ID: 961323822

View in Genome Browser
Species Human (GRCh38)
Location 3:126097926-126097948
Sequence CTGTGTAAGGGGGAGACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 438
Summary {0: 1, 1: 0, 2: 4, 3: 43, 4: 390}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961323822_961323830 16 Left 961323822 3:126097926-126097948 CCCTCTGTCTCCCCCTTACACAG 0: 1
1: 0
2: 4
3: 43
4: 390
Right 961323830 3:126097965-126097987 AGTTCAGGAATCCAGAGGCCTGG 0: 1
1: 0
2: 2
3: 28
4: 275
961323822_961323831 20 Left 961323822 3:126097926-126097948 CCCTCTGTCTCCCCCTTACACAG 0: 1
1: 0
2: 4
3: 43
4: 390
Right 961323831 3:126097969-126097991 CAGGAATCCAGAGGCCTGGCTGG 0: 1
1: 0
2: 2
3: 24
4: 361
961323822_961323828 1 Left 961323822 3:126097926-126097948 CCCTCTGTCTCCCCCTTACACAG 0: 1
1: 0
2: 4
3: 43
4: 390
Right 961323828 3:126097950-126097972 GCACTTGCAAATGCTAGTTCAGG 0: 1
1: 0
2: 0
3: 5
4: 92
961323822_961323829 11 Left 961323822 3:126097926-126097948 CCCTCTGTCTCCCCCTTACACAG 0: 1
1: 0
2: 4
3: 43
4: 390
Right 961323829 3:126097960-126097982 ATGCTAGTTCAGGAATCCAGAGG 0: 1
1: 0
2: 0
3: 11
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961323822 Original CRISPR CTGTGTAAGGGGGAGACAGA GGG (reversed) Intronic
900120092 1:1045181-1045203 CAGTGTAAGGGGGCCACAGGCGG - Exonic
900569576 1:3351691-3351713 CAGAGGAAGGGAGAGACAGAGGG - Intronic
900649562 1:3724178-3724200 CTGGGGTAGGGGGAAACAGAGGG + Intronic
900908633 1:5578402-5578424 CAGTGGGAGGGGGAGAGAGAGGG - Intergenic
901356563 1:8654878-8654900 CTTTGGGAGGCGGAGACAGAAGG - Intronic
901798963 1:11696222-11696244 CTATGGGAAGGGGAGACAGAGGG - Intronic
902363073 1:15952696-15952718 CCGTGTGAGTGGGAGACACATGG + Intronic
902574218 1:17367146-17367168 CCTTATAAGGGGGAGGCAGAGGG - Intergenic
902987022 1:20161092-20161114 CTGTGTGAGGAGGAGATGGAGGG + Intergenic
903021500 1:20398538-20398560 CTCAGTGAGTGGGAGACAGATGG + Intergenic
903139497 1:21330730-21330752 CTGAGTCAGGGGGAGGAAGAAGG - Intronic
903552737 1:24169308-24169330 TTGGGGAAGTGGGAGACAGATGG + Intronic
903758829 1:25683741-25683763 GTGTGTTAGGGAGAGAGAGAAGG + Intronic
904296762 1:29524425-29524447 CTCAGTCCGGGGGAGACAGATGG - Intergenic
904879217 1:33682221-33682243 CTTTGTAAGAAGAAGACAGAGGG - Intronic
905371719 1:37486031-37486053 CTGTGAAAGGAGGAGAGGGAGGG + Intergenic
905746386 1:40422137-40422159 CTGTGGAAAGGGGAGAGCGAGGG - Exonic
906042744 1:42801313-42801335 CTTTGGGAGGCGGAGACAGATGG - Intergenic
906199668 1:43951409-43951431 CTGTGTAAGAGTTAGCCAGATGG + Intronic
906562263 1:46767870-46767892 GTGTGTGAAGTGGAGACAGAGGG - Intronic
907332991 1:53683493-53683515 CTGTGAAATGGGGAGAATGAGGG + Intronic
908140015 1:61174466-61174488 CAGTGCAAGGGGCAGAGAGATGG + Intronic
908250729 1:62263656-62263678 CTGTGTGAGGGGGAAGGAGAGGG - Intronic
909115021 1:71522714-71522736 GTGTGTAAGGGGGGGGTAGAGGG - Intronic
911103470 1:94111781-94111803 CGGTGTAGTGGGGAGACAGACGG + Intronic
911252027 1:95587208-95587230 CTGTGTAAGGGGAAAACTGTTGG - Intergenic
911553905 1:99318926-99318948 CTATGGAAGGGGTTGACAGATGG - Intergenic
911634772 1:100222744-100222766 CAGTGAAAGGAGGAGAAAGAGGG - Intronic
912746990 1:112253256-112253278 GTGTGTATGGGGTAGAGAGAGGG - Intergenic
913387554 1:118276083-118276105 CAGGGAAAGGAGGAGACAGAAGG + Intergenic
913401654 1:118441041-118441063 CTATGTAAAGGGCAGTCAGAAGG - Intergenic
915648163 1:157288621-157288643 CTGTGGCAAGGGGAGTCAGACGG + Intergenic
916046005 1:161000349-161000371 CTGTGGAAGAGAAAGACAGAAGG + Intronic
917102568 1:171460816-171460838 CTTTGGAAGGCGGAGACAGGCGG + Intergenic
917355390 1:174121787-174121809 CTGTGTGCGGGTGAGAGAGAGGG + Intergenic
917727013 1:177837866-177837888 ATGTGTGAGAGAGAGACAGAGGG - Intergenic
918123019 1:181556484-181556506 CTGTGGGAGGGGGAGGCAGAGGG + Intronic
919389418 1:196963587-196963609 CTTTGGAAGGCGGAGGCAGACGG + Intergenic
919708672 1:200704511-200704533 CTGAGGAAGGGGAAGACATAAGG - Intergenic
921341338 1:214137440-214137462 CTGAGTGAGGGGGATACAAAAGG - Intergenic
