ID: 961320499

View in Genome Browser
Species Human (GRCh38)
Location 3:126070146-126070168
Sequence CTAAGATTCTTGGCAGGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 108}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961320499_961320503 29 Left 961320499 3:126070146-126070168 CCAAGACCTGCCAAGAATCTTAG 0: 1
1: 0
2: 0
3: 6
4: 108
Right 961320503 3:126070198-126070220 TACAAGAGATCCTTTAGAGCAGG 0: 1
1: 0
2: 0
3: 12
4: 254
961320499_961320504 30 Left 961320499 3:126070146-126070168 CCAAGACCTGCCAAGAATCTTAG 0: 1
1: 0
2: 0
3: 6
4: 108
Right 961320504 3:126070199-126070221 ACAAGAGATCCTTTAGAGCAGGG 0: 1
1: 0
2: 1
3: 20
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961320499 Original CRISPR CTAAGATTCTTGGCAGGTCT TGG (reversed) Intronic
900863795 1:5252963-5252985 CGAAGATTCTGAGCAGGCCTTGG - Intergenic
903470808 1:23586061-23586083 CTGAGAAGCCTGGCAGGTCTGGG + Intronic
912231135 1:107794127-107794149 TTGAGATTCTTGACAGTTCTGGG - Intronic
912261307 1:108113723-108113745 CTAAGCTGCTTGGCAGGACCAGG + Intergenic
916466819 1:165081301-165081323 CTCAGATTCTGGGGAGGCCTCGG + Intergenic
916585732 1:166148312-166148334 CTCAGATTCTGAGCAGGGCTTGG - Intronic
920301535 1:204992010-204992032 CTAAGGTGCTGGGCAGCTCTGGG + Intronic
1063194003 10:3723112-3723134 CTAAGTTTCATGGCTGGTTTTGG + Intergenic
1067933986 10:50592539-50592561 CTCAGATTGTTGCCAGATCTAGG + Intronic
1068117672 10:52752154-52752176 TTCAGCTTCTTGGAAGGTCTAGG + Intergenic
1070915779 10:80153739-80153761 CTGAGATTGATGGCAGGTCCTGG - Exonic
1072297714 10:94027529-94027551 ATAAGCTTCTTGGCTGGGCTTGG + Intronic
1072728660 10:97829998-97830020 CAAAGCTTCTTGGGAGGTGTGGG - Intergenic
1074126213 10:110530590-110530612 CTGAGATCCTGGGCAGGTCCAGG - Intergenic
1074384200 10:113004245-113004267 CAAAGAGTCTTGGCAGGGCAGGG + Intronic
1080038159 11:27730720-27730742 ATAAGAATTCTGGCAGGTCTTGG - Intergenic
1080413282 11:32046219-32046241 CTCAAATTCTTGCCAAGTCTGGG + Intronic
1082753852 11:57052231-57052253 CTAACATCTTTGGCAGTTCTTGG - Intergenic
1088676245 11:112196674-112196696 ATAAAATACTTGGGAGGTCTAGG - Intronic
1089482743 11:118820463-118820485 TGAAGATTCTTGGCAGATCCTGG + Intergenic
1089549405 11:119259997-119260019 GTAAGATTGTTGGCATCTCTGGG - Intronic
1089751160 11:120652238-120652260 CTAAGGTTCTTAGAAGCTCTGGG - Intronic
1090306299 11:125694041-125694063 ATAAGGTTCTTAGCAGATCTGGG - Intergenic
1091914625 12:4261671-4261693 CTAAGGTTCTTTGCACTTCTGGG + Intergenic
1098235174 12:68411341-68411363 CCAAGGTTCTTTGGAGGTCTGGG - Intergenic
1098724571 12:73946760-73946782 ATAAGAGTCTTTGCAGATCTAGG - Intergenic
1104313548 12:127676058-127676080 CTCAGTCTCTTGGCATGTCTGGG + Intergenic
1104509740 12:129366478-129366500 CTCAGCTTCTGGGGAGGTCTCGG - Intronic
1104697636 12:130875505-130875527 TTAAGATTCTTGGCAAGGCATGG - Intronic
1107279328 13:38715488-38715510 CACAGACTCTTGGCAAGTCTTGG - Intronic
1109989577 13:70036974-70036996 CTAAGGTTCTTCTCTGGTCTGGG - Intronic
