ID: 961332726

View in Genome Browser
Species Human (GRCh38)
Location 3:126152548-126152570
Sequence CAGAGTGAGGCGTGGCAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 167}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961332726_961332740 23 Left 961332726 3:126152548-126152570 CCATACTGCCACGCCTCACTCTG 0: 1
1: 0
2: 1
3: 11
4: 167
Right 961332740 3:126152594-126152616 CTGGGGGTACCACGCCCATGGGG 0: 1
1: 0
2: 0
3: 7
4: 79
961332726_961332737 7 Left 961332726 3:126152548-126152570 CCATACTGCCACGCCTCACTCTG 0: 1
1: 0
2: 1
3: 11
4: 167
Right 961332737 3:126152578-126152600 GGACACAGCAACACGGCTGGGGG 0: 1
1: 0
2: 1
3: 12
4: 190
961332726_961332738 21 Left 961332726 3:126152548-126152570 CCATACTGCCACGCCTCACTCTG 0: 1
1: 0
2: 1
3: 11
4: 167
Right 961332738 3:126152592-126152614 GGCTGGGGGTACCACGCCCATGG 0: 1
1: 0
2: 0
3: 10
4: 151
961332726_961332739 22 Left 961332726 3:126152548-126152570 CCATACTGCCACGCCTCACTCTG 0: 1
1: 0
2: 1
3: 11
4: 167
Right 961332739 3:126152593-126152615 GCTGGGGGTACCACGCCCATGGG 0: 1
1: 0
2: 2
3: 2
4: 48
961332726_961332736 6 Left 961332726 3:126152548-126152570 CCATACTGCCACGCCTCACTCTG 0: 1
1: 0
2: 1
3: 11
4: 167
Right 961332736 3:126152577-126152599 CGGACACAGCAACACGGCTGGGG 0: 1
1: 0
2: 1
3: 5
4: 96
961332726_961332735 5 Left 961332726 3:126152548-126152570 CCATACTGCCACGCCTCACTCTG 0: 1
1: 0
2: 1
3: 11
4: 167
Right 961332735 3:126152576-126152598 CCGGACACAGCAACACGGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 53
961332726_961332732 0 Left 961332726 3:126152548-126152570 CCATACTGCCACGCCTCACTCTG 0: 1
1: 0
2: 1
3: 11
4: 167
Right 961332732 3:126152571-126152593 GTAGGCCGGACACAGCAACACGG 0: 1
1: 0
2: 0
3: 9
4: 111
961332726_961332733 4 Left 961332726 3:126152548-126152570 CCATACTGCCACGCCTCACTCTG 0: 1
1: 0
2: 1
3: 11
4: 167
Right 961332733 3:126152575-126152597 GCCGGACACAGCAACACGGCTGG 0: 1
1: 0
2: 0
3: 5
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961332726 Original CRISPR CAGAGTGAGGCGTGGCAGTA TGG (reversed) Intronic
900140046 1:1136044-1136066 CAGAATGAGGCGTGTCGGGATGG - Intergenic
900515093 1:3077996-3078018 CTGAGTGTGGGGAGGCAGTAGGG - Intronic
901511799 1:9721352-9721374 CAGAGGGAGGCCAGGCAGGAGGG - Intronic
902185852 1:14724837-14724859 CAGAGTGAGGAAGGGCAGAAGGG - Intronic
906686724 1:47767757-47767779 CAGTGGGAAGCGTGGCAGGAAGG - Intronic
906781631 1:48577792-48577814 GAGAGTGAGGGGTGAGAGTAAGG + Intronic
909223283 1:72988659-72988681 AAGAGTTAAGCGTGGCAGTTTGG + Intergenic
914781733 1:150791812-150791834 CGGAGTGTAGCGTGGAAGTAGGG - Intergenic
918125894 1:181583322-181583344 CAGAATGAGGAGTGGTAGAAAGG - Intronic
924715179 1:246566503-246566525 CAGAGGGAGGCGGGGCGGAAAGG + Exonic
1063108634 10:3015823-3015845 CATAATTACGCGTGGCAGTAAGG + Intergenic
1063363570 10:5476188-5476210 AAGAGTTAAGAGTGGCAGTATGG - Intergenic
1064420369 10:15185488-15185510 CCCTGTGAGGCCTGGCAGTAAGG + Intergenic
1067479031 10:46583686-46583708 CAGAGTCAGGCGTGGGGGTAGGG - Intronic
