ID: 961321490

View in Genome Browser
Species Human (GRCh38)
Location 3:126079494-126079516
Sequence ATGGAGAAACTGACACAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 590
Summary {0: 1, 1: 1, 2: 6, 3: 51, 4: 531}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961321487_961321490 -8 Left 961321487 3:126079479-126079501 CCTACAGAGAAAACCATGGAGAA 0: 1
1: 0
2: 2
3: 27
4: 324
Right 961321490 3:126079494-126079516 ATGGAGAAACTGACACAGGATGG 0: 1
1: 1
2: 6
3: 51
4: 531

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961321490 Original CRISPR ATGGAGAAACTGACACAGGA TGG Intronic
900476761 1:2879723-2879745 ATGGAGAAGCAGACACGCGAGGG + Intergenic
900546440 1:3231825-3231847 GTGGAGAAGCTGAACCAGGAAGG - Intronic
900558857 1:3293795-3293817 ATGGAGAAGCCGACAAAGGATGG - Intronic
900792348 1:4688910-4688932 GTGGAGAAACTGAGGCAGGGAGG + Intronic
900864864 1:5261039-5261061 ATGAAGAAACTGACGCAGGGTGG + Intergenic
900915641 1:5636232-5636254 ATGGAGTGAGTGTCACAGGAAGG - Intergenic
901142985 1:7047411-7047433 ATGGAGGAACTGGCACACGCAGG + Intronic
902141783 1:14362898-14362920 ATAGAGAAACTGAGGCAGGAAGG + Intergenic
902249838 1:15147064-15147086 ATGGGGAAACTGAAACAGAGAGG - Intergenic
902989875 1:20179486-20179508 AGGGAGAAGCTGACACAAAAGGG - Intergenic
902989890 1:20179705-20179727 AGGGAGAAGCTGACACACAAGGG - Intergenic
902989910 1:20179957-20179979 AGAGAGAAACTGACACACGAGGG - Intergenic
902989919 1:20180053-20180075 AGGGAGAAGCTGACACATAATGG - Intergenic
903014623 1:20353943-20353965 AGGGAGAAGCTGTCACAGGACGG - Exonic
903133754 1:21295884-21295906 ATGAAGAAACTGAGACCTGAGGG - Intronic
903500549 1:23797980-23798002 ATGGGGAAACTGAGACTGGGAGG + Intronic
903935005 1:26889630-26889652 ATGGAGTAACTGAGACAGGGAGG - Intronic
904787240 1:32992165-32992187 ATGGTGAAACTGAGGCAGGGGGG - Intergenic
904860133 1:33531316-33531338 ATGGATACACTAAAACAGGATGG + Intronic
905094643 1:35459072-35459094 ATGGATAAACTGTCACACTATGG + Intronic
905407339 1:37743391-37743413 ATGGAGAAACTGAGAAGGGCTGG + Intronic
905934820 1:41815062-41815084 ATGAAGAAAGTAAAACAGGATGG + Intronic
906679033 1:47712464-47712486 ATGGAGAAACCAAGGCAGGAAGG - Intergenic
907355381 1:53868385-53868407 ATGAGGAAACTGAGACAGGAAGG - Intronic
908600598 1:65735061-65735083 GTGAAGAAAGTGATACAGGAAGG - Intergenic
909617076 1:77623010-77623032 ACAGAGTAACTGACACAGAATGG + Intronic
909944176 1:81644777-81644799 ATGGAGAAAGTTACACATGTGGG + Intronic
910415795 1:86996665-86996687 ATGGAGAAACAGACAACTGAAGG + Intronic
911370635 1:96990748-96990770 ATGTAGAAACTGACAGTTGAAGG - Intergenic
912978338 1:114349286-114349308 ATGGAGAAAATCACGCAGCATGG - Intergenic
915061910 1:153193149-153193171 CTGGATAAACTGCCACAGGATGG + Intergenic
915069260 1:153252562-153252584 ATGGAGAAACTGAGATCTGAGGG + Intergenic
915676777 1:157539240-157539262 ATGATGAAACTGGTACAGGATGG + Exonic
915848130 1:159290387-159290409 ATGGAGAATCTGACACTGCTAGG - Intronic
915848133 1:159290416-159290438 ATGGAGAATCTGACACTGCTAGG - Intronic
916044515 1:160989380-160989402 TTGCAGAAACAAACACAGGAAGG - Intergenic
916303996 1:163308373-163308395 AGTTAGACACTGACACAGGATGG + Intronic
916561115 1:165934820-165934842 AGGGAGAAAGTGACAAAGGCAGG + Intergenic
917044342 1:170841329-170841351 TTGAAGAAACGGACACTGGATGG + Intergenic
917452076 1:175155704-175155726 AGGAAGAAACTGAGAAAGGAGGG - Intergenic
917707111 1:177645815-177645837 GAAGAGAAACTGAAACAGGAAGG + Intergenic
917897848 1:179509717-179509739 ATGGAAAGACTGAGACTGGAGGG - Intronic
918139168 1:181705842-181705864 ATGAAGAAATTGAGACAGCAAGG + Intronic
918158284 1:181872335-181872357 ATGGGGAAAATGATACAGGGAGG + Intergenic
918420211 1:184356658-184356680 TTGGATAGACTGTCACAGGAGGG + Intergenic
918786496 1:188769989-188770011 ATGGAGAAATTGACAGAAGCAGG + Intergenic
919085378 1:192914815-192914837 ATGCAGAAACTGACACACAAAGG + Intergenic
919641889 1:200053430-200053452 ATGAAGAAACTGAGGCAGAAGGG + Intronic
922153339 1:223022976-223022998 CTGGAGACACTCACACAGGCAGG + Intergenic
922253295 1:223870146-223870168 ATTGACAAACTGACAGAGGCAGG - Intergenic
923307654 1:232702843-232702865 AAGGAGAAGTTGACACAGCAGGG - Intergenic
923483402 1:234405811-234405833 AAGGAGAAGCTGACACAGTATGG + Intronic
924606324 1:245538614-245538636 ATGGAGAGACAGACAGGGGAAGG - Intronic
1064329898 10:14383633-14383655 CTGGAGAAATTCACACAGAAGGG + Intronic
1064891085 10:20174594-20174616 GTGGAAAAAAAGACACAGGAAGG + Intronic
1065163124 10:22944364-22944386 ATGGGGAAAATAACACAAGATGG - Intronic
1065409489 10:25408362-25408384 ATGGACAAATTGAAACATGATGG - Intronic
1067273847 10:44817710-44817732 ATGGAGAAATTGACACGGAAAGG + Intergenic
1068249042 10:54412126-54412148 ATGGAGGAACTGACAATAGATGG + Intronic
1068762305 10:60725865-60725887 ATAGGGAAACTGAAACAGAATGG + Intronic
1068816037 10:61314162-61314184 ATGGAGAAACTGACATAAAGAGG - Intergenic
1069155223 10:65021214-65021236 ATGAAAAAACTGACTCAAGATGG + Intergenic
1069453527 10:68535994-68536016 ATGAAGACACCGTCACAGGATGG - Intergenic
1069517476 10:69090049-69090071 AGGGAGAAACTGACAAACTAGGG + Intronic
1070155117 10:73828681-73828703 ATGGCTATACTGACAAAGGAAGG - Intronic
1070399995 10:76045059-76045081 AGGGGGAAACTAACAAAGGAGGG - Intronic
1071071418 10:81698057-81698079 ATGGACAAACTGACAGAAGTAGG + Intergenic
