37256820-37256842 ATTTGGGGAAAGAGGGAAGGCGG - Intronic
1006945040 6:37779295-37779317 CTGAGAGGCCAGAGGGAAAAGGG + Intergenic
1007107510 6:39293978-39294000 CTGTGGGGACAGTGGCAGAAGGG - Intergenic
1007337377 6:41163247-41163269 GGGTGGGGACAGAGGGGAGGAGG + Intergenic
1007406418 6:41638451-41638473 CTGGAGGGAGAGAAGGAAGAAGG + Exonic
1008043423 6:46827380-46827402 CTCTGGAGAGAAAGGGAAGATGG - Intronic
1008418322 6:51268709-51268731 CTGGAGGAACAGGGGGAAGAGGG - Intergenic
1009370125 6:62889123-62889145 CCGTGGGAAGAGAGAGAAGAGGG + Intergenic
1009413799 6:63394952-63394974 CAGTGCACACAGAGGGAAGAAGG - Intergenic
1009787458 6:68358247-68358269 CTGGGGGGTCAGGGGCAAGATGG + Intergenic
1009979934 6:70715891-70715913 CTTTGGGGACTGGGGGAAAAGGG - Intronic
1010015059 6:71095405-71095427 CTGAGGGGACAGTTGGGAGAGGG - Intergenic
1010390030 6:75326332-75326354 CTTTGGGGACTCAGGGAAGTGGG + Intronic
1011031555 6:82929793-82929815 GTGTGGATACAGAGGGAATATGG - Intronic
1011275944 6:85631407-85631429 GAGTGGGGAAAGAGGTAAGAAGG + Intronic
1012247043 6:96937717-96937739 CTGTGAGGATGGAGGGTAGAGGG - Intronic
1012359678 6:98361724-98361746 CAGTGAGGTCAGAGGGAAGAAGG + Intergenic
1012433734 6:99192933-99192955 CTTTGGTGAAAGAAGGAAGAAGG - Intergenic
1012687094 6:102265688-102265710 GGCTGAGGACAGAGGGAAGATGG - Intergenic
1013299882 6:108794996-108795018 CTTTGGGGACAAAAGGAGGAAGG + Intergenic
1013680709 6:112522411-112522433 CTGTGAGGCTAGAAGGAAGATGG - Intergenic
1013703639 6:112805710-112805732 ATGTGGGGAGAGATGGAAGGAGG - Intergenic
1014419920 6:121230945-121230967 CTTTGGGGACTCAGGGAAAAGGG - Intronic
1014545852 6:122734467-122734489 GTGTGGTGACAGAGGGAAGATGG + Intergenic
1014624293 6:123707070-123707092 CTCTAGGGACAGAGGCAAAAAGG + Intergenic
1014688636 6:124533870-124533892 GTGAGGACACAGAGGGAAGATGG - Intronic
1014951007 6:127556312-127556334 CTGTGGGGAGAGAGTGGAGGTGG - Intronic
1015330889 6:131977890-131977912 CTGGGGGCTCAGAAGGAAGAGGG - Intergenic
1015380021 6:132556437-132556459 CTTTGGGGACTCAGGGGAGAAGG - Intergenic
1015901465 6:138072405-138072427 TTGTGGAGACAGAGGGAAAATGG + Intergenic
1015980276 6:138831418-138831440 CTATGGAGAAAGAGGGAAGAGGG - Intronic
1016521458 6:144951341-144951363 CTGTGGATACTGAGGGATGATGG - Intergenic
1016605490 6:145918616-145918638 CCAGGGGGACAGAGGAAAGAAGG - Intronic
1016866630 6:148773946-148773968 CGGGGAGGACAGAGGGAAGCTGG - Intronic
1017279125 6:152604765-152604787 TTGTAGGGACAGTGGGAAGGGGG - Intronic
1018176713 6:161183844-161183866 CTCTGGGGACATGGGGAAGCAGG + Intronic