1067615707 10:47758115-47758137 CAGAGTCAGGCGTGGGGGTAGGG + Intergenic
1070788285 10:79174966-79174988 CAGAGAGAGGCCTGGGAGGAAGG - Intronic
1077121325 11:910310-910332 CAGAGGGAGCAGAGGCAGTAGGG - Intronic
1081322401 11:41707106-41707128 CAGAGAAAGGTGTGGCAGAATGG + Intergenic
1083598849 11:63933725-63933747 AAGAGTGGGGCATGGCAGAAGGG + Intergenic
1083681341 11:64353232-64353254 CAGTGTGAGGTGTGGCTGGAGGG + Exonic
1084355924 11:68638563-68638585 CAGAGTTAAGAGTGGCAGTTTGG - Intergenic
1084665994 11:70576664-70576686 CAGAGTTAGGCCTGGGAGTGTGG - Intronic
1087150571 11:94855858-94855880 CAGGCTGAGGAGTGCCAGTAGGG + Intronic
1088359459 11:108975673-108975695 TAGAGTGAGGCCTGGCACGATGG - Intergenic
1089248982 11:117144214-117144236 CACGCTGAGGCGTGGCAGGATGG + Intergenic
1090944684 11:131419529-131419551 CAGAATGAGGGGAGGCAGTGAGG + Intronic
1092040246 12:5378000-5378022 CAGAGTGAGGCCTGGAACTCAGG - Intergenic
1092285365 12:7125598-7125620 AAGAGTGAGGGATGGCAGTGGGG + Intronic
1095256051 12:40037604-40037626 CAGAGTGAGACCTGGCACTCAGG + Intronic
1095936192 12:47684323-47684345 CAGTGTGCGGGGTAGCAGTAGGG - Intronic
1098153957 12:67577776-67577798 CAGAGTGAGAGGTGGTAGGAGGG + Intergenic
1098595797 12:72272443-72272465 CAGAGTGAGGCGGGGCTGATGGG + Intronic
1100302136 12:93317419-93317441 CATAGAGAGGCCTGGCAGCAAGG + Intergenic
1101835475 12:108292086-108292108 CAGAGCCAGGCATGGCAGTGTGG + Exonic
1103323088 12:120102866-120102888 CAGAGTGAGGGGCGGCTGTCTGG - Intronic
1110616440 13:77547254-77547276 AAGAGAGAGGCGTGGCATTCCGG + Intronic
1112130467 13:96517743-96517765 GAGAGTGGGGGGTGGCAGGAGGG - Intronic
1112406569 13:99125766-99125788 CAGACTGAGGCCTGGCAGCAGGG + Intergenic
1113710945 13:112464990-112465012 CAGAGTGAGGTCTGGCTGTCAGG + Intergenic
1115984061 14:39085249-39085271 TAGAGTGAGGTGTGGGAGAAGGG - Intronic
1120003249 14:79327541-79327563 CAAACAGAGGCCTGGCAGTATGG - Intronic
1122337635 14:101004428-101004450 TAGTGGGAGGCGTGGCAGGAGGG - Intergenic
1122412598 14:101533600-101533622 CAGGGTGAGGCTGGGCAGGAGGG + Intergenic
1122553183 14:102561090-102561112 CTGAGTGAGGTGAGGCAGGATGG + Intergenic
1122764324 14:104055018-104055040 CAGAGGCAGGCGTGGCACCACGG + Intergenic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1127829475 15:62737723-62737745 CAGAGTGAGGTTTGGGAGGATGG + Intronic
1129927935 15:79382765-79382787 CAGGATGAGGAGTGGCAGGAAGG - Intronic
1130551302 15:84891418-84891440 CAGAGGGAGTCTTGGCAGGAAGG + Intronic
1132160544 15:99537525-99537547 CAGAGTCAGGAATGGGAGTATGG + Intergenic
1133056907 16:3149905-3149927 GAGAGCGAGGCGTGGCAGCGTGG + Exonic
1134341809 16:13353419-13353441 AAGAGTTAAGCGTGGCAGTTTGG + Intergenic
1135635147 16:24069368-24069390 CAGAGTGAGACGTTGAAGTTTGG + Intronic
1136369518 16:29827345-29827367 CAGAATGAGGCAAGGCAGTGAGG + Intronic
1139652501 16:68369499-68369521 GGGAGTGAGGGGTGGGAGTAAGG + Intronic
1141365129 16:83435504-83435526 CAGAGTGAAGAGAGGCAGCAGGG - Intronic