1071879067 10:89874971-89874993 TTGGAGAAATAGCCACAGGATGG + Intergenic
1071950137 10:90693890-90693912 ATACAGAAACTGACTCAAGATGG - Intergenic
1073118681 10:101108182-101108204 TTGGGGAAACTTACCCAGGAGGG + Intronic
1073199194 10:101721044-101721066 ATGGACCTACTGACACAGGCAGG - Intergenic
1073793857 10:106966704-106966726 GTGGAGAAACAGAGTCAGGAGGG - Intronic
1074416017 10:113267364-113267386 CTGAATAAACTGAAACAGGAAGG - Intergenic
1074438623 10:113455622-113455644 ATGGGGAAACAGACTCAGGATGG - Intergenic
1074540150 10:114358428-114358450 ATGAAGAAACAGACTCAGGGAGG + Intronic
1074790801 10:116885878-116885900 ATGGAGAAACTGCAGCAGCATGG - Exonic
1074875687 10:117611451-117611473 AGAAAGAAACTGACCCAGGAGGG - Intergenic
1074907611 10:117878885-117878907 AGGGAGGAGCTGACAGAGGAAGG - Intergenic
1075906414 10:126085641-126085663 ATGGACAGACAGACAAAGGATGG - Intronic
1075922414 10:126224464-126224486 AGGGAGAAACAAGCACAGGAAGG + Intronic
1076165346 10:128277893-128277915 ATGAAGAAACTCACAAAGGAAGG - Intergenic
1077731746 11:4738217-4738239 TTGCAGAAGCAGACACAGGAAGG - Intronic
1077890195 11:6412941-6412963 GCGGAGAAACTGACCCACGAAGG - Intronic
1079902145 11:26199855-26199877 ATTGAGAAAGAGACAAAGGAAGG - Intergenic
1080241115 11:30128220-30128242 CTGGAGGCATTGACACAGGAGGG + Intergenic
1081533007 11:43977099-43977121 ATGGAGAAACTGACTCACTCTGG - Intergenic
1081797529 11:45831722-45831744 CTGAAGAAAATGAAACAGGATGG + Intergenic
1082018809 11:47513797-47513819 ATGGAAAAATTAAAACAGGAAGG - Intronic
1082809178 11:57468197-57468219 ATGGAGATGCTGAGGCAGGAAGG - Intronic
1083184523 11:61009427-61009449 AGGGGGACACAGACACAGGAGGG + Intronic
1083477512 11:62923625-62923647 ATGGGGAAACTGAGGCAGGAGGG + Intergenic
1085392286 11:76188675-76188697 ATGGGGAAACAGACACAGAAGGG + Intronic
1085440118 11:76553780-76553802 ATGGAGAAACTGACTCGGAGAGG - Intergenic
1085484565 11:76851047-76851069 ATGATGAAACTGACACAGTGAGG - Intergenic
1085646291 11:78225194-78225216 AGGAAGAAGCTGACAGAGGAAGG + Exonic
1085720603 11:78909385-78909407 ATGAGGAAACTGACACATAAAGG + Intronic
1087629860 11:100637268-100637290 ATGGAGAAATTGAGACACAAAGG + Intergenic
1088120539 11:106363783-106363805 ATGAAGAAACTGAGGCAGGGAGG - Intergenic
1088447302 11:109945868-109945890 ATGGAGAAACAGAAACATGGAGG - Intergenic
1088923963 11:114281933-114281955 ATGAGGAAATTGACAAAGGAAGG + Intronic
1089831744 11:121335118-121335140 ATGGAGAGACTGTCAGAGGTGGG - Intergenic
1090734554 11:129599472-129599494 ATGGACAAACTGACAGGAGAAGG + Intergenic
1091284097 11:134398564-134398586 ATGAAGAAACTGAGGCATGAGGG + Intronic
1091348403 11:134871983-134872005 AAGGATGAACTGACTCAGGATGG - Intergenic
1091443661 12:530643-530665 ATGAAGAAACAGAAACAGAAAGG - Intronic
1091935116 12:4428824-4428846 ATGGGGAAATTGGCCCAGGAGGG - Intronic
1092566628 12:9673054-9673076 ATGGATAAACTGACAGAAGTAGG - Intronic
1092997934 12:13967915-13967937 ATGGAGATGGTGACACAGGCAGG - Intronic
1094381217 12:29845297-29845319 ATGAAGAAACTGAAACAGAAAGG + Intergenic
1095492474 12:42748866-42748888 ATGGAGAAAGTGACAAGGCAGGG + Intergenic
1095814752 12:46408850-46408872 ATGGAGAAACGTGAACAGGAAGG + Intergenic
1096000307 12:48124199-48124221 ATGAAGAAACTGAGGAAGGAGGG + Intronic
1096760176 12:53835195-53835217 ATGGATAAACTAAGAGAGGAGGG - Intergenic
1097089128 12:56491609-56491631 ATGGAGAAACTAAGGCAGAAAGG - Intergenic
1097147369 12:56951039-56951061 ATGGAGTGACTTACACAAGAGGG - Intergenic
1098236064 12:68419621-68419643 CTGGAGAGGCTGAGACAGGAGGG + Intergenic
1098366720 12:69711394-69711416 ATTGAGAAACTGTCACAGATTGG + Intergenic
1099821675 12:87719329-87719351 ATGAAGAAACAGACTCAGAAAGG - Intergenic
1100473881 12:94917900-94917922 ATTGAGACACTGAGGCAGGAGGG + Intronic
1100657167 12:96659592-96659614 ATGGAGAAATAGACTCATGAAGG + Intronic
1101846668 12:108368358-108368380 ATGGAGAAACAGGCCCAGAAGGG + Intergenic
1102721061 12:115016617-115016639 ATGGAGAAACTGAGACCTGAGGG + Intergenic
1103903977 12:124318010-124318032 GAGGGGAAACTGACAAAGGATGG + Intergenic
1104697733 12:130876687-130876709 ATGTAGAACCTCAAACAGGATGG + Exonic
1104915031 12:132260167-132260189 ATGGAGAAACAGACACAGGGAGG + Intronic
1106150307 13:27094211-27094233 GTGGAGAAACTGGCCCAGCACGG + Intronic
1106172339 13:27298676-27298698 CTGGAGAGACTACCACAGGAAGG - Intergenic
1106762650 13:32882197-32882219 ATGAAGAAACTGAGATAGGCTGG + Intergenic
1107663090 13:42659525-42659547 AAGGAGAAACTGAGACAGAGAGG - Intergenic
1107664462 13:42674642-42674664 AAGGCCAAACTGACACAGCATGG + Intergenic
1108486200 13:50928738-50928760 ATGTGGAAACAGCCACAGGAAGG + Intronic
1108884338 13:55161063-55161085 AAGGAGAAGCTGTCACAGAATGG - Intergenic
1108905904 13:55472525-55472547 ATGGAAATTCAGACACAGGAAGG + Intergenic
1109151798 13:58857107-58857129 AGGGAGAAAATGATACAGAAGGG - Intergenic
1109287991 13:60434738-60434760 AAGAAGAAACTGACACCAGAGGG - Intronic
1111140406 13:84111034-84111056 ATGAAGAAACTGAGCCAGGTGGG + Intergenic
1111847969 13:93535350-93535372 TTGGAGAAATTGAAACAGAAAGG + Intronic
1112051702 13:95649491-95649513 ATGGAGCAGCTGTCACAGGTTGG + Intergenic
1112086628 13:96038992-96039014 ATGGAGAGACAGGCATAGGATGG + Intronic
1112699959 13:101996326-101996348 ATGGAGAAACTTTCTGAGGAGGG + Intronic