1018305677 6:162452798-162452820 CTACGTGGACAGAGGGAAGTGGG + Intronic
1018366312 6:163123305-163123327 CTGTGGTGACAAGGAGAAGAGGG + Intronic
1018923958 6:168193979-168194001 CCGTGGGGACTGAAGGAAAATGG - Intergenic
1019113746 6:169739484-169739506 CTGTGGGGAGAATGGGAAGTTGG + Intergenic
1019215264 6:170439040-170439062 CTGGGGGGACAGAAGGCTGAGGG + Intergenic
1019340581 7:507134-507156 CTGAGGGGACAAAGGTCAGAGGG - Intronic
1019427455 7:984303-984325 GGGTGGGGACAGAGGGAAAATGG - Intronic
1019438474 7:1033918-1033940 CAGTGGGGACAGTGGGAGGGTGG - Intronic
1019442221 7:1053153-1053175 CTCTGGGCACAGAGGCAAGCGGG + Intronic
1020635383 7:10690611-10690633 CTTTGGGGACTCAGGGAAAAAGG + Intergenic
1020891402 7:13882393-13882415 TTGTGGGGAGAGAGTGAACACGG + Intergenic
1021123147 7:16819717-16819739 GAGTGGGGAGGGAGGGAAGAGGG - Intronic
1021425418 7:20494732-20494754 ATGTGAGGACACAGTGAAGATGG + Intergenic
1021840326 7:24717133-24717155 CTGTGGGAAGAGAGGGAAAGAGG - Intronic
1022411355 7:30141004-30141026 CTGTGGTCACACAGGGAACAAGG - Intronic
1022470001 7:30676296-30676318 CTGCTGGGAGAGAGGGAAGGTGG - Intronic
1022540328 7:31128957-31128979 CTGTGGAGAAAAAGGGAGGAGGG - Intergenic
1022563672 7:31375221-31375243 CTGTGGGTACAGAGGTAAATGGG - Intergenic
1024047085 7:45592309-45592331 GTGAGGGCACAGAGGGAAGGCGG - Intronic
1024337529 7:48224492-48224514 CAGTGGGGAAAGAGGGAAAGAGG - Intronic
1024391413 7:48816947-48816969 GAGTGGGGACAGAGGGATGAAGG + Intergenic
1024791316 7:52967832-52967854 ATGTGGGGATACAGGGAAGGGGG - Intergenic
1024847347 7:53662377-53662399 CTGTGGGGTTAGAGTGAAGGAGG - Intergenic
1026105482 7:67417559-67417581 CTGTGTGGACATAGTGAAAATGG + Intergenic
1026509954 7:71019484-71019506 CACTGGGAACAGAGGGGAGATGG - Intergenic
1026769707 7:73187882-73187904 GAGTGGGGACAGAAGGAAGGCGG + Intergenic
1026845549 7:73697137-73697159 CTGAGGGGTATGAGGGAAGAAGG - Intronic
1026902598 7:74045302-74045324 CTGTCTGGACAGAGGGCTGATGG + Intronic
1026955798 7:74375864-74375886 CTGTGGGGAGAGAGGGAGACAGG - Intronic
1027010575 7:74741264-74741286 GAGTGGGGACAGAAGGAAGGCGG + Intronic
1027077467 7:75204776-75204798 GAGTGGGGACAGAAGGAAGGCGG - Intergenic
1027268996 7:76510235-76510257 GGGTGGGGACAGAAGGCAGAGGG + Intergenic
1027743327 7:82040649-82040671 CTGTGTGGAGACAGGGAAGATGG + Intronic
1028193696 7:87880206-87880228 CTGTGGAGATAGAAGAAAGAAGG - Intronic
1028428103 7:90713553-90713575 TTGTGGGGAGAGAGGGAAGATGG + Intronic
1028624840 7:92865862-92865884 TTGAGGGGAGAGAGTGAAGAGGG + Intergenic
1028879577 7:95864973-95864995 TTGTGGGGAAAGGGGGAAGGTGG + Intronic