1142518125 17:446597-446619 CAGGGCGAGGGGTGGCAGTCTGG - Intergenic
1143322163 17:6075406-6075428 GAGACTGAGGGGTGGCAGCAGGG - Intronic
1143329481 17:6122612-6122634 CAATGTCAGGCGTGGCAGTGGGG + Exonic
1143382144 17:6503234-6503256 CAGAGTGAGGGGTGGGAGGCTGG - Intronic
1144759067 17:17697076-17697098 AAGAGACAGGCCTGGCAGTAGGG - Intronic
1145078416 17:19874425-19874447 CTGAGTGAGGCGTGACATTTTGG - Intergenic
1149509970 17:57232297-57232319 CAGGGTGAGGAGAGGCAGGATGG + Intergenic
1151655655 17:75494823-75494845 CAGAGTTAGTGGTGGCAGAAGGG - Intronic
1152278063 17:79369537-79369559 CAGAGTTTGGGGTGGCAGGAAGG - Intronic
1153821423 18:8835301-8835323 TTGAGTTAGGCTTGGCAGTACGG + Intergenic
1154461078 18:14587247-14587269 CAGAGAGAAGGGTGGCAGAAGGG + Intergenic
1155544873 18:26904525-26904547 TAGAGTGAGGTGTTGCTGTAAGG - Intergenic
1156505937 18:37592853-37592875 CAGGGTGAGGTATGGCAGTGAGG - Intergenic
1156523740 18:37746635-37746657 CAGAGTGAGGCAGGGCAGGGAGG + Intergenic
1157159472 18:45300147-45300169 CAGAGTGAGGCCAGACAGGATGG - Intronic
1157485504 18:48084226-48084248 CAGAGGAAGGCGGGGCAGTGGGG + Intronic
1157698158 18:49741210-49741232 GAGGGTGAAGCGTGGCAGGAGGG - Intergenic
1158011454 18:52733195-52733217 CAGAATGAGGCATGGGAGTTAGG - Intronic
1160357753 18:78242962-78242984 CAGAGGGAGGCGTGGGCGTCCGG - Intergenic
1161257301 19:3316494-3316516 CAGAGTGAGGAGGGGGAGAAAGG + Intergenic
1161289402 19:3485007-3485029 CAGAGTGAGCCGGGGGAGTGGGG + Intergenic
1161345954 19:3768814-3768836 CAGAGTGAGGAGGGGGAGGAGGG - Intergenic
1161496733 19:4590697-4590719 CAGAGTGAGGAATGGGAGGAAGG + Intergenic
1161623200 19:5310055-5310077 CAGAGTGAGGAGGGGGAGGAGGG - Intronic
1162721409 19:12665020-12665042 CAGAGCCAGGAGTGGGAGTAGGG + Intronic
1166700956 19:44881335-44881357 CAGAATGAGGCGGGGCAGAGTGG - Intronic
1167338455 19:48900787-48900809 CAGAGGGAGGCATGGCAGTGTGG - Exonic
1167621337 19:50562688-50562710 GAGAGTGAGGCAGGGCAGGAGGG - Intronic
1168727122 19:58591322-58591344 CAGAGTCAGGGCTGGAAGTATGG + Intergenic
926104558 2:10142159-10142181 CAGAGTGAGGGGTGGGAGATGGG + Intronic
926458099 2:13093826-13093848 CAGAGTGATGTGTGGCACTGGGG + Intergenic
926792166 2:16584921-16584943 CACAGTGTGGCATGACAGTAAGG - Intronic
931459592 2:62439125-62439147 AAGTGTGAGACATGGCAGTATGG + Intergenic
932030501 2:68178671-68178693 TAGAGAGAGGGGTAGCAGTAAGG + Intronic
933091141 2:78119019-78119041 GAGAGTGAAGGGTGGCAGGAGGG - Intergenic
933273205 2:80255903-80255925 CAGAGGGAAGGGTGGCAGGAAGG - Intronic
933727715 2:85436004-85436026 CAGACTGAGCCATGGCAGGAGGG - Intronic
933753759 2:85620878-85620900 CAAAGTGAGTACTGGCAGTAAGG - Intronic
938145723 2:128833514-128833536 CAGAGGAAGGCGTGGGAGGAGGG + Intergenic
941885505 2:170523449-170523471 CAGAGGGTGGGGTGGGAGTAGGG + Intronic
943304532 2:186243390-186243412 GAGAGGTAGGAGTGGCAGTAAGG + Intergenic
945102782 2:206277182-206277204 CTGAGTGTGGCGTGGCAGTGTGG - Intronic
947116218 2:226773973-226773995 GACAGTGAGGCATGGCAGAATGG + Intronic