1112826362 13:103397155-103397177 ATGGTGAAACAGGCACAGAATGG + Intergenic
1115724694 14:36200330-36200352 ATTCAGAAACTGAGATAGGAGGG + Intergenic
1115810506 14:37101929-37101951 ATGAGGAAACTGAAACATGAGGG - Intronic
1116150443 14:41134586-41134608 ATGGACACAGGGACACAGGAAGG + Intergenic
1116312200 14:43341633-43341655 ATGGATAAACTGACAGAAGTAGG - Intergenic
1117214066 14:53531841-53531863 ATGGAGAAAAGGACAAAGGGAGG - Intergenic
1117486567 14:56203929-56203951 ATAGAGAAAATGACAAATGAAGG + Intronic
1117528156 14:56632260-56632282 ATGCAGACACAGTCACAGGAAGG - Intronic
1117598881 14:57353183-57353205 ATGGAGAAACTGAGACATCCTGG - Intergenic
1117884998 14:60351641-60351663 ATGGGGAAATTGGCACAGAAGGG - Intergenic
1118164382 14:63321634-63321656 ATGGAGACACTGACAGAGCCTGG + Intergenic
1119141260 14:72269380-72269402 AGGGAGAAAGTGAGAAAGGAAGG - Intronic
1119473602 14:74914069-74914091 ATGGAGAAACAGGCTCAGGAGGG - Intronic
1121009860 14:90513495-90513517 ATGGGGACGCTGACACTGGAGGG - Intergenic
1121340772 14:93103838-93103860 AAAGTGAAACTGCCACAGGAGGG + Intronic
1121382254 14:93482955-93482977 ATGTAGTAATTGAAACAGGAAGG - Intronic
1121808272 14:96852433-96852455 AAGGAGAAACAGTCACAGGAAGG + Intronic
1123585132 15:21753205-21753227 CTGGAGACACTGTCTCAGGAGGG - Intergenic
1123621779 15:22195812-22195834 CTGGAGACACTGTCTCAGGAGGG - Intergenic
1123890144 15:24769436-24769458 ATGGCAATACTGCCACAGGAAGG - Intergenic
1124159310 15:27254337-27254359 ATGGAGCATGTCACACAGGAGGG + Intronic
1124835688 15:33194411-33194433 CTGGAGGAACCGACACAGAAGGG + Intronic
1125681902 15:41536252-41536274 ATGGAGAAACTTCCCCAGGCTGG + Intronic
1125805926 15:42493616-42493638 CTTGAGAAATTTACACAGGAGGG + Intronic
1126544423 15:49857262-49857284 ATAGAGAAATTGGGACAGGATGG - Intergenic
1126922022 15:53537540-53537562 ATGAAGAAACAGAGACAGAAAGG - Intronic
1127291362 15:57574159-57574181 AGGAAGAACCTGACACAGGCAGG - Intergenic
1127418027 15:58776295-58776317 ATGGGGAGACTGAGGCAGGATGG - Intronic
1128253404 15:66179639-66179661 TTGGGGAAACTGAGACAGGGAGG - Intronic
1128689237 15:69710679-69710701 ATGGAGGAGATGTCACAGGAAGG - Intergenic
1129230496 15:74194534-74194556 ATGGAGAAACGGTCTCAGAAAGG + Intronic
1130755400 15:86757658-86757680 ATGGAGAAAATGACAAAAAAGGG - Intronic
1131113374 15:89778892-89778914 ATGGTCAAACTGACAAATGAGGG - Intergenic
1131610450 15:93955695-93955717 ATGGTGAAACTGAGTCAGGCAGG - Intergenic
1132006845 15:98235082-98235104 ATGGGAAAACTGAACCAGGAAGG - Intergenic
1132377981 15:101344245-101344267 AATGACAAACTCACACAGGAGGG - Intronic
1132933405 16:2469822-2469844 CTGGAGCAACTGACACTGGCTGG - Intergenic
1133001610 16:2854285-2854307 ATGCAGTATCTGAGACAGGAAGG - Intronic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133300425 16:4779193-4779215 CTAGGGAAAGTGACACAGGAGGG - Intronic
1133855085 16:9542152-9542174 AAGAAGAAACTGAAACAAGAAGG + Intergenic
1135660405 16:24291720-24291742 ATGAGGAAACTGAGGCAGGAGGG - Intronic
1135984406 16:27173457-27173479 ATGGGGAAACTGAGACAAAAGGG - Intergenic
1136014240 16:27384882-27384904 CGGGAGAAACTGCCTCAGGATGG - Intergenic
1136016259 16:27402998-27403020 ACATAGAAACTGACACAGAATGG - Intronic
1136153195 16:28365481-28365503 AAGGAGAAACTGAGGCAGAATGG + Intergenic
1136209891 16:28749792-28749814 AAGGAGAAACTGAGGCAGAATGG - Intergenic
1137395442 16:48113714-48113736 TTGGATAAAATGACACGGGAAGG + Intronic
1137670381 16:50274978-50275000 ATGGGGAAACTGAGGCAGGTGGG + Intronic
1138462001 16:57154663-57154685 ATGGGGAAACTGAAGGAGGAAGG + Intronic
1138512051 16:57514581-57514603 ATGAAGAAACTGACACAGAGAGG + Intronic
1138526384 16:57610132-57610154 ATGGAGAAACTGAGGCACCAAGG + Intergenic
1138618015 16:58187219-58187241 ATGGAAAAACTGAAACAAAATGG + Intronic
1139048498 16:63093772-63093794 ATTGACAAACTGAGACAGAAAGG - Intergenic
1140042908 16:71420984-71421006 AGGGAAAAACTGACACAAAATGG - Intergenic
1141377948 16:83548942-83548964 AAGGAGAAAATGACACACAAGGG - Intronic
1141530437 16:84642938-84642960 ATGGAGAAACTGAGGCACAACGG + Intergenic
1141768625 16:86075039-86075061 ATGGAGAAACAGGCCCAGGGTGG - Intergenic
1141894337 16:86948936-86948958 ATGGGGAAACTGAGGCATGAGGG + Intergenic
1142393608 16:89818029-89818051 ATCGAGAAATTGAAACAGGCTGG + Intergenic
1142683983 17:1566697-1566719 CTTGAGAAACTGAGAGAGGACGG - Intergenic
1144262610 17:13537405-13537427 ATGGAGGAGCTGAGAAAGGAAGG - Intronic
1144670528 17:17130311-17130333 AGGGACAAACAGACAAAGGAAGG - Intronic
1144949516 17:18986480-18986502 ATGGAGAAACTGAGATCCGAGGG - Intronic
1145051540 17:19665876-19665898 ATGGAGCAACTGACTTAGGACGG - Intronic
1145708479 17:26945313-26945335 ATGGAGACCCAGACACAAGATGG + Intergenic
1146373478 17:32279762-32279784 ATGGAGAAACAGAGGCAGGGTGG + Intronic
1146691179 17:34877231-34877253 AAGGAGAAAGGGAGACAGGAAGG + Intergenic
1146913709 17:36664807-36664829 ATGGAGAAACTGAGTCTGGGAGG + Intergenic
1146937414 17:36820903-36820925 ATGAAGAAACTGGTGCAGGAGGG - Intergenic
1147112692 17:38275243-38275265 ATGAAGAAACTGAAACAGCAAGG - Intergenic
1147135593 17:38432238-38432260 ATTAAGAAACTGACACAGGCCGG + Intronic
1147305044 17:39557357-39557379 TAGGAGAAAATGACCCAGGAAGG - Intronic
1147406339 17:40215082-40215104 ATGAAGAAACAGACACAGCAAGG - Intergenic
1148049633 17:44763282-44763304 ATGGAGAAACAGGCACAGAGAGG + Intronic