1029252567 7:99247571-99247593 CTGGTGGGAGGGAGGGAAGATGG - Intergenic
1029481575 7:100816669-100816691 CTGGGGGTACAGAGTGAAGCAGG + Intronic
1029714737 7:102319806-102319828 CTGTGGGAACAGCTGGAACAGGG - Intronic
1030187729 7:106779972-106779994 CTGTGGGAAAAGAGGGAGCATGG - Intergenic
1030318343 7:108139175-108139197 ATGTGAGGACAGAGAGAAGGTGG - Intergenic
1030380358 7:108803946-108803968 CAGGGGGGAGAGAGGGAAGCAGG - Intergenic
1030524309 7:110635199-110635221 CTGTGGGCACATAGGTAGGATGG - Intergenic
1031047111 7:116903723-116903745 CTGTGGGCCCAGAGGCAAGGTGG + Intronic
1031089990 7:117342886-117342908 CTTTGGGGACTCAGGGAAAAGGG - Intergenic
1032201444 7:129825548-129825570 CTGTCGGGAAAGGAGGAAGAAGG - Intergenic
1032534141 7:132646556-132646578 CTGTGAGGACACAGTGAGGATGG + Intronic
1032547518 7:132756128-132756150 CTTTGGGAGCAGAGGGCAGAAGG - Intergenic
1032549133 7:132768025-132768047 CTTTGGAGACCGAGGGGAGAGGG - Intergenic
1032897954 7:136273088-136273110 CTGTGAGGACAGAGATAACATGG - Intergenic
1033074949 7:138240118-138240140 CTGTGCGGCCAGAAGGAAGATGG + Intergenic
1033151309 7:138917040-138917062 CTCTGTGGGCAGAGGGAAGGGGG + Exonic
1033286894 7:140049202-140049224 CTGAGAGGACTGAGGGAACAAGG + Intronic
1033653896 7:143361267-143361289 CTGGGGGAAAAGAGGAAAGATGG + Intronic
1033890497 7:146006864-146006886 CTTTGGGGACACAGGGGAAAGGG + Intergenic
1034211476 7:149367303-149367325 GGGTGGGGAGAGGGGGAAGAGGG + Intergenic
1034277210 7:149829206-149829228 CTGAGGGGACTGTGGGAAGAGGG - Intergenic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035181565 7:157093113-157093135 CGGTGAGGACAGAGGTAAGATGG - Intergenic
1035203653 7:157281361-157281383 CTGCAGAGACAGAGGGCAGATGG + Intergenic
1035204951 7:157289277-157289299 CTGTGTGAACTGAGGGAAGTCGG - Intergenic
1035836160 8:2754410-2754432 GGGTGGGGCCAGAGGGTAGATGG + Intergenic
1035961937 8:4147347-4147369 CACTGAGGACTGAGGGAAGAAGG - Intronic
1036010544 8:4717075-4717097 CTCGGGGCAGAGAGGGAAGAAGG - Intronic
1036627609 8:10484419-10484441 CTGTGGGGACTGAGTATAGAAGG + Intergenic
1036660093 8:10702297-10702319 CAGTGGGGGCTGAGGGAGGAGGG - Intronic
1036950691 8:13136325-13136347 GAGTGGGGAGAGAGGGAGGAAGG - Intronic
1036988193 8:13560764-13560786 CTGTGGGGGGGGAGGGAAAAAGG + Intergenic
1037017169 8:13923408-13923430 ATGTGGGAACAGAGGGCATAAGG - Intergenic
1037079875 8:14771254-14771276 GTGTGGGGTCAGAGGAGAGAGGG + Intronic
1037098892 8:15018625-15018647 ATGCAGGGACAGAGGGGAGAAGG + Intronic
1037877311 8:22554429-22554451 CTGTGGGGAAGGAGGAAGGAAGG - Intronic
1037901585 8:22692234-22692256 GTGTGGGGACGGCGGGGAGAAGG - Intronic