921778505 1:219131761-219131783 CTGTGTCAGGGTGGAACAGAGGG + Intergenic
921962971 1:221055425-221055447 CTATGTGTGGGGGAGTCAGAGGG + Intergenic
922957288 1:229613978-229614000 CTGTGCAAGAAGGGGACAGAGGG + Intronic
923114560 1:230922850-230922872 CTGTGTGTTGGGGATACAGAAGG - Intronic
923373896 1:233340591-233340613 CAGGGGAAGGGGGAGGCAGATGG + Intronic
924896794 1:248347379-248347401 CTGTAGAAGAGGGAGACAGGAGG - Intergenic
1062818730 10:518577-518599 CTGTGTCAGGGCCAGAGAGAAGG + Intronic
1065021893 10:21508566-21508588 GTGTGTAAGAGGGAGAGAGAGGG + Intergenic
1065168056 10:23001423-23001445 CTTTATAAGAGGGGGACAGAAGG - Intronic
1065536030 10:26715638-26715660 CTTTGGGAGGGGGAGACAGGCGG - Intronic
1065660983 10:28004031-28004053 CTGTGCAAGGGGTGGACAGTAGG - Intergenic
1066705635 10:38175014-38175036 CTGTGGAAGGAAGAAACAGAGGG + Intergenic
1070085229 10:73230554-73230576 CAGTGTAAAAGGGAAACAGAGGG + Intronic
1070997384 10:80797539-80797561 CTGAATAAGAGGGAGGCAGAAGG - Intergenic
1074842702 10:117371426-117371448 CTTTGTAAGGCTGAGACAGGCGG - Intronic
1075420274 10:122295298-122295320 CAGTCAAAGGGGGAGAAAGAGGG + Intronic
1076413406 10:130267625-130267647 CTTTATAAGAGGGAGACAGAGGG - Intergenic
1076661009 10:132056181-132056203 CTGAGTGTGGGGGTGACAGAAGG - Intergenic
1076731393 10:132440772-132440794 CTGTGTGCTGGGGAGACAGTGGG - Intergenic
1076742403 10:132493227-132493249 CTGTGTGAGATGGAGACTGAGGG - Intergenic
1077047632 11:553420-553442 CTGTGGAGGGGGCAGACAGAGGG + Intronic
1077273314 11:1691901-1691923 CTGTGTAGGTGGGATCCAGAGGG + Intergenic
1078402691 11:11042344-11042366 CTGTGGAAGAGGGAAACAAAAGG + Intergenic
1078514982 11:12014315-12014337 CTGTTGCAGGGGCAGACAGAGGG + Intergenic
1078910080 11:15722991-15723013 CTGTGAAAGGGAGGGGCAGAGGG + Intergenic
1079085079 11:17439588-17439610 CAGTGGGAGGGGGAGAGAGACGG - Intronic
1080569421 11:33542619-33542641 CTGGGGGAGGGGGAGACGGATGG - Exonic
1080873576 11:36257796-36257818 CTGTGGAGGGTGGAGGCAGATGG + Intergenic
1081864613 11:46352651-46352673 CTGTTCAAGGAGGAGGCAGAGGG - Intronic
1082262862 11:50090670-50090692 ATGTGGAAGAGGGAGGCAGAAGG + Intergenic
1084052648 11:66610460-66610482 CCTTGTAAGAGGGAGGCAGAAGG - Intergenic
1084549129 11:69830578-69830600 GAGGGAAAGGGGGAGACAGAAGG - Intergenic
1085252171 11:75151090-75151112 CAGGGCAAGGGAGAGACAGAAGG + Exonic
1085286756 11:75367646-75367668 CTTTGGAAGGCTGAGACAGACGG + Intergenic
1085456043 11:76665959-76665981 CTGTGTAAGGCGGAGAGGAAAGG + Intronic
1085958901 11:81435889-81435911 CAGAGTAAGAGAGAGACAGAGGG - Intergenic
1086036494 11:82421667-82421689 CTGTGAAAAGGAAAGACAGAGGG + Intergenic
1088560533 11:111110925-111110947 CTTTGTAAGAGGGAGACAGGAGG + Intergenic
1088737730 11:112741962-112741984 CTGAGACAGGGGGAGACAGGGGG + Intergenic
1089279958 11:117366996-117367018 CTGTGAAAGGAGGAGACAGAAGG + Intronic
1089555305 11:119312696-119312718 CTGGATAAGGGGGAGCCAGCAGG + Intronic
1089644445 11:119869405-119869427 GTGTGGAAGGGGATGACAGAGGG - Intergenic
1090907328 11:131088315-131088337 TTGTGTTAGGGGGAGACAGGTGG - Intergenic
1091152222 11:133339451-133339473 CTGTGTTTGGGGGAAACAGTGGG - Intronic
1091948686 12:4572823-4572845 CTGTTAAATGGAGAGACAGAGGG - Intronic
1092040178 12:5377262-5377284 CTGTGAGAGTGGGAGAGAGATGG + Intergenic
1094581872 12:31740710-31740732 CTGGGGGAGGGGGAGAAAGATGG + Intergenic
1094650160 12:32368449-32368471 CTGTGGAAGGCCGAGGCAGAGGG + Intronic
1095192174 12:39270368-39270390 GTGTGGATGGGGGAGACACAGGG - Intergenic
1095950069 12:47776966-47776988 CTGTGGCACGAGGAGACAGAGGG + Intronic
1096578456 12:52569447-52569469 CAGTGGGAGGAGGAGACAGAGGG + Intronic
1098998862 12:77153064-77153086 CAGTGTATGGGGGAGGGAGAAGG + Intergenic
1099871725 12:88358055-88358077 CTGAGTAAAGGAGAGAGAGAAGG - Intergenic
1100298208 12:93282395-93282417 CTTTGGAAGGGCGAGACAGGCGG + Intergenic
1100617263 12:96240589-96240611 CTGGGTAAGGGGGACAGAGCAGG - Intronic
1101092280 12:101299950-101299972 CTGTCCAAGGGGGAGAAAAAGGG - Intronic