1148416932 17:47513996-47514018 ATGAATAAACTGAAACAGCAAGG + Intergenic
1148547351 17:48528501-48528523 ATGGAGAAACAGAAGCAGGCAGG + Intergenic
1149326692 17:55538054-55538076 ATAGAGGATCTCACACAGGAAGG - Intergenic
1149848275 17:60020248-60020270 CTGTAGAAACTCACTCAGGAAGG + Intergenic
1149861894 17:60126276-60126298 CTGTAGAAACTCACTCAGGAAGG - Intergenic
1150086627 17:62276815-62276837 CTGTAGAAACTCACTCAGGAAGG + Intronic
1151126394 17:71849816-71849838 ATGGAGAAACAGACATAGAAAGG + Intergenic
1151484093 17:74387715-74387737 ATAGAGGAACTGAGGCAGGAGGG - Intergenic
1152387743 17:79985215-79985237 ACGGACACACAGACACAGGAGGG - Intronic
1153641072 18:7157649-7157671 ATGGAGAAATTGTCCCAGGTTGG - Intergenic
1154021360 18:10666658-10666680 ACGGAGAAGCAGCCACAGGAAGG + Intronic
1156144177 18:34156323-34156345 CTGGAGAAAATGAAACAGAAAGG + Intronic
1156239942 18:35243466-35243488 ACAGGGAAACTCACACAGGAGGG - Intronic
1156402021 18:36748013-36748035 AAGCAGAAACTGACACAAGCTGG - Intronic
1156470297 18:37373608-37373630 ATTAAGAAACTGGCACAGGGAGG + Intronic
1156625433 18:38902260-38902282 ATTGAGAAACTGACAGTGGTAGG + Intergenic
1156738487 18:40293924-40293946 ATGGAGGAACTGTCACAGATTGG - Intergenic
1157678420 18:49584575-49584597 ATGGAGAAAATGCCAGAGGAGGG - Intronic
1159076782 18:63689187-63689209 ATGGAGGAACTGACAGAAGCAGG + Intronic
1159684318 18:71398689-71398711 ATGGAGAAAGTAACACAACAGGG + Intergenic
1160119111 18:76111549-76111571 GTGGAGAGACTGACTTAGGATGG + Intergenic
1161898747 19:7101886-7101908 ATGAGGAAACTGAAACACGAAGG + Intergenic
1162509735 19:11110834-11110856 ATGGGGAAACTGAGGCATGAGGG - Intronic
1162531590 19:11239352-11239374 ATGGAGAAACAGGCTCAGCATGG + Intronic
1162805612 19:13136564-13136586 ATGGAGGAGCTGATACAGCAAGG + Intronic
1163141706 19:15353756-15353778 ACAGGGAAACTGACACAGCAGGG + Exonic
1163183273 19:15618786-15618808 ATGGTGGAAGTGCCACAGGATGG - Intronic
1163247517 19:16106241-16106263 AGGGAGAAACAGACACACAAAGG - Intergenic
1163597497 19:18228701-18228723 ATGGAGAAAGAGTCACAGCAAGG + Intronic
1164067657 19:21734214-21734236 ATGGATAAACTGACAGAAGTAGG + Intronic
1164535222 19:29081003-29081025 ATGGAGAGCCTGAGACTGGAAGG + Intergenic
1164903282 19:31946469-31946491 ATGGAGAGACTGAGGCAGAAAGG + Intergenic
1165528622 19:36378057-36378079 AGGGAGAAAATTCCACAGGAAGG + Intronic
1166803478 19:45471626-45471648 ATGGAGAAACTGAGGCAAAATGG - Intronic
1166978727 19:46620569-46620591 ATGGAGAAGCTGGCAGATGAAGG - Exonic
1167294801 19:48643756-48643778 ATGCAGAAACTGACACACAGAGG - Intronic
1167557351 19:50204535-50204557 ATGTGGAAACTGAGGCAGGAAGG - Intronic
1167616572 19:50537723-50537745 AAGAAGAAACTGACAAAGTATGG + Intronic
1167643376 19:50693892-50693914 ATGGGGACAGAGACACAGGATGG + Intronic
1167660924 19:50795584-50795606 CTGTAGAAGCTGAAACAGGAGGG - Intergenic
1168454579 19:56496453-56496475 TTGGAGAAACTGAAAGGGGAAGG + Intergenic
925130731 2:1492487-1492509 ATGGACAAAGTGAAAGAGGAAGG - Intronic
925881915 2:8359871-8359893 CTGGAGAATCAGGCACAGGATGG + Intergenic
926111192 2:10184820-10184842 ATGGGGAAACTGAGTCAGAAAGG + Intronic
926629414 2:15123169-15123191 AAGGAGAAACTGAGAGAGCATGG - Intergenic
927092769 2:19724977-19724999 AGGGACAAACTGATACAGGAGGG - Intergenic
927192647 2:20527395-20527417 ATGGGGAAACTGAGGCAGTAGGG + Intergenic
927458266 2:23276046-23276068 ATGGAGAGACTGAGGAAGGAAGG - Intergenic
928063194 2:28135883-28135905 ATGGATAAACTGAAATAGGAAGG - Intronic
928309478 2:30197625-30197647 CTGGAGAAACTGGCTCAGGCAGG + Intergenic
928435396 2:31251532-31251554 ATGAAGCAACTGAGTCAGGAGGG + Intronic
928673809 2:33630315-33630337 ATGGTAAAAATGATACAGGAGGG + Intergenic
929417041 2:41754131-41754153 AGGGAGAAAGTGAATCAGGATGG - Intergenic
929924670 2:46198306-46198328 ATGGAAAAGCTGAGGCAGGAAGG - Intergenic
930003176 2:46874958-46874980 CTGGATAAACTGAGGCAGGAAGG + Intergenic
930235567 2:48885646-48885668 AAGGAGAGGCTGATACAGGAAGG + Intergenic
930352383 2:50273614-50273636 ATTGAAAACCTGACATAGGAAGG + Intronic
930552340 2:52851850-52851872 ATGGACAAACTGACACAAGTAGG - Intergenic
930738542 2:54804598-54804620 ATTGATTAACTGACACAAGAAGG - Intronic
931030237 2:58167412-58167434 ATGTAGAAACAGACAGAGAAAGG - Intronic
931660868 2:64561112-64561134 ATAGAGAAAATGAAAAAGGAGGG + Intronic
931734235 2:65179493-65179515 ATGGATAAAGTGAAACAGGTGGG - Intergenic
931802173 2:65769119-65769141 ATGGAGAATGTGACACATTAAGG - Intergenic
931849957 2:66243220-66243242 ATTGAAAAACAGACACAGTATGG - Intergenic
931850900 2:66249588-66249610 ATTGAAAAACAGACACAGTATGG - Intergenic
932023235 2:68109481-68109503 ATGGTGAAACTGGCATGGGAAGG - Intronic
932654473 2:73597679-73597701 ATGGGGAAACTGACACAAAGAGG + Intronic
934502815 2:94872904-94872926 ATGGAGACACTGACAGTGCACGG + Intronic
934589189 2:95530950-95530972 ATGTAGGAGCTGACACAGCACGG - Intergenic
934874988 2:97909362-97909384 AAGGAGAAAATGAGACTGGAGGG + Intronic
936427574 2:112434180-112434202 ATGGAGAAACTGACAGAGAAGGG - Intronic
936789245 2:116131272-116131294 ATCGAGAAACAGAGACAGTATGG + Intergenic
937576505 2:123428931-123428953 ATCCAGAAACTGACAGAGGCAGG + Intergenic
937893828 2:126962590-126962612 ATGGACAAACTGACAGAAGTAGG - Intergenic
939807071 2:146787260-146787282 AAGGAAAAACTGACAAGGGAAGG + Intergenic