1037935923 8:22915065-22915087 CTGTGGGGATATTGGGGAGAGGG - Intronic
1037962815 8:23111697-23111719 CTGTGGGGACAAAGGAGTGATGG - Intronic
1038214870 8:25552299-25552321 CTGAGGGGTCAGAAGGAAGTGGG + Intergenic
1038435406 8:27532206-27532228 ATGTGGGGGCTGAGGGGAGAGGG - Intronic
1038745683 8:30252857-30252879 TGGTGGGGACAGCTGGAAGACGG + Intergenic
1039045907 8:33449200-33449222 CTGTGGGCACTGAGAGAAGAAGG + Intronic
1039086970 8:33789626-33789648 ATGTGGGGAAAGATGGAAGCTGG + Intergenic
1039366660 8:36935183-36935205 CAGTGGGAAGAGGGGGAAGACGG - Intronic
1039438947 8:37581394-37581416 CTGGGGGCACAGAAGGAACATGG - Intergenic
1039808942 8:41027646-41027668 CAGTGGGGGCAGAGGGAATCTGG - Intergenic
1040384256 8:46902984-46903006 CACTGGGGACAGAGGGAAGAGGG + Intergenic
1040543122 8:48377069-48377091 CTGTGGGGCCTGAGGGAAGCTGG + Intergenic
1040697753 8:50022749-50022771 CAGTGGGAACAGAGGCAACATGG - Intronic
1041046772 8:53895018-53895040 CTGTGCGGGGAGAGGGAAGGAGG + Intronic
1041192427 8:55367133-55367155 CGGTGGGCACACAGGGAAGGAGG - Intronic
1041240323 8:55843645-55843667 CTGTGAAGACAGAGAAAAGATGG + Intergenic
1041447695 8:57970775-57970797 AGGAAGGGACAGAGGGAAGAAGG - Intergenic
1042262366 8:66872363-66872385 TGGTGGGGTCATAGGGAAGAAGG - Intronic
1042335738 8:67628532-67628554 CAGTGGCTACAAAGGGAAGATGG - Intronic
1042420662 8:68584881-68584903 CTGTGGAGCCAGAGGGAGAAGGG - Intronic
1042942123 8:74118381-74118403 AGGTGGGGAGAGAGGGAAGAAGG - Intergenic
1043132029 8:76473406-76473428 ATATGGGAACAGAGGCAAGATGG - Intergenic
1043172929 8:76987700-76987722 CAATGGGGACAGAGAGAAAAGGG + Intronic
1043691621 8:83160474-83160496 CTTTGGGGACTCAGGGAAAAGGG - Intergenic
1044727665 8:95206632-95206654 CTGTTGGGAAGGAGGAAAGAGGG - Intergenic
1044892935 8:96856308-96856330 CTGTGGAGACAGTGGGCAGTGGG + Intronic
1045085574 8:98680198-98680220 CTGTGCAGACAGAGCTAAGAGGG + Intronic
1045149770 8:99391392-99391414 CTGTGGGGACAGATGAGGGAGGG + Intronic
1045622377 8:103995461-103995483 CAGTGGAGACAGAGGGAGAATGG + Intronic
1045826967 8:106409261-106409283 TTGTGGGGCCAAAGGGAGGATGG + Intronic
1046002426 8:108437131-108437153 CAGTGGGGATAGAGGTATGATGG - Intergenic
1046768735 8:118098000-118098022 GTGTGGGGAAAGCGGGGAGAAGG + Intronic
1046958266 8:120083666-120083688 CTGAAGGGACTGTGGGAAGAAGG - Intronic
1047346873 8:124037475-124037497 CAGTGGGGACAGAGGGACAGTGG + Intronic
1047498727 8:125426833-125426855 CTGTGGGAAGAGGGGGAGGAAGG + Intergenic
1047613753 8:126545769-126545791 TTGTGGGGAGAGGGGGAGGAGGG + Intergenic