1102226994 12:111235834-111235856 ATGTGGCAGGTGGAGACAGAGGG + Intronic
1102409424 12:112704422-112704444 CTGGGTGATGGAGAGACAGAGGG + Intronic
1102562356 12:113771130-113771152 CTGTGTTGCGAGGAGACAGACGG - Intergenic
1102620442 12:114190467-114190489 CTCTGTAAGGGGGAGAGCAATGG - Intergenic
1102686064 12:114725596-114725618 CTTGCCAAGGGGGAGACAGAGGG + Intergenic
1104358590 12:128111196-128111218 CTGTGTTTGGGGGAGACCCAGGG - Intergenic
1104512649 12:129394566-129394588 CTGGAGAAGGGGGAGACAGAGGG + Intronic
1104849082 12:131862679-131862701 CTGTGTGTGCGGGAGACACACGG - Intergenic
1104873501 12:132017060-132017082 CAGTGAAGGGGGCAGACAGAAGG - Intronic
1104896933 12:132169159-132169181 GTGTGGCAGGGGGAGACAGCGGG + Intergenic
1105333311 13:19438911-19438933 CAGTGGAAAGGTGAGACAGAGGG - Intronic
1105878406 13:24580881-24580903 CAGTGGAAAGGTGAGACAGAGGG + Intergenic
1105921449 13:24968193-24968215 CAGTGGAAAGGTGAGACAGAGGG - Intergenic
1107526702 13:41239915-41239937 CTTTGGAAGGGCGAGACAGGCGG + Intronic
1107966636 13:45603653-45603675 CTGGGAAAGGGGGTGACAGAGGG - Intronic
1108557386 13:51607926-51607948 CTTTGTAAGAGGGAGGCAGAAGG + Intronic
1109923197 13:69097998-69098020 GTGTGTGAGAGGGAGAAAGAGGG + Intergenic
1111308469 13:86448243-86448265 CTGTCTGAGGAGGAGATAGAGGG - Intergenic
1111767594 13:92552468-92552490 CTTTGTAAGGGGAAGATAAATGG + Intronic
1113943609 13:114031829-114031851 CTGTGGGAGGGTGGGACAGACGG + Intronic
1114401025 14:22410816-22410838 CTCTGGAATGGGAAGACAGAGGG - Intergenic
1115063250 14:29220680-29220702 CCGTGTATGAGTGAGACAGATGG + Intergenic
1115574774 14:34700305-34700327 CTGAGTAATTGGGAAACAGATGG + Intergenic
1116662087 14:47723436-47723458 TTGTCTAAGTGGGAAACAGAGGG + Intergenic
1118128991 14:62941010-62941032 GAGAGTAAGGGAGAGACAGATGG + Intronic
1118510898 14:66472080-66472102 ATGTGAAAGGGGGAAAAAGATGG - Intergenic
1119388686 14:74275649-74275671 CACTGGAAGGGGGAGACAGATGG + Intergenic
1119749302 14:77066289-77066311 CTGAGTGAGGGGGAGTGAGAGGG - Intergenic
1120139064 14:80907298-80907320 TTAGGTAAGGAGGAGACAGAGGG - Intronic
1120247401 14:82023355-82023377 TTTTGTAAGAGAGAGACAGAGGG + Intergenic
1120672408 14:87378179-87378201 GTGTGTAAGAGAGAGACAGAGGG + Intergenic
1120751912 14:88205456-88205478 CTGTGTAGTAGGGAGACACATGG - Intronic
1121405141 14:93715303-93715325 CTGTGTCCTGGGGATACAGAGGG - Intergenic
1121612389 14:95290429-95290451 CTTTATAAGAGGAAGACAGAGGG + Intronic
1121685766 14:95833936-95833958 CAGGGTAACGGGGAGACCGAAGG - Intergenic
1121798383 14:96754120-96754142 GTGTGGAAGGGGGAGAGGGAAGG + Intergenic
1121999317 14:98633573-98633595 CTGTGTCAGAGACAGACAGAAGG + Intergenic
1122206448 14:100150290-100150312 CTGGGTAAGAGGGAGGCAGTGGG - Intronic
1122696073 14:103552893-103552915 CAGTGTGAGATGGAGACAGAAGG + Intergenic
1122953576 14:105059574-105059596 CTGTGTAGGCGAGAGACAAATGG + Intronic
1123499752 15:20868921-20868943 CTGTGGATGGGGGAGGGAGAGGG + Intergenic
1123593225 15:21879884-21879906 CTGTGGATGGGGGAGGGAGAGGG + Intergenic
1123633653 15:22280352-22280374 CTTTGGGAGGCGGAGACAGAAGG + Intergenic
1123776256 15:23583661-23583683 CTGCGTGAAGGAGAGACAGAAGG + Intronic
1123990189 15:25677720-25677742 CTGTTAAATGGGGAGACAAAGGG - Exonic
1124552025 15:30690345-30690367 CTGTGTGTGGGGCACACAGAAGG + Intronic
1124679218 15:31715327-31715349 CTGTGTGTGGGGCACACAGAAGG - Intronic
1125451714 15:39815180-39815202 CTGTGTGTAGAGGAGACAGAAGG + Intronic
1125981941 15:44010238-44010260 GTGTGTAAAGTGGAGACAGAAGG - Intronic
1126074971 15:44900384-44900406 CCTTGTAAGAGGGAGATAGAGGG + Intergenic
1126078849 15:44939034-44939056 CTGTGGGAGGTGGAGACAGGCGG - Intergenic
1126398376 15:48243412-48243434 CTTTGGGAGGGGGAGACAGGTGG + Intronic
1126405299 15:48316907-48316929 CTTTGTAAGGGGGAAGCTGAGGG + Intergenic
1127271971 15:57409622-57409644 GTGTGAAAGGGGGAGGGAGAAGG + Intronic
1128811165 15:70573769-70573791 CTTGGTAAGGGGGAGAGAAAAGG + Intergenic
1129067149 15:72914802-72914824 CTGTGGAAGGAGAAGGCAGAAGG - Intergenic