940139953 2:150483044-150483066 ATGGAGAAAGGGAGAAAGGAAGG + Intronic
941694239 2:168534209-168534231 ATGGACAAACTGACAGAAGTAGG - Intronic
942608328 2:177714979-177715001 GTGGGGAACCAGACACAGGAGGG - Intronic
945168709 2:206973518-206973540 ATGAAGAAACTGAGACAGAGAGG + Intergenic
945758987 2:213887307-213887329 ATGGAGGAACTGTCACAGATTGG - Intronic
946074396 2:217061954-217061976 AAGGAGAAAATGACACAGCTAGG + Intergenic
946666114 2:222051581-222051603 AGAGAGAAACAGACACAGAAAGG + Intergenic
947379402 2:229530656-229530678 ATAGAGAAACTGACTCCAGAAGG - Intronic
947525690 2:230875451-230875473 ATGGAGAAACTGAGACGGTGGGG - Intronic
948906732 2:240983213-240983235 ATGGGGAAACTGAGCCTGGAGGG + Intronic
1169566943 20:6865032-6865054 ATGGAGAAAATCATAGAGGACGG + Intergenic
1169997919 20:11579477-11579499 TTGGAGCATCTGAGACAGGAAGG + Intergenic
1170858230 20:20077415-20077437 ATGGAGATCATGACACAGGCTGG + Intronic
1171134024 20:22680542-22680564 AAGGAGAAAATGACCCAGCAGGG - Intergenic
1171263037 20:23749725-23749747 ATGGGTAAACTGACACTCGAGGG - Intronic
1172718646 20:36982831-36982853 ATGGAGACAATGATACAGGGTGG + Intergenic
1172875194 20:38159959-38159981 AGGGGGAAACTGAGACTGGAGGG + Intronic
1172963148 20:38812916-38812938 ATGCAGAAACTGACTCAGTAGGG + Intronic
1174276334 20:49407295-49407317 ATGGGGAAACTGAGACTGGTGGG + Intronic
1174466371 20:50720742-50720764 ATGAAGAAACTGAGTCAGGAAGG + Intergenic
1174691439 20:52510389-52510411 ATTGGGAAATTGACTCAGGATGG - Intergenic
1175058663 20:56221349-56221371 ATGGAGCAGGTGACTCAGGAAGG - Intergenic
1176206792 20:63893287-63893309 TTGGAGAAAATAAGACAGGAAGG - Intergenic
1176374657 21:6081024-6081046 ATGGAGAAACTGACAGAGAAGGG + Intergenic
1176652463 21:9563459-9563481 AGGAAGAAACAGACACAGGCAGG + Intergenic
1177520789 21:22221404-22221426 TTGGGGAAAAAGACACAGGATGG - Intergenic
1177854440 21:26385240-26385262 ATGTATAAATGGACACAGGAAGG + Intergenic
1178305066 21:31484518-31484540 AGGGAGAAACACACAAAGGAAGG + Intronic
1178330952 21:31690661-31690683 ATGGAGATACTGACACAGGAGGG + Intronic
1179480303 21:41672544-41672566 ATGGAGAAACTGAGGCAGGACGG + Intergenic
1179485544 21:41708081-41708103 AGGAAGAAAGTGACACAGGATGG - Intergenic
1179748818 21:43457221-43457243 ATGGAGAAACTGACAGAGAAGGG - Intergenic
1180595512 22:16970380-16970402 ATGGAGAAACTAATTCAGAAAGG - Intronic
1182111857 22:27729396-27729418 ATGGGGAAACAGACTCAGAAAGG - Intergenic
1182387834 22:29961393-29961415 ATGTATATACTGACATAGGAGGG + Intronic
1182746158 22:32607050-32607072 ATGCAGACATGGACACAGGAAGG - Intronic
1183649244 22:39144903-39144925 ATGGAGAAACTGAGACACGGAGG + Intronic
1183730179 22:39614158-39614180 ATGAAGAAACTGAGACAGAAGGG - Intronic
1183786441 22:40031594-40031616 ATGGAGAAACTGAGGCAGAAAGG - Exonic
1183946998 22:41332245-41332267 ATGGATAAACTGAGACAGGTTGG - Intronic
949959035 3:9296684-9296706 ATGGGGAAACTGAGGCAGGGTGG - Intronic
950152429 3:10698054-10698076 AGGCAGAAACTGACACAGTCAGG - Intronic
950627178 3:14255981-14256003 ATGGAGAAATTGAGGCTGGAGGG - Intergenic
951051159 3:18095710-18095732 ATGAAGAAACAGGCACAGAAAGG - Intronic
951778051 3:26332136-26332158 CTGGAGATACTGAGAGAGGAGGG + Intergenic
952063293 3:29537172-29537194 AAGGTAAAACTGACACATGAGGG + Intronic
952144325 3:30515276-30515298 ATGGTGAAAATGACACAGGGAGG - Intergenic
952310665 3:32186375-32186397 ATGGAGGGGCTGACACAGGCTGG + Intergenic
954616290 3:51970266-51970288 ACAGAGAAACTGACCTAGGAGGG - Intronic
954707880 3:52490675-52490697 ATGGAGAAAGGGACAGAGGGAGG - Intronic
954722680 3:52578941-52578963 CTGGAGAAACTGCCAGGGGAAGG + Intronic
955123427 3:56085032-56085054 ATGGAGAAACTGAGGCTGAAAGG - Intronic
955629526 3:60957639-60957661 GTGAAGAAATTGACACAGGAGGG - Intronic
956066604 3:65403106-65403128 ATGGAGAAACTGAGACAGAGAGG - Intronic
956326538 3:68059366-68059388 ATGAGGAAACTGAGACAGAAAGG + Intronic
956536573 3:70283363-70283385 TTGGAGAACCTGAAACTGGATGG + Intergenic
956647436 3:71470230-71470252 ATGAAGAAACAGGCTCAGGAAGG - Intronic
956726191 3:72158438-72158460 ATGGAGAGAGAGAGACAGGAAGG + Intergenic
957278869 3:78124600-78124622 ATTCAGCAACTGACAAAGGATGG + Intergenic
957850023 3:85795953-85795975 ATGGGCAAACTGACACTGGGAGG - Intronic
957894690 3:86406629-86406651 ATGAAGAAACTGAAACAAGGAGG - Intergenic
958259768 3:91367058-91367080 ATAGGGAAACTGAAGCAGGAGGG + Intergenic
958423578 3:93955546-93955568 ATGGAGAACATAACACAGGACGG + Intronic
958880831 3:99667052-99667074 ATGAAGAAACAGATTCAGGAAGG + Intronic
959642945 3:108661905-108661927 ATGGAGAAACTGAAAAGGAAAGG + Exonic
960038864 3:113129038-113129060 ATGGAGAAAAGGGCACAGGGAGG + Intergenic
960982146 3:123239486-123239508 ATGGACACATGGACACAGGAAGG - Intronic
960983489 3:123254469-123254491 GTGGGGAAACAGAGACAGGAAGG - Intronic
961104591 3:124230322-124230344 AAGTAGAAACTGACTCTGGAAGG - Intronic
961141960 3:124563303-124563325 AAGATGAAACTGACTCAGGAAGG - Intronic
961321490 3:126079494-126079516 ATGGAGAAACTGACACAGGATGG + Intronic
961410259 3:126715289-126715311 ATGAAGAAACTGAGTCAGGGAGG - Intronic
961917093 3:130387710-130387732 AGGGAGAAACTGTAAGAGGATGG + Intronic
962506243 3:136048992-136049014 ATGGTAAAACGGAAACAGGAAGG - Intronic
962967203 3:140366044-140366066 AAGGACAAGCTGACACAGGAGGG + Intronic
963972223 3:151442899-151442921 ATGGAAAAAGTGACACAGTGAGG - Intronic