1047986774 8:130243554-130243576 GTGTGGGAACAGAGGGGAGAGGG - Intronic
1048210401 8:132449939-132449961 CTCTGGACACAGTGGGAAGAGGG - Intronic
1048235582 8:132686658-132686680 CAGTGGTGATAGAGGGAAGTGGG + Intronic
1048300306 8:133246358-133246380 CTTTGGGGATAGAGGGACCAGGG - Intronic
1048393907 8:133994720-133994742 CTGTGGAGACACGGAGAAGATGG + Intergenic
1048492388 8:134906199-134906221 CAGTGGGGAAAGAGGGATGCTGG - Intergenic
1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG + Intronic
1048905457 8:139083926-139083948 CTGTGGGGAATGAGGGAATAAGG - Intergenic
1049348990 8:142154076-142154098 CTGTGGGGAGAGCTGCAAGAGGG - Intergenic
1049610230 8:143551743-143551765 CAGTGGGGAGAGTGGGATGAGGG - Intergenic
1049747506 8:144269231-144269253 CAGTGGGCACAGAGAGAAGAAGG + Intronic
1049950013 9:634741-634763 CTGTGAGGCCAGAAGCAAGATGG + Intronic
1050313353 9:4375342-4375364 GTGTGGGTACAGAGAGAAAAGGG + Intergenic
1050414152 9:5397624-5397646 AAGAGGGGAGAGAGGGAAGAAGG + Intronic
1050441550 9:5669290-5669312 CTTTGGGGACTCAGGGAAAAGGG - Intronic
1050475364 9:6034979-6035001 CAGTGGGGAGAGGGGGAAGCGGG - Intergenic
1051202441 9:14642661-14642683 ATGTGGGGACAGAGAGAAGGTGG + Intronic
1052219535 9:26002637-26002659 CTTTGGGGACTTAGGGAAAAGGG + Intergenic
1052834515 9:33240574-33240596 CTGTGGGGACAGAAGGGAGCAGG + Intronic
1052859390 9:33427520-33427542 CTGTGGGGAGAGAGAAAGGAAGG + Intergenic
1052916204 9:33925950-33925972 CTGTGGGGACAGAGGGGAATAGG - Intronic
1052977388 9:34421292-34421314 CTGGGGGTACAGAGGTAAGGAGG + Intronic
1053018157 9:34675837-34675859 CTGGGGTGTCAGAGGGAAGTAGG + Intergenic
1053188675 9:36040770-36040792 ATGTGGGAAGTGAGGGAAGAAGG + Intronic
1053205818 9:36185779-36185801 ATGTGAGGACAGAGTGAAGGTGG + Intergenic
1053286201 9:36850964-36850986 CTGTGGGGGCAGAAGGCAGGTGG + Intronic
1054814674 9:69463739-69463761 CTGCAGGGAGTGAGGGAAGAAGG + Intronic
1055447988 9:76402102-76402124 TTCCGGGTACAGAGGGAAGAAGG + Intergenic
1055845238 9:80554636-80554658 TTGTGGTCACAGAGAGAAGATGG + Intergenic
1056408800 9:86303970-86303992 CTGGGAGTACAGAGGGAATAGGG + Intronic
1056665250 9:88576577-88576599 CTGAGGGGAGAAGGGGAAGAGGG + Intronic
1056812688 9:89776625-89776647 CTGTGGGGCAAGGGGGCAGATGG + Intergenic
1056832865 9:89930890-89930912 ATGTGTGGACTGAGAGAAGAAGG + Intergenic
1056844893 9:90029126-90029148 GTGTGGGGGCAGAGGGTAAATGG + Intergenic
1056897495 9:90564500-90564522 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
1057369441 9:94456935-94456957 GGGTGGGAAAAGAGGGAAGAAGG - Intronic
1057370039 9:94462971-94462993 GTGAGGGGACACTGGGAAGAGGG + Intergenic
