ID: 961330460

View in Genome Browser
Species Human (GRCh38)
Location 3:126135243-126135265
Sequence CCAAGGGATGCTTCCAAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 112}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961330460_961330466 4 Left 961330460 3:126135243-126135265 CCCACTTTGGAAGCATCCCTTGG 0: 1
1: 0
2: 1
3: 10
4: 112
Right 961330466 3:126135270-126135292 CGCACCTCCTCACCTCCACCAGG 0: 1
1: 0
2: 2
3: 36
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961330460 Original CRISPR CCAAGGGATGCTTCCAAAGT GGG (reversed) Intronic
901672716 1:10865752-10865774 CCAAGGCAGGCTTACACAGTGGG - Intergenic
905201390 1:36319445-36319467 CCAATGGTGGCTTCCAAAGTGGG + Exonic
907945268 1:59130210-59130232 ACACTGGATGCTTCCAAGGTAGG - Intergenic
911723999 1:101222298-101222320 CCAAGGAAGGCCTCCAAATTAGG + Intergenic
917543277 1:175936283-175936305 CCAAGGCATGATTAGAAAGTTGG + Intergenic
920961120 1:210664967-210664989 CCAGGAGATGCTGCCAAAGAGGG - Intronic
921595070 1:217045787-217045809 CCAAGGGAGGCTTTCAGGGTTGG - Intronic
921725737 1:218521423-218521445 CCCAGGGATCCTGCCAAAGAGGG - Intergenic
921766375 1:218977140-218977162 ACAAGGTATGTTTCCATAGTAGG + Intergenic
1067007688 10:42680357-42680379 CCAAGGGATGCTTTTAAATCAGG + Intergenic
1067908948 10:50324465-50324487 CCTAGGTATGATTCTAAAGTAGG + Intronic
1068037420 10:51778418-51778440 CCAAGGGCAGCACCCAAAGTAGG - Intronic
1068465694 10:57387533-57387555 CTAAGGGATGCTTAGATAGTTGG - Intergenic
1069635483 10:69922488-69922510 ACAAGGGATCCTTCAAAACTGGG - Intronic
1070044169 10:72814207-72814229 CCATGGCATGCTTACAAATTAGG - Intronic
1073322395 10:102623331-102623353 CCCAGAGATGGTTCCCAAGTGGG - Intronic
1074752467 10:116599954-116599976 AAATGGGATGGTTCCAAAGTAGG - Intronic
1079365707 11:19807547-19807569 CCAAGGGATGGTTCCAGGCTGGG - Intronic
1080553096 11:33390949-33390971 GGAAGGGAAGCTTCCACAGTAGG + Intergenic
1083231364 11:61322535-61322557 CCAAGGGATGATTCCAGAAGGGG + Intronic
1092649768 12:10621561-10621583 CCATGGGAAGCTTCTAAAATAGG - Intronic
1093459583 12:19396082-19396104 CTAAGGTATGCTTTCAAAATAGG + Intergenic
1106547733 13:30744962-30744984 CCCAGAGATCCTTCCAAAGGGGG + Intronic
1106866027 13:33964969-33964991 CCAAGGGATGCCACAGAAGTTGG + Intronic
1112490373 13:99857621-99857643 GCAAGGAATGCTTCCAAATGTGG - Intronic
1114240243 14:20860348-20860370 CCAAGGGAAGCCTTCAAAGATGG + Intergenic
1114272958 14:21115128-21115150 CCAAGGGAAGCTTCCCAAAGTGG - Intergenic
1117957004 14:61130687-61130709 CCAAGGGAAGCACACAAAGTAGG + Intergenic
1118502903 14:66379870-66379892 CCAAGAGTTGCTTGCAATGTGGG + Intergenic
1119511513 14:75215347-75215369 CCAAGGGATGATTTCAAGGATGG + Intergenic
1120935695 14:89893136-89893158 CCCAGGAATGCTGCCAGAGTGGG - Intronic
1122766001 14:104070595-104070617 GAAAGGTCTGCTTCCAAAGTTGG - Intergenic
1128549559 15:68589693-68589715 CCAAGGACTGATTCAAAAGTGGG + Intronic
1128991089 15:72260957-72260979 CCAAGGGATTATTCCATACTTGG - Intronic
1130179949 15:81615936-81615958 ACATGGGATGCATCTAAAGTGGG - Intergenic
1130368169 15:83259523-83259545 AGAAGGGCTGCTTGCAAAGTGGG - Intronic