965581938 3:170277910-170277932 ATGGAGGAACAGACGTAGGAAGG - Intronic
965607977 3:170515525-170515547 AAGGAGAAAATGACAAAGCAGGG + Intronic
965847389 3:172980047-172980069 ATAGAGAACCAGACAAAGGAAGG - Intronic
966660998 3:182414807-182414829 ATGGAGAAACAGACCCAGTTTGG + Intergenic
966779235 3:183569415-183569437 GTGCAGAAACAAACACAGGAGGG + Intergenic
967584798 3:191199067-191199089 AGGGAGAAACTGAAGAAGGAAGG + Intergenic
968718528 4:2180138-2180160 ATGAAGAAACTAACACTGAAGGG - Intronic
969102583 4:4780473-4780495 ATGGAGAAACTGAGGCTTGAGGG - Intergenic
969125790 4:4946844-4946866 ATGGAGATTCTGAAGCAGGATGG + Intergenic
969296694 4:6274448-6274470 ATGGGGAAACAGACACAGTGAGG + Intronic
969463916 4:7343651-7343673 ATGGGGAAACTGAGGCAGGCAGG - Intronic
969966699 4:11003864-11003886 ATGGAGAAACAGGCTCAGGGAGG + Intergenic
970046181 4:11857385-11857407 TTGGAGAGACTTAAACAGGAAGG - Intergenic
970440371 4:16076507-16076529 ATGAGGAAACTGACACAGAGAGG + Intronic
971303382 4:25460480-25460502 ATGTAGAAAATGAAAAAGGAGGG - Intergenic
971810151 4:31414428-31414450 ATTGAGAAAGTGAGAGAGGAAGG - Intergenic
971871563 4:32246577-32246599 ATGGGGAAAATGAAACAAGACGG - Intergenic
972333138 4:38081767-38081789 ATGAGGAAACTGACACAGAGGGG + Intronic
974467277 4:62273405-62273427 ATGGAGAACCTGAATCTGGAAGG - Intergenic
976242019 4:82967716-82967738 ATGGAGATATTCACTCAGGATGG - Intronic
977459644 4:97309086-97309108 ATGGGGAAAATGAAACTGGAGGG + Intronic
978206293 4:106084086-106084108 ATGGACAAAGTGACAGAAGAAGG + Intronic
979409193 4:120353860-120353882 CTTGAGAAACAGACATAGGAAGG - Intergenic
979865751 4:125751153-125751175 ATGGAGAAAGTGGCAGAGAATGG - Intergenic
980331661 4:131418343-131418365 ATGCAGAAATTAACTCAGGATGG + Intergenic
981435949 4:144722324-144722346 ATGGACAAAGGGACACAGTATGG - Intronic
981809498 4:148757704-148757726 AAGGAGAGAGTGACACAAGAGGG + Intergenic
981932918 4:150209667-150209689 ATTTGGAAACAGACACAGGATGG + Intronic
981956476 4:150479815-150479837 ATGGAAAAACTGACTCGGTAAGG + Intronic
982576481 4:157117307-157117329 ATGAAGAAACTAAGACAGCAGGG - Intronic
982759321 4:159262043-159262065 ATGGGGAACCAGACACAGGATGG - Intronic
983532256 4:168823017-168823039 ATGGAGAAACGGACCCACAAAGG - Intronic
984664562 4:182411636-182411658 CTGGTGTAACTAACACAGGAGGG + Intronic
986011763 5:3723713-3723735 ATGGATAAACTGACAGAAGCAGG - Intergenic
986085544 5:4441689-4441711 ATGGGGCATCTGACACAGTAGGG + Intergenic
986124370 5:4871755-4871777 GTGGAGAAGCTTTCACAGGAAGG + Intergenic
986276404 5:6278991-6279013 ACTGAGAAACTGTCACAGGTTGG + Intergenic
987781828 5:22447500-22447522 GTGGAGACAGTAACACAGGAAGG + Intronic
988375877 5:30435212-30435234 ATGGAGAAATGTACACAGTATGG - Intergenic
988673359 5:33405967-33405989 ATGGAAAAACTGACACCTAAGGG - Intergenic
988973694 5:36494334-36494356 ATGGAGAAATGAACAAAGGAGGG + Intergenic
989305565 5:39951361-39951383 ATGGATAAACTGACAGATGTAGG + Intergenic
990321459 5:54633572-54633594 ATGGAGAAACTGAGACACAGGGG - Intergenic
991454367 5:66786470-66786492 ATATAGAAAATGACATAGGAGGG + Intronic
992248093 5:74849038-74849060 ATCAAAAAACTGACACAGAATGG + Intronic
992458387 5:76937792-76937814 AGGGAGAAAATCACACAGAAAGG - Intergenic
992489530 5:77228688-77228710 ATGGAGAAAATGAAAGATGAGGG + Intronic
992953252 5:81881572-81881594 ATGGAGAAAATGAAGCAGGGAGG + Intergenic
993418795 5:87673586-87673608 ATGGAGAAACGGAAAAAGCAAGG - Intergenic
994050371 5:95355828-95355850 ATGAGAACACTGACACAGGATGG - Intergenic
994356630 5:98800551-98800573 ATGGAGCAAGTGACAGAGAAGGG + Intergenic
994672092 5:102774436-102774458 ATGAAAAAACTGACACAGAAAGG - Intronic
995763607 5:115590884-115590906 AGAGAGAGACTGACACATGATGG - Intronic
996129498 5:119764676-119764698 TTAAAGAAACTGACAAAGGATGG + Intergenic
996663915 5:126035743-126035765 ATGGAGAAATGGAGACATGAAGG - Intergenic
996793940 5:127323881-127323903 ATGGAGAGACCAACACAGTAAGG - Intronic
996829828 5:127727692-127727714 ATGGATAAACTGACAGAAGTAGG + Intergenic
996894542 5:128464640-128464662 TTGGAGAATCTGGCACTGGATGG - Intronic
997787212 5:136724429-136724451 ATGTAGAAACATAGACAGGAAGG - Intergenic
997851603 5:137337962-137337984 ATAGAGAAACAGACTCAGGGAGG - Intronic
998261019 5:140632001-140632023 GTGGATAACCTGACACTGGACGG - Exonic
998425600 5:142025631-142025653 ATGGGGAAAGTGAGACGGGAAGG + Intergenic
998722175 5:144965667-144965689 AGGGAAAAACTGAGAGAGGAGGG - Intergenic
998859042 5:146425206-146425228 ACAGAGAAACTGACAGAAGAGGG - Intergenic
999730445 5:154473345-154473367 ATGGAGAAACAGACTCAGGGAGG - Intergenic
999829247 5:155303428-155303450 ATGGAGGAACTGAGACTGGAGGG - Intergenic
1000116584 5:158159702-158159724 ATGAAGAAACTGCCCAAGGAAGG - Intergenic
1000379248 5:160614299-160614321 AAAGAGAAAATGAAACAGGAAGG + Intronic
1000399194 5:160807615-160807637 ATTGAGAAACTGATGGAGGAAGG + Intronic
1000718027 5:164671044-164671066 ATGGAGAAACTGATCAAAGAGGG - Intergenic
1000944897 5:167409540-167409562 AAAGAGAAACTCACACAGAAAGG + Intronic
1001254699 5:170174642-170174664 ATGGAGAAATTGACACTAAAAGG - Intergenic
1001344159 5:170875737-170875759 ATGGACAAACTGACAGAAGTAGG - Intronic
1001749359 5:174117144-174117166 ATGGAGAAAGTGAAGCTGGAAGG - Intronic
1001788954 5:174437952-174437974 ATGGACAAATTGACAGAAGAAGG + Intergenic