1057503984 9:95617829-95617851 CCTTGGGGAGAGACGGAAGAGGG + Intergenic
1058061968 9:100507014-100507036 CAGTGGGGAGAGAGGGAGAAAGG - Intronic
1058223851 9:102336667-102336689 TTATGGAGACAGAGGGAATATGG - Intergenic
1058959341 9:109978158-109978180 CTGAGGTGGCAGAGGGGAGATGG + Intronic
1059021757 9:110583255-110583277 ATATGGGGAAAGATGGAAGAGGG + Intergenic
1059287267 9:113185335-113185357 TTGTGGGAAGAGAGGAAAGAGGG + Intronic
1059456254 9:114402178-114402200 CTGGGGGTGCAGAGGGAAGCTGG + Exonic
1059542310 9:115143113-115143135 CTGTGTGAACACAGGGAAAAAGG + Intronic
1059584838 9:115594989-115595011 GTTGGGGGTCAGAGGGAAGAGGG - Intergenic
1059670481 9:116486416-116486438 ATGGAGGGAAAGAGGGAAGAAGG + Intronic
1059960894 9:119563543-119563565 CTATGGGGACTGAGGGGAGCTGG - Intergenic
1060100345 9:120834864-120834886 CAGTGAGGATAGAGAGAAGAGGG + Intronic
1060216196 9:121739922-121739944 CTGTGAGAACAGAGGAAAGCTGG + Intronic
1060260588 9:122070646-122070668 CTGAGGGGACAGAGGAATGAAGG + Intronic
1060344456 9:122804088-122804110 CTCTGGGGACAGAGAAAGGATGG - Intronic
1060398819 9:123335500-123335522 CTGTGAGGGCAGAGGGCAGGTGG - Intergenic
1060417307 9:123440538-123440560 TTGTGGGGTGAGAGGGAACATGG - Intronic
1060504042 9:124184815-124184837 ATGTGGGGGCAGAGGGCATATGG - Intergenic
1060550073 9:124480879-124480901 CTGCGGGGACAGTGAGATGAGGG + Intergenic
1060750509 9:126165470-126165492 CCTTGGTGACAGAGGGAAGCGGG + Intergenic
1060921313 9:127422494-127422516 CTGAGGTGGCAGAAGGAAGATGG - Intergenic
1061002382 9:127909847-127909869 CTGTGGGGGCAGAGGGAGTGTGG - Intronic
1061091310 9:128428152-128428174 CTGTGGGACCAGAGGGAGAAAGG - Intronic
1061134402 9:128724913-128724935 CCCTGGGGACACAGGGAAGGAGG - Intergenic
1061250223 9:129422059-129422081 AGGTGGGGTCAGAGGGCAGATGG - Intergenic
1061501851 9:131008674-131008696 CTGTGGGGACAGAGCGCAGCCGG + Intergenic
1061680771 9:132241509-132241531 TTGCGGGGACAGAGGGAGGGAGG + Intronic
1061830042 9:133285905-133285927 CTGTAAGGACAAAGGAAAGAGGG - Intergenic
1062000142 9:134211806-134211828 CTGTGGAGAAAGAAGGCAGAGGG + Intergenic
1062283932 9:135764790-135764812 GTGTGGGGACCAAGGGAGGAGGG - Intronic
1062315292 9:135964231-135964253 CTGGGGGAACAGAGAGAGGAGGG + Intergenic
1062322102 9:135995106-135995128 CTGTGGAGACAGACGGTGGAGGG - Intergenic
1062586069 9:137250679-137250701 CTGGGGGCACAGAGGCTAGAGGG - Intergenic
1062702180 9:137913052-137913074 CAGTGGGGACACAGGAATGAAGG + Intronic
1185609960 X:1388389-1388411 CTGTGAGGACACAGGGAAGACGG + Intronic
1185894609 X:3846397-3846419 CTGTGAGGTCTGATGGAAGATGG + Intergenic