1133660506 16:7911832-7911854 CCTAGGGGAGCTTCCAAAGATGG - Intergenic
1136912839 16:34159022-34159044 CCATGGGAAGCATCCCAAGTGGG + Intergenic
1137438826 16:48481781-48481803 CCAAGGGATGGTTACAAAGTGGG + Intergenic
1141363897 16:83424479-83424501 TCAAGAGAGGCTTCAAAAGTGGG - Intronic
1143876845 17:9998100-9998122 CCAAGGCATGCTTAGAAGGTTGG - Intronic
1146322307 17:31856640-31856662 CCAAGCAAGGCTTCCAAAGGAGG + Intronic
1146394741 17:32455587-32455609 AAAAGGTATGATTCCAAAGTAGG - Intronic
1152227714 17:79100348-79100370 ACTCGGGATGCTTGCAAAGTGGG + Intronic
1154174416 18:12076045-12076067 CCCAGCGATGCATCCACAGTAGG + Intergenic
1158604642 18:58884645-58884667 CAAAGGAATGCTTCTAAAGTTGG + Intronic
1162696766 19:12482758-12482780 CAAAGGGCTCCTTCCACAGTAGG + Intronic
925747598 2:7056793-7056815 CAAGGAGATGCCTCCAAAGTAGG - Intronic
926937151 2:18097402-18097424 CAAAGGAATGCTTTTAAAGTTGG - Intronic
931613783 2:64133546-64133568 CCATGGGTTGGTTCCAAAGAGGG + Intronic
935269436 2:101420745-101420767 CCAGGGAGTGCTTCCAAAGCAGG - Intronic
937157629 2:119732286-119732308 CGCAGGGCTGCTTGCAAAGTGGG - Intergenic
939517450 2:143186906-143186928 TCAAGGGAAGCTGCCAAAATAGG - Intronic
940145446 2:150541148-150541170 ACAAGGGAAGCTTTCAAAGGGGG + Intergenic
943472728 2:188314846-188314868 CAAAGGGATGATTCAAAAGTAGG - Intronic
946366090 2:219249930-219249952 CCAAGCCTTGCTTCCAGAGTTGG + Exonic
946385241 2:219380313-219380335 TCAAGAGATCCTTCCCAAGTAGG + Intronic
948704761 2:239782018-239782040 CCAAGGGCTGCTGCCATGGTAGG + Intronic
1169514328 20:6299584-6299606 CCCAGGGGTGCTTCTAAAGAGGG + Intergenic
1169917196 20:10695485-10695507 CCTAGGAAGCCTTCCAAAGTTGG + Intergenic
1170220632 20:13937962-13937984 CCTAGAGACACTTCCAAAGTAGG + Intronic
1170383971 20:15795800-15795822 CCAACGGATGTTCCCACAGTCGG - Intronic
1174181048 20:48674995-48675017 CCAGGGGTTGCTTCCACACTAGG - Intronic
1174207526 20:48851591-48851613 CCAAGGGATGGTCACAAAGGAGG - Intergenic
1174548734 20:51345689-51345711 CCCAGGGCTGGTACCAAAGTGGG - Intergenic
1174974264 20:55313726-55313748 GCAAGGGAAGCTTGCAAACTAGG - Intergenic
1178027856 21:28488690-28488712 CCAGAGGATTCTTCTAAAGTCGG + Intergenic
1180059481 21:45377202-45377224 CCAAGGGCTGCTCCCAGAGGGGG - Intergenic
1180342264 22:11628497-11628519 CCATGGGAAGCTTCCCAAGTGGG + Intergenic
1182034010 22:27183463-27183485 CCAAGGGATGCGTCCATATATGG + Intergenic
1183303762 22:37071082-37071104 CCAAGGAAACCTTCCAAAGTGGG + Intronic
950100956 3:10356585-10356607 CTAAGGGATGTTTCCAAGGCAGG + Intronic
950108796 3:10405414-10405436 CCAAGGGATGACTAGAAAGTGGG + Intronic
954973512 3:54671771-54671793 CCAAGTGCTGCTTGCAAATTGGG + Intronic
957837591 3:85617660-85617682 CCAAGGTATGATTACAGAGTTGG - Intronic
959443446 3:106407751-106407773 CAAATGGATGCTTACAAAGCAGG + Intergenic
959629896 3:108495984-108496006 CCAAAAGCTGCTTCCAAATTTGG + Intronic
960454074 3:117848815-117848837 CCAAGGCATGTTTTCAGAGTTGG - Intergenic
961330460 3:126135243-126135265 CCAAGGGATGCTTCCAAAGTGGG - Intronic
963165843 3:142202459-142202481 GAAAGGGATGATTGCAAAGTGGG + Intronic