1129118934 15:73383183-73383205 CCTTATAAGAGGGAGACAGAGGG + Intergenic
1130184527 15:81667305-81667327 CTTTGGGAGGTGGAGACAGATGG + Intergenic
1130885960 15:88092859-88092881 TTTTGTAAGGGAGAGGCAGAGGG - Intronic
1130952204 15:88601448-88601470 CTTTGGAAGGCCGAGACAGATGG - Intergenic
1131329209 15:91480661-91480683 CTGTGTAAGCAGGAGACAGAAGG + Intergenic
1131799665 15:96055867-96055889 CTATGTAATGGGGAGGCAAAAGG + Intergenic
1202965344 15_KI270727v1_random:169808-169830 CTGTGGATGGGGGAGGGAGAGGG + Intergenic
1133634325 16:7651565-7651587 CTGAATAATGGGGAGACATAAGG + Intronic
1133925713 16:10190355-10190377 CTCTGTGAGAGGGAGACGGAGGG + Intergenic
1134519155 16:14910897-14910919 CTGGCTAAGAGAGAGACAGAGGG - Intronic
1134554772 16:15155329-15155351 CTGGCTAAGAGAGAGACAGAAGG + Intergenic
1134706825 16:16309552-16309574 CTGGCTAAGAGAGAGACAGAGGG - Intergenic
1134777423 16:16865227-16865249 ATGTGGAAGGGGGAGTGAGAAGG + Intergenic
1134960715 16:18402572-18402594 CTGGCTAAGAGAGAGACAGAGGG + Intergenic
1136228070 16:28872198-28872220 CTGTTCCAGGGGGAGCCAGAGGG + Exonic
1138091307 16:54176969-54176991 CTGTGTTAGAGTGAGAGAGAGGG - Intergenic
1138454025 16:57110879-57110901 CTCTGTAAAGAGGACACAGAAGG - Exonic
1138509975 16:57503102-57503124 CTGGGTAAGGTGAAGACGGAAGG + Intergenic
1139188909 16:64838994-64839016 CTGTGCAAGGTGGCAACAGAAGG - Intergenic
1141202438 16:81908327-81908349 CTGGGTCAGGGTGAGACAGAAGG + Intronic
1141246836 16:82315723-82315745 CAGTTTAAAGTGGAGACAGATGG + Intergenic
1203140526 16_KI270728v1_random:1762404-1762426 CTTTGTGAGGCTGAGACAGACGG - Intergenic
1143850937 17:9811530-9811552 CTGGTTTAGGGGGTGACAGATGG + Intronic
1144063093 17:11600413-11600435 TAGTGTATGTGGGAGACAGAAGG + Intronic
1144410092 17:14992347-14992369 TTGTGGAAGGGGCAGAGAGATGG - Intergenic
1146482002 17:33212294-33212316 CCTTGTAAGAGGGAGGCAGAAGG + Intronic
1146505273 17:33399439-33399461 GTGTAGAAGAGGGAGACAGAGGG - Intronic
1147647646 17:42043426-42043448 CTGTGTGTGGGGGAGGCAGGGGG - Intronic
1148464775 17:47858213-47858235 CTGGGCAAGGAGGAGAAAGATGG - Intergenic
1150417057 17:64996237-64996259 CTCTGTAAGAGGGAGACAGAGGG + Intergenic
1150794609 17:68227686-68227708 CTCTGTAAGAGGGAGACAGAGGG - Intergenic
1150926046 17:69533180-69533202 CTTTGTGAGGGTGAGACAGGTGG - Intronic
1151153839 17:72110747-72110769 GTGTGTATGAGAGAGACAGAGGG + Intergenic
1151887552 17:76932130-76932152 CTGTGTAAGAAGAAGAAAGAAGG - Intronic
1152282184 17:79391312-79391334 CTGTCTCAGGGGGAGAAAAAGGG + Intronic
1153828428 18:8898426-8898448 CTTTGGAAGGAGGAGAAAGATGG + Intergenic
1153842413 18:9018670-9018692 CCTTCTAAGGGGGAGGCAGAAGG + Intergenic
1156863439 18:41864349-41864371 CTGCGTAAGGTGGACACAGAGGG + Intergenic
1157306255 18:46519746-46519768 CTGTGTAAAGGAGAGAAAGATGG - Intronic
1157381420 18:47221754-47221776 CTGTTTAGCAGGGAGACAGATGG - Intronic
1157605317 18:48922771-48922793 CTGTGGAAGGAGGGGAGAGAGGG - Intronic
1158911947 18:62073199-62073221 GTGTGTAAGGGGGGGATGGAGGG + Intronic
1159209944 18:65305605-65305627 CTGTGAAAGGGAGAGAAAGGAGG - Intergenic
1159893065 18:73971385-73971407 GTGTGTAAGAGGGAGATACAAGG - Intergenic
1160592968 18:79954150-79954172 CTTTGTAAGAGGGAGGCAGAAGG + Intergenic
1161227632 19:3154465-3154487 CTGGGTAATGGGTGGACAGATGG + Intronic
1161787026 19:6333120-6333142 CTGTGGTAGGGGGAGGCAGAGGG - Intronic
1162458738 19:10801967-10801989 CTGTGGAATGGGGTGACAGGAGG - Intronic
1163200938 19:15768610-15768632 TTGTGTAAGGGGGAAGGAGAAGG - Intergenic
1163667414 19:18609900-18609922 ATGTGTAAGGGGCAGAAGGAGGG + Intronic
1164400762 19:27900656-27900678 CTAAGCATGGGGGAGACAGAGGG - Intergenic
1164811444 19:31159933-31159955 CTTTGGAAGGCTGAGACAGAAGG - Intergenic
1165312487 19:35037249-35037271 CTGTGTTAGGAGAAGGCAGATGG + Intronic
1165722959 19:38092732-38092754 GTGTTTGAGGGGGAGACAAAAGG + Intronic
1166534021 19:43560749-43560771 CAGTGTACGGAGGAGACAGAAGG - Intronic
1166762828 19:45235428-45235450 CCACGTAAGGGGGAGAGAGATGG + Intronic
1166961004 19:46495737-46495759 CTGTGTCAGGGAGAGAGGGAGGG - Exonic