1185899727 X:3884821-3884843 CTGTGAGGTCTGATGGAAGATGG + Intergenic
1185904843 X:3923250-3923272 CTGTGAGGTCTGATGGAAGATGG + Intergenic
1186027441 X:5328220-5328242 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
1186137003 X:6532715-6532737 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186267282 X:7844583-7844605 ATGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186297707 X:8169068-8169090 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186325152 X:8467403-8467425 GTGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186932962 X:14414788-14414810 TAGTAGGGACAGAGAGAAGAGGG + Intergenic
1187449518 X:19384345-19384367 CAGTGGGGACTGGGGGAAGGTGG + Intronic
1189128792 X:38477171-38477193 CTTTGGGGACACAGGGGAAAGGG - Intronic
1189446539 X:41085834-41085856 CTGAGGGGAGAAGGGGAAGAGGG + Exonic
1190074047 X:47302678-47302700 CGGAGGGGAAAGAGGGAGGAGGG - Intergenic
1190091983 X:47446602-47446624 CTTTGGGGACATAGGTTAGAAGG + Exonic
1190320012 X:49174465-49174487 CTGAGAGGGCAGAGGGAAAAAGG + Intronic
1190430907 X:50377015-50377037 ATGTGGGTACAGTGGGTAGAGGG + Intronic
1191629187 X:63302735-63302757 CTTTGGGGACTCAGGGAAAAGGG - Intergenic
1192554412 X:72078538-72078560 CTGTGGTTAGAGAGGAAAGAGGG - Intergenic
1193088012 X:77464888-77464910 CTTTGGGGACTGAGGGGAAAGGG + Intergenic
1193281758 X:79659377-79659399 CTTTGGGGACACAGGGGAAAGGG - Intergenic
1193359924 X:80569976-80569998 CTGGGAGCACAGAGGGGAGAGGG - Intergenic
1194104128 X:89747347-89747369 CTTTGGGGACTGAGGGGAAAGGG - Intergenic
1194250040 X:91563093-91563115 CCGAGGGGAGAGAGGCAAGAAGG - Intergenic
1194992930 X:100564111-100564133 CAGTGGAGGAAGAGGGAAGAGGG + Intergenic
1195224015 X:102773610-102773632 CTGTGGAGATAGAGAGTAGAAGG - Intergenic
1195903206 X:109819529-109819551 CTGAGGGAGCACAGGGAAGATGG + Intergenic
1196251326 X:113463515-113463537 TTATGGGGATAGAGGGTAGAAGG - Intergenic
1197027585 X:121773507-121773529 AAGTGGGGAGAGAGGGAGGATGG - Intergenic
1197751385 X:129966181-129966203 CTGTGGGGACAGAGAATGGAGGG - Intergenic
1197776459 X:130121546-130121568 CTGTCGGGACGGGAGGAAGAGGG - Intergenic
1198137837 X:133771795-133771817 CTCTGGGCAGAGAGGGAAGAAGG + Intronic
1198718797 X:139592755-139592777 CTGTGGGTTCAGAGTGAAGCAGG + Intronic
1199264872 X:145818178-145818200 CAGTGGGGATTGAGGGTAGAGGG - Exonic
1200123698 X:153803358-153803380 CGGTGGTGACTGAGAGAAGAGGG + Exonic
1200569002 Y:4804342-4804364 CTGAGGGGACAGAGGCAAGAAGG - Intergenic
1201622527 Y:15976014-15976036 GTGGAGGGACAGAGGGTAGAAGG + Intergenic