1002480758 5:179499234-179499256 AAGGAGAAACAGACACTGAAAGG + Intergenic
1002580417 5:180206875-180206897 TTGCAGAAAGAGACACAGGAAGG + Intronic
1002640165 5:180626959-180626981 ATGGGCAAACAGACACAGCAAGG - Intronic
1003686968 6:8314321-8314343 ATGGACAAACTGACAGAAGTAGG - Intergenic
1006324700 6:33344909-33344931 GTGGAGAGTCAGACACAGGAAGG + Intergenic
1006495215 6:34417992-34418014 ATGGAGAAACTGAGGCAGAGGGG + Intronic
1006912599 6:37573168-37573190 ATGGAAAAACAGAAACAGAAAGG - Intergenic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1009994340 6:70881839-70881861 ATGGACAGACAGACAGAGGAGGG - Intronic
1010837434 6:80607501-80607523 ATGGAGAAACTGAAAAAGCCTGG + Intergenic
1011903260 6:92327622-92327644 AGGTAGAGACTGACACAAGAAGG - Intergenic
1012290993 6:97455182-97455204 ACTGAGAAACTGTCACAGGTTGG + Intergenic
1013189039 6:107786306-107786328 AGGCAGAAACTGACACTGGTGGG - Intronic
1013379790 6:109556974-109556996 ATGGATGAACTGACAGAGGTAGG - Intronic
1013821849 6:114163561-114163583 ATTGAGTAACTGACACAAAATGG - Intronic
1014625889 6:123724159-123724181 ATGGAGAAAATGAAATAGGCAGG - Intergenic
1015869429 6:137760960-137760982 CTGGTGAATCTGAAACAGGAAGG + Intergenic
1016209431 6:141510394-141510416 CTGGAGAAGCTGAAGCAGGAGGG - Intergenic
1016554345 6:145318774-145318796 AAGGAGAAACTGAGTAAGGAAGG + Intergenic
1017159036 6:151348394-151348416 TTTGAGAAGCTGAGACAGGAGGG + Intronic
1017387239 6:153900669-153900691 ATGGAGAATCTGGCACTTGAAGG + Intergenic
1017853042 6:158322335-158322357 ATGGAAAAACAGAAACAGAAAGG - Intronic
1018024582 6:159794368-159794390 CTGCAGAAACTAACACAGAAAGG - Intronic
1018938567 6:168291158-168291180 ATGGAGGCAATGAGACAGGATGG + Intergenic
1019668791 7:2267094-2267116 ATGGAGAAACAGGCTCAGGGAGG - Intronic
1020512338 7:9073411-9073433 TTGGAGAAGCTGAGGCAGGAGGG - Intergenic
1021514639 7:21470866-21470888 ATGGTGAAACAGACTGAGGATGG - Intronic
1021612667 7:22473358-22473380 ATGTAGAAAGTGACTCAGGTGGG + Intronic
1021624715 7:22581619-22581641 ATAGAGACACTAACAAAGGACGG - Intronic
1022419925 7:30210700-30210722 AGGGCGACACAGACACAGGAGGG + Intergenic
1023749529 7:43358444-43358466 ATCGAGAAAGTGACTCAGGAAGG + Intronic
1023924658 7:44657989-44658011 ATGGAAAAACAGACACACAAAGG - Intronic
1026224019 7:68425038-68425060 ATTGGGAGACTGAGACAGGAGGG + Intergenic
1026772923 7:73213495-73213517 ATGAAGAAAATGTCACATGAAGG - Intergenic
1026875607 7:73877373-73877395 ATGGGGAGACTGAGGCAGGAAGG + Intergenic
1027013786 7:74766891-74766913 ATGAAGAAAATGTCACATGAAGG - Intergenic
1027074252 7:75179141-75179163 ATGAAGAAAATGTCACATGAAGG + Intergenic
1027353651 7:77336381-77336403 ATTGAGGAACAGACCCAGGATGG - Intronic
1028385512 7:90248850-90248872 ATGAGGAAACAGACACAGAAAGG - Intronic
1028970602 7:96854410-96854432 ATGAAGAAAGTGAAACAGGGAGG + Intergenic
1028997724 7:97119719-97119741 ACGGAGCAACTGTCACAGAATGG - Intronic
1029835143 7:103301514-103301536 AAGGAGAAACAGAAAAAGGAAGG + Intronic
1029880868 7:103808212-103808234 ATGGACACATGGACACAGGAAGG + Intronic
1030716452 7:112813388-112813410 ATGGACACATGGACACAGGAAGG - Intergenic
1030864610 7:114684326-114684348 ATTCAGAAACTGTCAGAGGAGGG + Intronic
1031339596 7:120582597-120582619 ATGGAGAAAGAGGCAGAGGAGGG - Intronic
1031514251 7:122682782-122682804 ATGAGGAAACTGACCCAGAATGG - Intronic
1031969286 7:128052452-128052474 ATGGGGAAAAGGAGACAGGATGG - Intronic
1031977234 7:128101829-128101851 ATGAAAGCACTGACACAGGATGG - Intergenic
1032146689 7:129389231-129389253 ATGGACAAAAAGACACAGGTAGG - Intronic
1032158195 7:129487948-129487970 ATGGAGAAACTGAAGCACTAAGG + Exonic
1032189154 7:129753238-129753260 ATTGAGAAACTGACCCAGAGAGG - Intronic
1032419556 7:131766916-131766938 ATGAAGAAACTGAGACAACAGGG + Intergenic
1032548289 7:132761761-132761783 ATGGGGAAACTGAGGCAGGGTGG + Intergenic
1032631934 7:133662988-133663010 GTGGAGAAAGTGAAACAGAAAGG + Intronic
1032738498 7:134714379-134714401 AGGGAGAACCTGCCAGAGGAAGG - Intergenic
1033068070 7:138175349-138175371 ATGGAGAAAAGGAGAAAGGAAGG + Intergenic
1033459092 7:141529222-141529244 ATGGAGACACAGACACACGAGGG - Intergenic
1033791633 7:144797633-144797655 ATGGATGAACTGACAGAGGTAGG + Intronic
1034015882 7:147586033-147586055 AAGGTGAAACTGAAGCAGGAAGG + Intronic
1034284979 7:149878636-149878658 ATGGTGAGCCTGGCACAGGAGGG - Intronic
1035488782 7:159253647-159253669 AGAGGAAAACTGACACAGGAAGG + Intergenic
1036554929 8:9850836-9850858 ATGGAGGGTCTGACCCAGGAAGG + Intergenic
1037318360 8:17620418-17620440 ATGGAGAAAAAGATACAGGGTGG + Intronic
1037485479 8:19342848-19342870 ATGGAGAAAGGGAAAGAGGAGGG + Intronic
1037636814 8:20707554-20707576 TTGGAGACAATGACACATGAAGG + Intergenic
1037664664 8:20957388-20957410 GTGGAGAAACTGACAGAAGTAGG + Intergenic
1038706852 8:29902202-29902224 ATGGATGAACTGACAGAGGTAGG + Intergenic
1039597232 8:38801370-38801392 ATGCAGAAACTGACTCAAAATGG - Intronic
1039685790 8:39801003-39801025 ATGGAGTAATTGACAGAAGATGG - Intronic
1039900047 8:41745203-41745225 AGGGAGAAATTGTCAGAGGAGGG + Intronic
1041021273 8:53641713-53641735 ATGGACAAACTGACAGAAGTAGG - Intergenic
1042178228 8:66058667-66058689 ATCTACAAATTGACACAGGAGGG - Intronic
1042731575 8:71940878-71940900 ACTGAGAAATTGACACAGGTTGG - Intronic
1043358724 8:79444227-79444249 ATGGGTAAACTGATACAGAATGG - Intergenic