1167168192 19:47813607-47813629 CAGAGAAAGGGGGAGACAGAGGG - Intronic
1167663005 19:50807422-50807444 CTGTATGAGAGGGAGATAGATGG + Intergenic
925306138 2:2849264-2849286 CTGTGGAGGGGGCAGGCAGATGG - Intergenic
925712891 2:6758669-6758691 ATGTGGAAGAGGGAGGCAGAGGG + Intergenic
925831980 2:7904587-7904609 CTGTGTGAGCAGGGGACAGAGGG - Intergenic
925999511 2:9319095-9319117 CTGTTTAAGGGGGCAGCAGACGG + Intronic
926141024 2:10368522-10368544 GTGTGTCTGGGGGAGTCAGAAGG - Intronic
927705879 2:25296336-25296358 CTGTGTAAGGGGCGGGCAGGAGG + Intronic
928642422 2:33314304-33314326 CTTTGGAAGGCGGAGACAGGAGG + Intronic
929582876 2:43094514-43094536 CTGTGTGAGTGGGAGAGAGAAGG - Intergenic
929583078 2:43096504-43096526 CTGTGTGAGTGGGAGAGAGAAGG - Intergenic
929610499 2:43267465-43267487 CTGTGTAAGGGGGAAAGACTGGG - Intronic
929763334 2:44824261-44824283 CAGTTTTAGAGGGAGACAGATGG + Intergenic
930359137 2:50357031-50357053 CTTTGGAAGGCGAAGACAGAAGG + Intronic
931062718 2:58548960-58548982 CTTTGGAAGGGCGAGGCAGATGG + Intergenic
932145562 2:69313054-69313076 CATTGTAAGAGGGAGGCAGAAGG - Intergenic
932327625 2:70873537-70873559 CTGTTAAAGAAGGAGACAGAAGG - Intergenic
932911886 2:75814996-75815018 CTTTATAAGAGGAAGACAGAGGG - Intergenic
935386897 2:102509306-102509328 GTGTGGAAGAGGGAGGCAGAAGG - Intronic
936022787 2:109007595-109007617 CTATGTGAGAGGGAGTCAGAGGG - Intergenic
936286739 2:111187093-111187115 GTGTGAGAGGGGGTGACAGAGGG - Intergenic
938810360 2:134847048-134847070 CAGTGAAAGGGGGAGATAGTAGG + Intronic
939125856 2:138176812-138176834 CTGAGTGAAGGGGAGAGAGAAGG + Intergenic
940984841 2:160042837-160042859 GTGTGTATGTGTGAGACAGAGGG + Intronic
942849141 2:180462087-180462109 CTGAATAAGGGACAGACAGAAGG - Intergenic
943608357 2:190002753-190002775 CTCTGTAGGTAGGAGACAGAAGG - Intronic
944293162 2:198031125-198031147 CTTTGTGAGGTGGAGACAGGAGG + Intronic
945384572 2:209181657-209181679 CTATGCAAGGTGGAGACAAAGGG - Intergenic
945578185 2:211558372-211558394 CTTTGTAAGTGGGAGGCAGAAGG - Intronic
946905024 2:224407451-224407473 CTGGAAAAGGGGGAAACAGATGG - Intergenic
947731936 2:232436055-232436077 CTGTGTCAAGGGGAGACTGAAGG - Intergenic
948612151 2:239176568-239176590 AAGTGGAAGGAGGAGACAGACGG + Intronic
1168950167 20:1792539-1792561 CCATATAAGAGGGAGACAGAGGG - Intergenic
1169819770 20:9697327-9697349 GTGTGTAGAGGGGAGAGAGAAGG - Intronic
1170128507 20:12992089-12992111 CTTTGGAAGGCTGAGACAGATGG - Intergenic
1170596033 20:17806634-17806656 CAGGGTAAGGAGGAGAAAGAAGG + Intergenic
1172038540 20:32027813-32027835 CTGTGTGCTGGGGATACAGATGG + Intronic
1172621276 20:36320014-36320036 CTGGGAGAGGGGGACACAGAGGG - Intronic
1173155730 20:40606978-40607000 CTTTATAAGAGGGAGACAGAAGG - Intergenic
1173353463 20:42265684-42265706 CAGTGGAAGGGGTTGACAGATGG - Intronic
1173381951 20:42553369-42553391 GAGTGGAAGGGGGAGATAGAAGG - Intronic
1173498028 20:43533222-43533244 CTTAGTGAGAGGGAGACAGATGG - Intronic
1173628963 20:44495661-44495683 CTGTGTAAGGAGGGGGCAGGGGG - Intergenic
1174368980 20:50073589-50073611 CTGGGTCAGGGGGCAACAGATGG - Intergenic
1175421174 20:58834669-58834691 CTGTGGCAGAGGGAGAGAGAGGG + Intergenic
1176513564 21:7766809-7766831 CCTTGTAAGAGGGAGGCAGAGGG + Intronic
1176739730 21:10589682-10589704 CAGTGGAAAGGTGAGACAGAGGG + Intronic
1177172017 21:17665526-17665548 CTTTGTAAGGTTGAAACAGAGGG - Intergenic
1178647677 21:34397333-34397355 CCTTGTAAGAGGGAGGCAGAGGG + Intronic
1179065852 21:38024329-38024351 CTTTGTAACAGGGAGGCAGAGGG + Intronic
1181339308 22:22165672-22165694 CTGTGTAAGTGAGGGGCAGAAGG + Intergenic
1181780706 22:25190896-25190918 CTGTGTAAGGGGAAGAATGAGGG + Intronic
1182874300 22:33677471-33677493 AGGGGTAAGGGGGAGATAGATGG - Intronic
1183872203 22:40748493-40748515 CTGTGTAAGAGGGGGCCTGAAGG - Intergenic
1184168624 22:42745326-42745348 CTGGGAAAGGGTGAGTCAGAGGG - Intergenic
1184407760 22:44309536-44309558 CTGTGTAACAGAGAGACTGAGGG - Intronic
1185230722 22:49678960-49678982 CAGTGTAGGGGGGCCACAGACGG + Intergenic
