ID: 961319181

View in Genome Browser
Species Human (GRCh38)
Location 3:126061170-126061192
Sequence GGCCAGATGGTCATTCTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 122}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961319172_961319181 20 Left 961319172 3:126061127-126061149 CCAATTCATTTCTCAGGGTCACC 0: 1
1: 1
2: 2
3: 12
4: 173
Right 961319181 3:126061170-126061192 GGCCAGATGGTCATTCTTACAGG 0: 1
1: 0
2: 0
3: 8
4: 122
961319175_961319181 -1 Left 961319175 3:126061148-126061170 CCTTGACCCTCGGCAGGTTCTGG 0: 1
1: 0
2: 0
3: 12
4: 150
Right 961319181 3:126061170-126061192 GGCCAGATGGTCATTCTTACAGG 0: 1
1: 0
2: 0
3: 8
4: 122
961319178_961319181 -7 Left 961319178 3:126061154-126061176 CCCTCGGCAGGTTCTGGGCCAGA 0: 1
1: 0
2: 1
3: 11
4: 168
Right 961319181 3:126061170-126061192 GGCCAGATGGTCATTCTTACAGG 0: 1
1: 0
2: 0
3: 8
4: 122
961319179_961319181 -8 Left 961319179 3:126061155-126061177 CCTCGGCAGGTTCTGGGCCAGAT 0: 1
1: 0
2: 0
3: 7
4: 173
Right 961319181 3:126061170-126061192 GGCCAGATGGTCATTCTTACAGG 0: 1
1: 0
2: 0
3: 8
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961319181 Original CRISPR GGCCAGATGGTCATTCTTAC AGG Intronic
900491425 1:2951174-2951196 GGCCAAGTGGCCAGTCTTACAGG - Intergenic
900790300 1:4675517-4675539 GGCCACATGGTCATTCAACCAGG - Intronic
909030000 1:70528534-70528556 GGACAGATGCTCATACTTCCTGG - Intergenic
915355645 1:155254108-155254130 GGCCAGTTGAGCATTCTTACAGG + Exonic
919799795 1:201346738-201346760 GGCCTGATGGTCATTGTAAAAGG - Intergenic
919990743 1:202707594-202707616 GGAATGATGGTCATTCTTCCAGG + Intronic
922449809 1:225727810-225727832 GCCCAGATGAATATTCTTACAGG + Intergenic
923484010 1:234412121-234412143 GCCCATATTGTCATTCTTAAAGG - Intronic
924358088 1:243205369-243205391 GGCCAGATAGTAAATCTTTCAGG + Intronic
924396710 1:243628943-243628965 GGCCATATGGTCAGGCTGACAGG + Intronic
1068046519 10:51893133-51893155 TTCCTGATGGTCATTCTGACAGG + Intronic
1072262664 10:93695875-93695897 GGCCAGATGGTAAATATTTCAGG + Intronic
1072414176 10:95233061-95233083 GTTCAGTTGGTCATTCTTGCTGG + Intergenic
1073095643 10:100978125-100978147 GGCCATAAGGTCATTCTCAGGGG + Intronic
1073792106 10:106951211-106951233 GGCCAGATGTTCCTTTTTAGAGG - Intronic
1075264622 10:120989991-120990013 GGCCAAATGCTCATTCTACCTGG - Intergenic
1081192678 11:40123087-40123109 GGCCAGATAGTAATTATTTCAGG + Intronic
1082885319 11:58076070-58076092 GGCCAAATGATCTTTCTCACAGG - Intronic
1089872870 11:121692410-121692432 GGCCAGATGGTAAATATTGCAGG - Intergenic
1091971931 12:4794541-4794563 CACCCGATGGGCATTCTTACAGG - Intronic
1092510366 12:9149102-9149124 GGCCAGATGGTAATTATTTTAGG + Intronic
1093845432 12:23965266-23965288 AGACACATGGTCATTCTTAGCGG - Intergenic
1096113381 12:49041467-49041489 GGCCGGTCGGTCAGTCTTACGGG + Exonic
1100759081 12:97786360-97786382 GCCCATCTGGTCATTCTTATAGG + Intergenic
1101540640 12:105661896-105661918 GGCCAGGTATTAATTCTTACTGG - Intergenic
1103144010 12:118578293-118578315 GGCCAGATAGTAAATGTTACAGG + Intergenic
1104408275 12:128536889-128536911 TGCCAGGTGGCCATTCTGACAGG + Intronic
1109592576 13:64505476-64505498 GGCCAGATGGTAAGTTTTTCAGG + Intergenic
1112152643 13:96780838-96780860 TGGCAGAAGGACATTCTTACTGG + Intronic
1112204790 13:97314072-97314094 GACCAGATGGTGACCCTTACTGG - Intronic
1114055090 14:18961202-18961224 GGACAAATGGCCATTCTGACTGG + Intergenic
1114107451 14:19440576-19440598 GGACAAATGGCCATTCTGACTGG - Intergenic