1043588096 8:81793395-81793417 ATGGAGACACTTACAGAGGGAGG - Intergenic
1043975175 8:86577056-86577078 ATTGAGAAACAGACAGAGCAGGG - Intronic
1044108187 8:88238093-88238115 ATGGTGAACCTGTCACAGGAAGG + Intronic
1044341645 8:91052766-91052788 ATGGTGAAAATGGCACAAGAAGG + Intergenic
1045058322 8:98389191-98389213 ATGGAGAAGGTGAAACAGGCTGG - Intergenic
1045121182 8:99036975-99036997 ATGAAGAATCTGAGACATGAAGG - Intronic
1045864307 8:106847361-106847383 AAAGTGAAAGTGACACAGGAGGG - Intergenic
1046702704 8:117418942-117418964 TTGGAGAGACTGAGACTGGATGG + Intergenic
1046918088 8:119698875-119698897 ATGGAGAGACAGAAACAGAAGGG - Intergenic
1047505826 8:125479230-125479252 AGGAAGAAACTTACAAAGGAAGG - Intergenic
1047681605 8:127259297-127259319 ATGGAGAGACTTACACTGTAGGG - Intergenic
1047686435 8:127309339-127309361 ATGAAGAAACTGACATAACAGGG - Intergenic
1048803066 8:138212164-138212186 AGGGAGAGTCTGACAAAGGATGG + Intronic
1050374910 9:4960650-4960672 CTGGGGAAACTGAAGCAGGAGGG - Intergenic
1050620101 9:7443077-7443099 AAGGAGGAAGTGAGACAGGACGG - Intergenic
1051458985 9:17292791-17292813 ATGGATGAACTGACACAAGTAGG - Intronic
1051901301 9:22044702-22044724 ATGGGGATACAGGCACAGGAAGG - Intergenic
1052236499 9:26217459-26217481 ATGCAGAAGCAGGCACAGGAAGG + Intergenic
1053402929 9:37843652-37843674 TTGGAGAAAATTATACAGGAAGG + Intronic
1053415254 9:37943388-37943410 ATTCAGTAACTGACACTGGACGG + Intronic
1053423731 9:37997598-37997620 GTGTAGAAGCTGGCACAGGAGGG + Intronic
1054405893 9:64762397-64762419 TTTGAGCAATTGACACAGGAAGG - Intergenic
1056162038 9:83906387-83906409 CTGGAGAACCTGCCAGAGGAGGG - Intronic
1056200687 9:84273156-84273178 ATGGGGAAACTGAGACAGAGTGG + Intergenic
1056325788 9:85477612-85477634 AGGGACAAGCTGTCACAGGAAGG - Intergenic
1056369922 9:85943294-85943316 AGGGACACACTGAGACAGGAAGG + Intronic
1056966312 9:91165496-91165518 GTGGAGGAACTGTCCCAGGATGG + Intergenic
1057317054 9:93976243-93976265 ATGTAGGATCAGACACAGGAGGG - Intergenic
1057403718 9:94747828-94747850 TTGGACAAACTGACATAGCATGG - Intronic
1057689120 9:97267573-97267595 ATGGAGCAACTGTCACAGATTGG - Intergenic
1058635444 9:107033867-107033889 ATGAAGAAACAGACTAAGGAAGG - Intergenic
1059147679 9:111916325-111916347 ATGGGGAAAGTGAAAGAGGATGG - Intronic
1059350789 9:113663377-113663399 AGGGAGAATGTGGCACAGGATGG - Intergenic
1059513789 9:114874436-114874458 ATGGGAAAACAGACACAGCAAGG + Intergenic
1059672790 9:116507347-116507369 ATGGAGAAACAGGCACAGAAGGG + Intronic
1059694769 9:116720681-116720703 ATAGAGAAACTGACTATGGAAGG - Intronic
1059766978 9:117392947-117392969 ATGGACAAATTGGCACAAGATGG + Intronic
1060434137 9:123579071-123579093 ATGGAGAAACAAAAACAGGGGGG + Intronic
1060640663 9:125235689-125235711 ATGGAGATTCTGACACAGCTAGG + Exonic
1060872700 9:127055599-127055621 ATGAGGAAACAGACACAGAAAGG + Intronic
1061048043 9:128177992-128178014 ATGGGGAAACAGACTCAGGAGGG + Intronic
1061610157 9:131740403-131740425 GTGGAAAATCTGACCCAGGAGGG - Intergenic
1061660334 9:132125903-132125925 ATGGAGAAGAGAACACAGGAGGG - Intergenic
1061984737 9:134123970-134123992 CTGGAGAAAACGACACTGGAGGG + Intergenic
1062373176 9:136250764-136250786 ATGGGGACCCTGACACAGGCCGG + Intergenic
1187554374 X:20338089-20338111 CTGGAAAAAATGAGACAGGAGGG - Intergenic
1188009536 X:25041592-25041614 ATGGAGACACAGAGAGAGGATGG - Intergenic
1188388619 X:29592032-29592054 ATGGGGAAACTCACACAGGATGG + Intronic
1189909644 X:45797228-45797250 ATGGAGAAACTGAGTCCTGAAGG - Intergenic
1190118239 X:47639482-47639504 AGAGAGAAACTTACAGAGGAGGG - Intronic
1190262365 X:48805472-48805494 AAGGAGCAACTGATCCAGGAGGG + Exonic
1190330439 X:49231932-49231954 ATGGAGAAACTGTGTCAGGGAGG + Intronic
1190801240 X:53791074-53791096 ATGCTGAAACCCACACAGGAAGG + Intergenic
1190862028 X:54354418-54354440 ATTGAGAGACTGAGAAAGGAGGG + Intronic
1193239656 X:79152754-79152776 ATAGAGAAACTGAAAAATGAGGG - Intergenic
1193600384 X:83503334-83503356 AAAGAGAAACTGAGACTGGACGG + Intergenic
1194039333 X:88920217-88920239 ATGGAGAAGGTTACACAGAAAGG + Intergenic
1194484309 X:94468861-94468883 ATAGAGAAACTGGAACAGCATGG + Intergenic
1194653690 X:96546046-96546068 ATGGAGAAAGGGACCCATGAAGG + Intergenic
1194804240 X:98307504-98307526 CTGGAGAACCTGACCCAAGATGG + Intergenic
1195091394 X:101463081-101463103 ATGGAGAAAGAGAGACAGAATGG - Intronic
1195374184 X:104210226-104210248 ATGGAGAAAGTATCATAGGAAGG + Intergenic
1195656995 X:107341215-107341237 ATGGAGAAAGAGACAAAAGATGG + Intergenic
1196416687 X:115478734-115478756 AGGGAGGAACTGTCAAAGGAAGG + Intergenic
1197145463 X:123167345-123167367 ATGTATTAACTGAGACAGGAAGG - Intergenic
1197230475 X:123998533-123998555 ATGGAGAAACTGAAACTGTGGGG - Intronic
1197424649 X:126280860-126280882 ATGAAGAAACTGAGACAAAAAGG - Intergenic
1198055047 X:132985518-132985540 ATGGGGAAACTGACTCAGACTGG - Intergenic
1198575443 X:138005432-138005454 ATAAAGAAACTGACACTGGCTGG - Intergenic
1198634763 X:138684226-138684248 ATTGATAACCTGACAAAGGAAGG + Intronic
1199114672 X:143977223-143977245 AATGAGAAACTGTCACATGATGG - Intergenic
1199554282 X:149089747-149089769 ATGAGAACACTGACACAGGAAGG + Intergenic
1199937907 X:152595148-152595170 AAGGAGAAACAGACACAGGCAGG - Intergenic
1201071402 Y:10150320-10150342 ATGAAGATCCTGCCACAGGATGG - Intergenic