949127955 3:469118-469140 GTGTGAAAGAGGGAGAGAGATGG - Intergenic
949389444 3:3543010-3543032 CTGTGAAATGAGGATACAGATGG - Intergenic
950640376 3:14344665-14344687 CTGAGAAAGGGGGAGACACTGGG + Intergenic
950884070 3:16347579-16347601 CTGTGTAACAGAGAGGCAGAGGG - Intronic
950947115 3:16960504-16960526 CTGAGTAGGTGGGAGACAGAGGG - Intronic
951117934 3:18886901-18886923 ATGTGTAAGATGGAGAGAGATGG - Intergenic
952206460 3:31185435-31185457 ATTTGTAAGAGGGAGCCAGAGGG + Intergenic
953145107 3:40267732-40267754 ATGTGTAAAGGGCAGATAGAAGG + Intergenic
953520946 3:43642752-43642774 GTGTGTAAGGGGGAAAAAGGAGG - Intronic
955632140 3:60986011-60986033 CGTTATAAGGGGGAGACAGGAGG - Intronic
956721025 3:72117594-72117616 CTGTGTAAAGGAGAGAGGGAAGG + Intergenic
956728218 3:72174121-72174143 CTGTGTATGTTGGAGAGAGAAGG + Intergenic
957580084 3:82060795-82060817 CTGGATAAGGGAGGGACAGAAGG - Intergenic
957686713 3:83511731-83511753 CTTTGAAAGGCTGAGACAGAAGG - Intergenic
957788722 3:84913803-84913825 GTGGGGAAGGGGGATACAGAAGG - Intergenic
958115009 3:89203945-89203967 CTGGGTAAAGCGGAGACAGAAGG + Intronic
958186024 3:90120144-90120166 CTTTATAAGAGGGAGGCAGAGGG - Intergenic
958816232 3:98919255-98919277 CTAAATAAGGGGAAGACAGAAGG + Intergenic
960615833 3:119595336-119595358 CATTGTAAGGTGGAGACAGATGG - Intergenic
961323822 3:126097926-126097948 CTGTGTAAGGGGGAGACAGAGGG - Intronic
962201693 3:133405388-133405410 CTGTGCAAGGGACAGAAAGACGG - Intronic
962345937 3:134619088-134619110 CTGTGGAAGAGGGAGAGGGATGG + Intronic
962712177 3:138097442-138097464 CTGTGAATGGGGCAGTCAGATGG - Intronic
963393607 3:144702823-144702845 CTGTAGTAGGGGGAGTCAGATGG - Intergenic
964365692 3:155949003-155949025 CTTTGTAAGGCCGAGACAGAAGG + Intergenic
964635729 3:158856812-158856834 CTGTGTAAGGAGGCTAAAGATGG + Intergenic
966414049 3:179670938-179670960 CTTTGTGAGGCCGAGACAGACGG - Intronic
966889017 3:184392810-184392832 CTTTGGGAGGCGGAGACAGATGG + Intronic
966940061 3:184740664-184740686 CTGTGTTTGGGGGAGGAAGAGGG - Intergenic
967122115 3:186391455-186391477 CCTTATAAGTGGGAGACAGATGG + Intergenic
967243184 3:187461393-187461415 GTGTGTAAGAGAGAGAGAGATGG + Intergenic
967913366 3:194559981-194560003 CTATGGAAGGTGGAGACTGAGGG - Intergenic
968455095 4:693591-693613 CTCTGTGAAGGAGAGACAGAGGG - Intergenic
968638718 4:1698116-1698138 CTGTGGGAGGCAGAGACAGACGG + Intronic
968880002 4:3293670-3293692 CTGTGGAATGGGGACAGAGAGGG + Intronic
969065298 4:4474638-4474660 ATGTGGAAGTGGGAGGCAGAAGG + Intronic
969954935 4:10879457-10879479 GTGTGTAAGACAGAGACAGAGGG + Intergenic
970251873 4:14125377-14125399 TTCTGAAAGGGGGAGAGAGATGG - Intergenic
974140565 4:57881093-57881115 GTGTGAAATGGGGAGAAAGAGGG - Intergenic
975345299 4:73286358-73286380 CTGTGGAAGGGAGAGAAAGGAGG - Intergenic
975991271 4:80262487-80262509 TTTTATAAGGGGGAGGCAGAGGG + Intergenic
976426389 4:84907952-84907974 CTGTTTAAGGGGGAAAGAGTGGG + Intronic
977278461 4:95008944-95008966 CTTTGGAAGGCTGAGACAGAAGG + Intronic
977333124 4:95662910-95662932 CTTTGGAAGGCGGAGACAGGGGG - Intergenic
978229282 4:106378802-106378824 AGGTGTGAGTGGGAGACAGAGGG - Intergenic
980640711 4:135574738-135574760 GTCTATAAGAGGGAGACAGATGG + Intergenic
984189127 4:176583664-176583686 GTGTGTATGGGGAAGAGAGAAGG + Intergenic
984782875 4:183541839-183541861 CTGTGCAAGGGGAATGCAGAAGG - Intergenic
985645031 5:1080737-1080759 CTGTTTGAGGAGGACACAGAGGG + Intronic
985803584 5:2021999-2022021 CTGTGTTAGGGGGAGGCAAGGGG - Intergenic
986226041 5:5813623-5813645 CTTTTTAGGGAGGAGACAGATGG - Intergenic
986484020 5:8217295-8217317 CTGCGGATGGGGGAGCCAGAAGG - Intergenic
986617048 5:9628448-9628470 CTGATAAAGGGGAAGACAGATGG - Intergenic
987278740 5:16390226-16390248 CAGTGAGAGGTGGAGACAGATGG + Intergenic
987428299 5:17798670-17798692 CTCTGCAATGGGGAGAGAGAAGG - Intergenic
988499356 5:31771493-31771515 GTGTGGTTGGGGGAGACAGAGGG + Intronic
988787551 5:34578745-34578767 CTTTATAAGAGGGAGGCAGATGG - Intergenic
989223213 5:38993449-38993471 CATTGGAAGGGGGAGAGAGAAGG + Intronic