1126206670 15:46053388-46053410 CAAACATTCTTGGCAGATGTGGG + Intergenic
1130060124 15:80563647-80563669 CTGAGCCTCTTGGCAGCTCTAGG + Intronic
1130765945 15:86871387-86871409 CTATGACTCATGGCAGGTCAAGG - Intronic
1131082552 15:89548862-89548884 GTAAGATTCTTGGCTGATGTTGG + Intergenic
1134183641 16:12066515-12066537 CTGAGATTCAAGACAGGTCTGGG + Intronic
1141452341 16:84113554-84113576 CTAGCATTCTTTGCAGCTCTTGG + Intronic
1144262445 17:13535504-13535526 CTCAAATTTTTGGCAGCTCTGGG + Intronic
1144856751 17:18273178-18273200 CTAGGATTGTTCTCAGGTCTTGG - Intronic
1152267485 17:79304797-79304819 CTAAGATTCTCGGAAGGTGCTGG + Intronic
1153444783 18:5158746-5158768 CTCAGAGTGTTGGCAGGACTTGG - Intronic
1159044431 18:63355718-63355740 CTAATTTTCTTGGCAGCTTTTGG + Intronic
1167433213 19:49464915-49464937 CTGAGAGTCTCGGCAGGCCTGGG - Intronic
1168137862 19:54363527-54363549 CTCAGGTTCTTGCCAGGTCTTGG - Intronic
926407001 2:12564535-12564557 CTAAGATTCATGTCAGATCAAGG - Intergenic
927409872 2:22812844-22812866 CTAAAATTCTTGACAAGTTTTGG - Intergenic
927425689 2:22978974-22978996 CTAAGATTCTAGTCAAGACTTGG - Intergenic
928355606 2:30611681-30611703 CTGAGATTCTTAACTGGTCTGGG + Intronic
932035117 2:68237207-68237229 GTAGTATTCTTGGCAGGTCTAGG - Intronic
932086701 2:68769026-68769048 CAAAGATTTTTGTGAGGTCTGGG - Intronic
935233247 2:101117472-101117494 CTTAGATTATTGACAGGTCAGGG - Intronic
937726481 2:125173490-125173512 CTCAGGTTCTGGGGAGGTCTCGG - Intergenic
940235254 2:151504706-151504728 CGCAGATTCTAGGCAGGTGTTGG - Intronic
941023713 2:160437994-160438016 CTAAGATTTTTGACAGGACCTGG + Intronic
943903091 2:193466017-193466039 CTGACATTCCTGGCAGGTTTGGG + Intergenic
944506277 2:200415037-200415059 TTAAGTTTCTTGGTAAGTCTTGG - Intronic
946195585 2:218031657-218031679 CTAAGATCCTTTTCAGCTCTGGG + Intergenic
947558911 2:231128051-231128073 CTAATATTCTTTATAGGTCTAGG + Intronic
948076895 2:235172080-235172102 CTAGGATTCTAGCCAGGTCTGGG + Intergenic
948981579 2:241497408-241497430 CAGAGAACCTTGGCAGGTCTGGG + Intronic
1171754260 20:29087164-29087186 CAAAAGTTCTCGGCAGGTCTGGG - Intergenic
1172799850 20:37568054-37568076 CTCAGATTCTGGGCTTGTCTAGG + Intergenic
1174410109 20:50329903-50329925 CTAATATTCTAGGCAGGTAGTGG - Intergenic
1177383331 21:20374548-20374570 ATAAGTTTCTTGGCCGGGCTCGG + Intergenic
1178337690 21:31758458-31758480 ATAAGCTTCTTGGCAGGCATGGG - Intergenic
1179017776 21:37608208-37608230 CTATGATCCTAGGCTGGTCTAGG + Exonic
1179060001 21:37971104-37971126 CCAAGATTCTTGGCAAGCTTGGG + Intronic
1182442056 22:30370447-30370469 CTCTGGCTCTTGGCAGGTCTGGG - Exonic
1183439010 22:37812719-37812741 GTCAGATTCCTGGCAGCTCTGGG + Intronic
1184917928 22:47585827-47585849 CTAACTTTCGTGACAGGTCTCGG - Intergenic
953701577 3:45199967-45199989 CTAAGATGCAGGGCAGCTCTGGG + Intergenic
957189612 3:76990590-76990612 CTAACATTCTTGGCGTGTGTTGG - Intronic
958921658 3:100113429-100113451 ATAAGGTTTTTGGCAGGTCTTGG - Intronic