963471424 3:145747089-145747111 TCATGGGCTGCTTCCAAACTAGG + Intergenic
965011514 3:163098627-163098649 TCAAGTGATCCTTCCAACGTAGG + Intergenic
966835494 3:184046410-184046432 CAAAAAGATGCTTCCAATGTAGG + Intergenic
967298088 3:187985255-187985277 TCAATGGATGCTTGCAAACTGGG - Intergenic
970321437 4:14879309-14879331 TCAAGGGATGCTTGAAGAGTGGG + Intergenic
972481936 4:39504982-39505004 CAAAGAGATGCTTCCAAAGCAGG - Intronic
976639495 4:87322964-87322986 ACAAGGCCTGCTTCCAAAGCTGG - Intergenic
983580980 4:169309808-169309830 CCAAGGGATACTTCCAAGGCTGG - Intergenic
995188912 5:109299694-109299716 CCACAGGGTGCTTCCACAGTCGG + Intergenic
998008949 5:138677812-138677834 CCAGAGGATGCTTCCAAGCTAGG - Intronic
999060651 5:148630932-148630954 CCATGGGATGCTGGAAAAGTAGG - Intronic
999185424 5:149703815-149703837 TCAAGGGAGGCTTCTAGAGTTGG - Intergenic
999297051 5:150466224-150466246 CCACGGGATGCTTCCAGGCTGGG - Intergenic
1000925294 5:167186568-167186590 CCAAGGGTTGTTTCCAAATTTGG - Intergenic
1007159508 6:39777589-39777611 CCAATGGATGCTCCAAAAATAGG + Intergenic
1010057947 6:71587181-71587203 CCAAGAAATGCTTCATAAGTTGG - Intergenic
1010933153 6:81827957-81827979 CCAAGGGATTCCTCCCAAGAAGG - Intergenic
1014904826 6:127013291-127013313 CAAAGAGATGCATCCACAGTAGG - Intergenic
1018746545 6:166766868-166766890 CCAAGGGAAGCTTCCAGAACAGG - Intronic
1018851834 6:167646055-167646077 TCAGGGGTTGATTCCAAAGTGGG + Intergenic
1020985565 7:15129724-15129746 CCACCAGATGCTTCCAAAGCAGG - Intergenic
1023367206 7:39475700-39475722 CCAGGGGCTGGTTCCAAAATGGG + Intronic
1023374578 7:39543244-39543266 CCAAGGGAAGCTAACAAACTTGG + Intergenic
1023431961 7:40102868-40102890 TCAAGCGATCCTCCCAAAGTGGG + Intergenic
1023929122 7:44694180-44694202 CCAAGGAATGCTTCCCAGGCAGG + Intronic
1024540867 7:50474095-50474117 TCAAAGGATGCTTTGAAAGTAGG + Intronic
1026237621 7:68541539-68541561 AAAAGGGATGCTTACACAGTTGG - Intergenic
1032149979 7:129420216-129420238 CCAAGGAATACTTCCAAAGATGG + Intronic
1032427591 7:131833955-131833977 CCAGAGGATCCTTCCACAGTCGG - Intergenic
1035265058 7:157685691-157685713 CCAAGGGAGGCCTCCAAAGCAGG - Intronic
1044525555 8:93247005-93247027 CCAACAGTTGCTTCCAAATTGGG + Intergenic
1049214486 8:141401552-141401574 CCCAGGGAGGCTACCAAAGGAGG - Intronic
1050851133 9:10287785-10287807 CTAAGGAATGCTTCTAAATTGGG - Intronic
1052220002 9:26008785-26008807 TCCAGAGATGTTTCCAAAGTAGG - Intergenic
1053068768 9:35088288-35088310 ACAAGGGAGGCTTCCACAGAAGG + Intergenic
1055271145 9:74560186-74560208 CCAAAGGATGCTTCTAGAGATGG - Intronic
1055618871 9:78102625-78102647 CCAAGGGATACTTCTGAAGATGG - Intergenic
1056667080 9:88589597-88589619 CCCAGGGATGGTGCCAAGGTTGG + Intergenic
1060886614 9:127158994-127159016 TCAAGGGCTGTTTCCAAAATAGG + Intronic
1187166396 X:16808067-16808089 CCAAGAGATGCCTTCAAAATGGG - Intronic
1190287138 X:48969189-48969211 CGCAGGGATGCTTGTAAAGTTGG + Exonic
1194865466 X:99060040-99060062 CCAAGGAAAGGTTACAAAGTTGG - Intergenic
1201187045 Y:11414822-11414844 GTAAGGGATGCTCCCAAAATTGG - Intergenic
1201921163 Y:19234459-19234481 CCAAGGGATCCTGGCAAAGGGGG - Intergenic