992341071 5:75823945-75823967 CTGTGGGAGGAGGAGGCAGAAGG + Intergenic
993398365 5:87418548-87418570 CTGGGTAATGGGGAGAATGATGG + Intergenic
993502918 5:88682061-88682083 CTTTTTAAGAGGGAGAGAGAGGG - Intergenic
995291707 5:110463889-110463911 CTGTGTAAGGGGTAGAAATAAGG - Intronic
996767091 5:127045468-127045490 CTCTATAAGAGGGAGTCAGAAGG - Exonic
997380824 5:133436333-133436355 CTGGGTAAGGGGGAGGCAGTGGG + Intronic
998152782 5:139766487-139766509 CTGTGTATGGGGGAAATGGATGG + Intergenic
998251610 5:140557327-140557349 CTGGGGCTGGGGGAGACAGAGGG + Intronic
998557503 5:143139875-143139897 CTGTAGAAGGGGGAGCCAGAAGG + Intronic
998936705 5:147236647-147236669 CTGTGGAAGGGGGAAGCAGATGG - Intronic
999194019 5:149769855-149769877 CTTTTTAAGAGGGAGGCAGAAGG - Intronic
999242321 5:150135108-150135130 TTCTGTAACGGGGAGACAGAGGG - Intronic
1001381794 5:171310501-171310523 GTGTGTTTGGGGGAGGCAGAGGG - Intronic
1001514569 5:172346315-172346337 CTGTGTCAGGGGGAGTCTAAGGG + Intronic
1001600402 5:172924526-172924548 CTGAGGAAGGTGGAGACTGAAGG + Intronic
1002163277 5:177329681-177329703 CTTTGGCAGGAGGAGACAGAGGG + Intergenic
1002842774 6:920801-920823 CAGTGGATGGGGGAGCCAGAAGG - Intergenic
1003432802 6:6055509-6055531 CTGTGTGAGGGAGAAAGAGAGGG + Intergenic
1004010550 6:11681915-11681937 CTGGGAAAGGGAGAGAAAGAGGG + Intergenic
1004272395 6:14207435-14207457 GTGTATAAGGGCAAGACAGAAGG - Intergenic
1004357673 6:14944230-14944252 CTGTGTAGGGGAGATAGAGAAGG - Intergenic
1004640378 6:17509432-17509454 CTGTGGAAGGCTGAGACAGGTGG + Intronic
1004836539 6:19538003-19538025 GTGTGTGAGGGAGAGAGAGAGGG + Intergenic
1005959323 6:30684710-30684732 CTGGGGGTGGGGGAGACAGAGGG + Exonic
1006364297 6:33606263-33606285 CTGTGGGAGGCTGAGACAGATGG + Intergenic
1006802944 6:36771007-36771029 CTGGGTAAGGGAGTGAAAGAGGG - Intronic
1006896852 6:37476690-37476712 CAGAGTCAGGAGGAGACAGATGG + Intronic
1006926299 6:37657353-37657375 CTGTGGAAGGGGCAGAATGATGG - Intronic
1007149300 6:39672223-39672245 CTTTGGAAGGCTGAGACAGAAGG - Intronic
1008742779 6:54629962-54629984 CTTTGAAAGGCGGAGACAGGTGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1014361091 6:120475305-120475327 CTGGGTCAGGGGGAAAGAGAAGG - Intergenic
1015199175 6:130559873-130559895 CTGTGTAAAAGAGAGAGAGAAGG + Intergenic
1016648061 6:146433554-146433576 GTGTGTCAGAGAGAGACAGAGGG + Intronic
1016700710 6:147050763-147050785 GTGTGTATTGGGGAGAAAGAAGG - Intergenic
1016857227 6:148683350-148683372 CTGTGTAAACAGGAGACAGATGG - Intergenic
1017438254 6:154438267-154438289 CTCTGGCAGGGGGAGAGAGAGGG - Intronic
1017438736 6:154442772-154442794 CTGTGGAAGGAGCAGAGAGAAGG - Intronic
1017481747 6:154863876-154863898 CTGCCTAAGGGGGACACAGAAGG - Intronic
1018742663 6:166742513-166742535 TTGTGTCAGGAGGAGGCAGAAGG - Intronic
1020428020 7:8091715-8091737 ATGTGTATGGGGGAAAGAGAGGG - Intronic
1020660490 7:10974956-10974978 CTGGGAAAGGGGAAGAGAGAAGG - Intronic
1020990636 7:15191958-15191980 GTGTGTGAGAGAGAGACAGAGGG - Intergenic
1021381296 7:19969946-19969968 TGGTGTTGGGGGGAGACAGAGGG - Intergenic
1022314588 7:29233631-29233653 ATGTGAAAGAGGGAGACAGAAGG + Intronic
1022338927 7:29450420-29450442 CTTTTTAAGGGAGAGGCAGAAGG + Intronic
1022955418 7:35375857-35375879 CTGTGTAAGTGAGAGACATTTGG - Intergenic
1023659789 7:42459965-42459987 CTTTGAAAGGGTGAGGCAGAAGG - Intergenic
1024335911 7:48204698-48204720 CTGTGTAAGGGCTGGACAGATGG - Intronic
1024498155 7:50070916-50070938 CTGGGAAAGGGGGAGAGATAAGG + Intronic
1024915687 7:54497103-54497125 ATGTGTGAAGGGGACACAGAAGG - Intergenic
1025910589 7:65825438-65825460 ATGTGGAAGAGGGAGGCAGAAGG - Intergenic
1026044765 7:66899383-66899405 ATGTGGAAGAGGGAGGCAGAAGG - Intergenic
1026396379 7:69958567-69958589 TAGTGTAAGGAGGAGACAAAGGG + Intronic
1026636144 7:72083473-72083495 CTTTGTAAGGCCGAGACAGGAGG + Intronic
1026989538 7:74575922-74575944 CTCTGGAAGGCTGAGACAGAAGG + Intronic
1027490573 7:78819593-78819615 CTGTATTAGAGAGAGACAGAGGG + Intronic
1027855965 7:83511639-83511661 CTTTGGAAGGGCGAGACAGGTGG + Intronic