1116697604 14:48197849-48197871 TGCCATATAGTCATTTTTACTGG - Intergenic
1122582688 14:102781155-102781177 GGCCATCTGGTCCCTCTTACAGG + Intronic
1129750367 15:78058700-78058722 GGGCAGATGGTGATCCTTCCCGG - Intronic
1131432676 15:92399295-92399317 GGTCAGATGTCCATTCTAACAGG - Intronic
1137639514 16:50016215-50016237 GGTCATATGGTGATTTTTACGGG + Intergenic
1138921400 16:61533898-61533920 GGCAAGATGGTCACTCTATCTGG + Intergenic
1143162852 17:4882608-4882630 GGCCAGATGGTAAATATTTCAGG + Intronic
1143645732 17:8228832-8228854 TGCCACATGGTGATTCCTACAGG + Exonic
1146083370 17:29803825-29803847 GGCCATATGGATATTTTTACAGG + Intronic
1153654459 18:7270691-7270713 AGCCAGATGGTCATTCACAATGG + Intergenic
1156046111 18:32879180-32879202 GGACATATTGCCATTCTTACTGG + Intergenic
1158256954 18:55562187-55562209 GGCCAAATGGTAAATCTTTCTGG - Intronic
1158542017 18:58365609-58365631 GGCCAGGTGGGGATTATTACAGG + Intronic
1158670111 18:59467075-59467097 GGCCAAGTGGCCATTGTTACAGG + Intronic
1160408801 18:78660779-78660801 GGCAAGATGGGCATTCTTGGAGG - Intergenic
1163491633 19:17620316-17620338 GGCCATCTGGTCATTCCTAGAGG + Intronic
1163555733 19:17991775-17991797 GGCCAGATGGTAAATCTTTCAGG + Intronic
1165012308 19:32857937-32857959 GGCCAGATGGTAAATATTCCAGG - Intronic
928584611 2:32746261-32746283 GGCCAGATGTGCATTCTTATAGG - Intronic
930745155 2:54875105-54875127 GGGCAGATGGACAAGCTTACTGG - Intronic
931663561 2:64593134-64593156 GGCCAGATTCTAATTCTTCCTGG - Intergenic
932759852 2:74432152-74432174 AGCCAGATAGCCAGTCTTACTGG + Intronic
933035662 2:77394499-77394521 TGCAAGATGGCCATTCTGACAGG + Intronic
935723752 2:106003755-106003777 GGCCAGATAGTAAATATTACAGG - Intergenic
936678604 2:114744734-114744756 GGCCATATGGTCACTGTTACAGG - Intronic
937051268 2:118893098-118893120 AACCAGATGATCACTCTTACTGG - Intergenic
937543484 2:122988443-122988465 GGCCAGATGGTAAATATTTCAGG + Intergenic
938473100 2:131583989-131584011 GGACAAATGGCCATTCTGACTGG + Intergenic
939456136 2:142438263-142438285 GACCAGATGCTCAATCCTACTGG + Intergenic
939553434 2:143643931-143643953 AGTCAGATGATTATTCTTACTGG + Intronic
940332578 2:152491168-152491190 TGCCAGATGTTCATTTTTACTGG - Intronic
940377063 2:152968955-152968977 GCCCAGTTGTTCATCCTTACAGG + Intergenic
941297618 2:163759799-163759821 GGCTAGAGGGTGATTCTTGCTGG + Intergenic
946502286 2:220262187-220262209 ATCCAGAAGGGCATTCTTACTGG - Intergenic
948306984 2:236955643-236955665 AGCCAGATGGTCGTTCTGAGAGG - Intergenic
1169662451 20:7995482-7995504 GGCCAGATTGTAAATATTACAGG + Intronic
1175157318 20:56979943-56979965 GGCCAGATAGTAAATCTTTCAGG + Intergenic
1175720638 20:61284807-61284829 GGCCAGATAGTCATTATTTTAGG + Intronic
1178322755 21:31618172-31618194 GGCCAGGCCCTCATTCTTACTGG - Intergenic
1179546086 21:42113152-42113174 GGCTAGAGAGCCATTCTTACAGG - Intronic
1180473571 22:15683752-15683774 GGACAAATGGCCATTCTGACTGG + Intergenic
1182061208 22:27399095-27399117 GGCAAGAACATCATTCTTACAGG + Intergenic
1183585283 22:38749859-38749881 GGCTTGATGGTCATTCTTCCAGG - Exonic
954937105 3:54336460-54336482 GGCCTGATGCTCATTCACACTGG - Intronic
956151797 3:66251364-66251386 GGAAAGATGATCATTCTTTCAGG + Intronic
956523633 3:70132584-70132606 TGCAAGATGGCCATTCTGACAGG - Intergenic
957353771 3:79056883-79056905 GACCAAATGGCCATTCTAACTGG + Intronic
960494590 3:118359713-118359735 GGGCAGAAGTTCATTCTTGCTGG - Intergenic
961319181 3:126061170-126061192 GGCCAGATGGTCATTCTTACAGG + Intronic
966490525 3:180523273-180523295 GACCAGATGTTCATTTTCACTGG - Intergenic