959474075 3:106788334-106788356 CTAAGAGTCTTGGCCGGGCATGG - Intergenic
961320499 3:126070146-126070168 CTAAGATTCTTGGCAGGTCTTGG - Intronic
962223628 3:133585790-133585812 TTAAGATTCTAGCCAGGGCTGGG - Intronic
966975966 3:185083493-185083515 CTGAGATTCCTGCCAGGCCTCGG - Exonic
967571616 3:191035886-191035908 CCCAGCTACTTGGCAGGTCTAGG - Intergenic
967747977 3:193081277-193081299 CTTTGAGTCTTGGGAGGTCTGGG + Intergenic
968326633 3:197823388-197823410 TTAAGATTCTTGGCTGGGCACGG - Intronic
970766887 4:19560353-19560375 CTAAGATTATTTACAGGTCCAGG - Intergenic
975629267 4:76383202-76383224 GCAAGATTCTTGCTAGGTCTGGG - Intronic
977395363 4:96464282-96464304 CTAAAATTGTTGTTAGGTCTTGG + Intergenic
978054377 4:104245333-104245355 CTAAAAGTCTTTGCAGATCTAGG + Intergenic
978729048 4:112003527-112003549 CTAAAATTCTTTGCAAGTATGGG + Intergenic
982445152 4:155482549-155482571 TTAAGCTTCTTGGCAGGGGTAGG + Intergenic
988570762 5:32363168-32363190 CTAAGATGCTTGGGAGTTGTTGG - Intronic
989790567 5:45394608-45394630 CTAAACTTCTTGGCAGAACTTGG + Intronic
993021804 5:82601062-82601084 CTAATATTCTAGGAAGGTGTGGG - Intergenic
994867911 5:105301536-105301558 CTAAAATTCTTAGTAGCTCTGGG + Intergenic
999456840 5:151723911-151723933 CTCAGATTCTTGGAAGTTTTTGG + Intergenic
1003249938 6:4418196-4418218 CCAAGATTCTTGGCCGGGCACGG + Intergenic
1006781079 6:36632706-36632728 CCAAGTTTCTTAGCAGGTCTAGG - Intergenic
1007218086 6:40256781-40256803 GTAAGAATCTGGGCAGGTCGGGG + Intergenic
1013272108 6:108555027-108555049 CTAAGATTGTTGGAAGGATTGGG - Intergenic
1013818645 6:114129543-114129565 TTAAGATTCTTGGCTGGGCGCGG - Intronic
1016568166 6:145481610-145481632 CTGAGATTGTAGTCAGGTCTTGG - Intergenic
1026408294 7:70091669-70091691 CTGAGATTCTTGGCAGATGAAGG + Intronic
1026466093 7:70655867-70655889 CATAGATTCTTGGCAAGGCTTGG - Intronic
1030491633 7:110242678-110242700 CTAATATTGTAGGCAGGTATAGG - Intergenic
1039659157 8:39444655-39444677 CTGAGGTTCATGGCAGCTCTTGG + Intergenic
1040074794 8:43218657-43218679 ATAAGATTCTTGGCTGGGCATGG + Intergenic
1043800955 8:84608784-84608806 CAAGGATTCGTGGCAGATCTGGG - Intronic
1044695072 8:94914632-94914654 CTAAGGTTCTTGGCTGGGCACGG + Intronic
1047912911 8:129550260-129550282 CTAAGATTATTGGCATGTCCAGG + Intergenic
1048715661 8:137265734-137265756 CTAAGATTCTTGTTAAGTTTTGG + Intergenic
1051498731 9:17754201-17754223 TTAAGATTCTTAGCAGAACTAGG - Intronic
1054957672 9:70931978-70932000 CTAACATTCTTGGAAGGTACAGG + Intronic
1187444657 X:19350599-19350621 CTAAGCTTCATAGCAGGTTTTGG - Intronic
1189565601 X:42238056-42238078 CTATGATTCTAGGCTGCTCTAGG + Intergenic
1193551810 X:82902774-82902796 CAAAGATGTTTGTCAGGTCTAGG - Intergenic
1199380318 X:147165035-147165057 ACAAGATTCATGGCAAGTCTGGG - Intergenic
1200142073 X:153907411-153907433 CTCAGATGCCTGGCAGGGCTGGG - Exonic
1200282294 X:154787266-154787288 ATAAGATTCTTGTCAGATTTGGG - Intronic
1201505826 Y:14698712-14698734 CTTAGATTTTTGGCTGTTCTGGG + Intronic