1029034237 7:97502240-97502262 TGGGGTAAGGGAGAGACAGAAGG - Intergenic
1029348176 7:99993714-99993736 GTGTGGAATGGGGAGAGAGAGGG - Intergenic
1032131564 7:129233418-129233440 CTTTGGAAGGGTGAGACAGGAGG - Intronic
1032503454 7:132417637-132417659 GTGTGTGAGGGAGAGAGAGAAGG + Intronic
1032548438 7:132762579-132762601 CTGGGCAAGAGGGAGACACAGGG + Intergenic
1033280724 7:140004719-140004741 CTGTGGAAAGGGGAGACAGCTGG - Intronic
1033589950 7:142800954-142800976 CTGTGTATGTGTGAGAGAGAAGG - Intergenic
1034581923 7:152050938-152050960 CTGTGTTTGGGGGAGGGAGAGGG - Intronic
1034955316 7:155330136-155330158 CTTTCTAAGAGGGAGGCAGAGGG + Intergenic
1035483715 7:159206266-159206288 CGGTGTAAAGGAGAGAGAGAAGG + Intergenic
1036706640 8:11051702-11051724 CTGTGTAGGGTGGAGGCAGTGGG - Intronic
1036796868 8:11762522-11762544 CTGTGTCAGAGGGAGGGAGAGGG - Exonic
1037040877 8:14231191-14231213 GTGTGTAGTGGGGAGAGAGAGGG + Intronic
1037125635 8:15345306-15345328 CTATCTAAGTGGAAGACAGAAGG - Intergenic
1037149366 8:15617029-15617051 CTGTGTAATCAGCAGACAGAGGG + Intronic
1037539644 8:19858461-19858483 CTGTGTGAGAGGGAGCCTGAAGG + Intergenic
1037691379 8:21184086-21184108 CTGTGTGGGAGAGAGACAGATGG - Intergenic
1038259343 8:25979457-25979479 CTGTTTAAGGGGGAAGCAGGTGG + Intronic
1038407145 8:27330618-27330640 CTGTGCAAGGGGGCGGCAGAGGG + Intronic
1038526512 8:28278769-28278791 CTGGGTGAGGGGTAGACGGAGGG + Intergenic
1040893668 8:52342955-52342977 TTGTGTGAGGGAGAGACATATGG + Intronic
1043186511 8:77158426-77158448 CCTTGTAAGAGAGAGACAGAGGG + Intergenic
1045205984 8:100041243-100041265 CTTTGGAAGGGCGAGACAGGCGG + Intronic
1045290282 8:100826949-100826971 CTTTCTCAGGGGTAGACAGACGG + Intergenic
1045315484 8:101040358-101040380 CCTTGTAAGGGAAAGACAGAGGG - Intergenic
1045656033 8:104387456-104387478 CTGTGCAGAGGGGAGACTGAGGG + Intronic
1045950042 8:107841114-107841136 CTGTGGCTGGGAGAGACAGAAGG - Intergenic
1048317009 8:133369992-133370014 CAGTGTGAGGGGCAGGCAGAGGG - Intergenic
1049238578 8:141525175-141525197 CTCTGGAAGGGGGAGCCAGTAGG + Intergenic
1049468823 8:142766115-142766137 CTGGGAAAGGAGGAGAGAGAAGG - Intronic
1055115744 9:72603370-72603392 GTGTGTAGTGGGGAGAGAGAAGG - Intronic
1057920886 9:99095656-99095678 CTGTGTAATGGGGAGGGGGAAGG - Intergenic
1058486019 9:105444163-105444185 CTGTGCAAGGGTAAAACAGAAGG + Intergenic
1060477484 9:123997367-123997389 CTCTGTAAGGAGGAGGCAAAGGG - Intergenic
1060925864 9:127454696-127454718 CTGTGGGTGGGGGAGGCAGATGG - Intronic
1061047686 9:128175960-128175982 CAATGAAAGGGGGAGACACAGGG + Intronic
1061627302 9:131848609-131848631 AGGGGTAAGAGGGAGACAGAAGG + Intergenic
1062122684 9:134842134-134842156 CTGGGGAAGAGGGAGACAGATGG - Intronic
1062237011 9:135515177-135515199 CTGGGGAAGGGGTACACAGAGGG - Intergenic
1062253868 9:135611776-135611798 GTGTGCAGGGGGCAGACAGAAGG - Intergenic
1186140665 X:6568477-6568499 CTGTGTTAGGAGGAGAAAGCAGG + Intergenic
1186317545 X:8387029-8387051 TTGTGTGTGGGGGAGAGAGACGG + Intergenic
1187734262 X:22288610-22288632 GTGTGTGAGAGAGAGACAGAGGG - Intergenic
1188481884 X:30644697-30644719 CTGTGTATGGTAGAGACTGAGGG - Intergenic
1189591600 X:42518217-42518239 ATGTGTAAGAGAGAGGCAGAGGG + Intergenic
1190357032 X:49615380-49615402 GAGTGAAAGAGGGAGACAGAAGG - Intergenic
1191801936 X:65091165-65091187 CCTTATAAGAGGGAGACAGAAGG + Intergenic
1195958271 X:110357957-110357979 ATGTCCAATGGGGAGACAGAGGG - Intronic
1196335911 X:114534057-114534079 CTCTGTCAGGGGGATAGAGAAGG - Intergenic
1197289362 X:124636821-124636843 GTCTGTCAGGGAGAGACAGATGG - Intronic
1197360164 X:125491798-125491820 CTTTGGAAGGCCGAGACAGATGG + Intergenic
1199323154 X:146464588-146464610 CTGTTTAAGGAGGATAAAGATGG + Intergenic
1199675739 X:150187803-150187825 CTTTATAAGGGGGAGGCAGAAGG - Intergenic
1202305015 Y:23459919-23459941 CTTTGGGAGGCGGAGACAGAAGG + Intergenic
1202565795 Y:26210671-26210693 CTTTGGGAGGCGGAGACAGAAGG - Intergenic
1202598029 Y:26563534-26563556 CAGTGGAAAGGTGAGACAGAGGG + Intergenic