967340192 3:188388854-188388876 GGCCAGATGGTCTCTGTCACAGG + Intronic
971210012 4:24607199-24607221 GGCCAGATGTTTATTCTAAATGG - Intergenic
972764915 4:42143651-42143673 GGCCAGATGGCCATATTCACTGG + Exonic
981201068 4:141979985-141980007 GGCCAGACGGTCGATATTACTGG - Intergenic
989096622 5:37787868-37787890 GGCCAGATGGTCCTTTTAATTGG - Intergenic
990966239 5:61451030-61451052 AGCCAGATGGTCAGTCTTCAGGG - Intronic
992558581 5:77927953-77927975 GGATAGATGGTCATACATACAGG - Intergenic
996095898 5:119398875-119398897 GGCTAAGTGGTCATTCTTGCTGG - Intronic
997607553 5:135185979-135186001 GGCAAGATGGGCATTCTGAAAGG - Intronic
998871015 5:146551657-146551679 GGCCAGATGGTAAATGTTTCAGG + Intergenic
999711602 5:154323121-154323143 GGCCAGATAGTAAATGTTACGGG + Intronic
1001094313 5:168764477-168764499 GGCTAGATGATCATTCCTACAGG - Intronic
1002359198 5:178656901-178656923 GGACAGATGGACATTCAGACAGG + Intergenic
1003192974 6:3890306-3890328 TGCCAGGTGGCCATTCTGACAGG - Intergenic
1004614577 6:17278578-17278600 GGCCAGATCCTCATTCTTGGTGG - Intergenic
1005836540 6:29713771-29713793 GGCCAGAGGTTCATCTTTACAGG + Intergenic
1006920044 6:37621671-37621693 GGCATGATGGTCATTCGTATTGG - Intergenic
1009294901 6:61933988-61934010 GGACACATGGACATTCTAACTGG + Intronic
1010984855 6:82412130-82412152 GGCCACATGGTCATTATGTCAGG - Intergenic
1013575612 6:111482179-111482201 GGCCAGATAATCTTTCTCACTGG - Intronic
1014490524 6:122056297-122056319 GTGCAGGTTGTCATTCTTACTGG + Intergenic
1021098245 7:16557997-16558019 GGCAAGATGTTCTTTCTTAGCGG - Intronic
1021573559 7:22088040-22088062 GGACAGATGGTCATCGTTTCAGG + Intergenic
1022419895 7:30210476-30210498 GGCCAGATGGACATTCCCATAGG + Intergenic
1023503960 7:40880833-40880855 GGCCAGATGGAAAATCTAACTGG - Intergenic
1030080044 7:105769625-105769647 GACAAGATGGTCATTCTACCTGG + Intronic
1031558622 7:123209560-123209582 TGCAAGTTGGACATTCTTACAGG + Intergenic
1035689435 8:1550098-1550120 GGCCACATGGTCCCTCTCACGGG - Intronic
1040548821 8:48422914-48422936 GGTCAGATGGCCAATCTTAAAGG - Intergenic
1041805153 8:61841583-61841605 GGCAGGTTGGTCATTCTGACAGG - Intergenic
1042392793 8:68255328-68255350 GGCCAGAGACTCATTTTTACTGG - Intergenic
1047013543 8:120698626-120698648 GTCAAGATGGTCCTTCTTGCTGG + Intronic
1048312763 8:133338477-133338499 TGTCAGAAGGTCATTCTTACTGG + Intergenic
1050457283 9:5846248-5846270 CACCAGATGGACAGTCTTACTGG + Intergenic
1053581166 9:39405890-39405912 GTCAAGATTGTCATTCTTAAAGG + Intergenic
1053845651 9:42233956-42233978 GTCAAGATTGTCATTCTTAAAGG + Intergenic
1054102753 9:60964694-60964716 GTCAAGATTGTCATTCTTAAAGG + Intergenic
1054583607 9:66942168-66942190 GTCAAGATTGTCATTCTTAAAGG - Intergenic
1056707816 9:88966956-88966978 GGCCAGTTGATCATACTTCCAGG - Intergenic
1058155146 9:101506578-101506600 GGACAGATGGTCAAGCGTACAGG - Intronic
1058789558 9:108429010-108429032 GGTCAAATGGACATTCTTCCAGG - Intergenic
1059958919 9:119546274-119546296 TGCCAGATGGTAATTGTTATGGG + Intergenic
1062506628 9:136880836-136880858 GGCCAGATGGTCACAGTTGCTGG + Intronic
1187787158 X:22904749-22904771 TGAAAGAGGGTCATTCTTACAGG + Intergenic
1188776007 X:34219607-34219629 GGCCAGAGGCTGGTTCTTACAGG + Intergenic
1189078270 X:37941197-37941219 TGCCAGAAAGTCATGCTTACTGG + Intronic
1194811261 X:98389887-98389909 AGCCAGAAGGGCATGCTTACAGG - Intergenic
1199082822 X:143595429-143595451 GGGCTGCTGGTCATTCTTCCAGG + Intergenic
1199433479 X:147786531-147786553 GGCCAGATGGTGGATCTTAAAGG + Intergenic