947767931 2:232649312-232649334 TAGAGTGAGGCGTGACTGTGTGG - Intronic
948356751 2:237384412-237384434 CAGAGAGAGGCGTGGGAGGAGGG - Intronic
1175050505 20:56151350-56151372 CAGAGCAAGGCTTGGCAGGAAGG - Intergenic
1175124405 20:56740685-56740707 CAGAGAGGGGCGAGGCAGGATGG + Intergenic
1175323423 20:58105891-58105913 CAAAGTGAGGTGAGGCAGAAGGG - Intergenic
1176304578 21:5116517-5116539 CTGAGTGAGGAATGGCAGTGAGG - Exonic
1176813425 21:13570595-13570617 CAGAGAGAAGGGTGGCAGAAGGG - Intergenic
1179852476 21:44145513-44145535 CTGAGTGAGGAATGGCAGTGAGG + Exonic
1181046545 22:20217311-20217333 CACAGTGGGGCGGGGCAGGAAGG + Intergenic
1181164140 22:20974412-20974434 CAGAGTGAGGGGTTGCGGTAGGG + Intronic
1182780145 22:32861030-32861052 CAGAGTGGGGGTTGGCAGGATGG + Exonic
1183347671 22:37316999-37317021 CAGAGTGAGGAGTGGCAGAATGG - Intergenic
1183466164 22:37981422-37981444 CAGCCTGAGGTGTGGCAGTCAGG - Intronic
1183739345 22:39661466-39661488 CAGAGTGGGACCTGGCAATAAGG + Intronic
1184605777 22:45574071-45574093 CACAGTGAGGCTGGGCAGCAGGG - Intronic
1185310748 22:50152926-50152948 CAGAGTCAGGCTTGGAAGTCAGG + Intronic
950106517 3:10392335-10392357 CCCAGTGAGGTGTGGCAGGAGGG - Intronic
950492480 3:13314445-13314467 GAGAGTGAGGCTGGGCAGGATGG + Intergenic
952815307 3:37442335-37442357 GAGAGGGAGGCGGGGCAGGAAGG + Intergenic
953759999 3:45679013-45679035 CAGTGTGGGGCGTGGCAGGGGGG + Exonic
953880335 3:46688034-46688056 CAGAGTGACACCTGGCATTAAGG - Intronic
955195320 3:56800740-56800762 CAGAGTGAGGTGTGGGAGAGTGG + Intronic
956501265 3:69888112-69888134 CAGAGTTATGCATGGTAGTAAGG - Intronic
961332726 3:126152548-126152570 CAGAGTGAGGCGTGGCAGTATGG - Intronic
962933184 3:140056342-140056364 CAGAGTGGGGGTTGGCAGGAGGG - Intronic
967145730 3:186604365-186604387 GAGACTGAGGCGTGGGAGGATGG - Intergenic
967600083 3:191376180-191376202 TGGAGTGAGGCCTGGCAGTTTGG + Intronic
969990232 4:11254526-11254548 CAGAGTGCGGGCTGGCAGTTTGG + Intergenic
970518327 4:16857573-16857595 CAGAGTGAGCCAGGGCAGTCCGG - Intronic
971368939 4:26000099-26000121 CAGAGAGAAGCTTGGCAGCATGG - Intergenic
971938887 4:33189036-33189058 CAGAGGGAGGTGAGGCAGCAAGG + Intergenic
975582778 4:75921744-75921766 CAGGGTGAGGAGTGGCAGTGGGG + Intronic
977816301 4:101417083-101417105 CAGAGGGAGGTGAGGCAGCAGGG + Intronic
982066282 4:151657471-151657493 CAGAGTGAGGAGTGGGGGTGGGG + Intronic
984437746 4:179726063-179726085 CAGAGTTAAGAGTGGCAGTTTGG - Intergenic
994760390 5:103844498-103844520 CAGTGTGAGGGGTGGCTATAAGG + Intergenic
995842800 5:116459754-116459776 CAGAGTGAAGTCTGACAGTAAGG - Intronic
999420750 5:151440407-151440429 CAGAGAGAGGCTTGACAGTAGGG + Intronic
1000164694 5:158636828-158636850 CAGAGTGAGACTTGAAAGTAAGG - Intergenic
1001650299 5:173311176-173311198 CAGAGGGAGCCCTGGCAGGAAGG + Intergenic
1002017419 5:176336025-176336047 CAGAGTGAGACCTGTCAGAAAGG + Intronic
1002510931 5:179716868-179716890 CAGATTGAGACTTGGCAGTGAGG + Intronic
1003443338 6:6163475-6163497 CAGGGTGCGGCGTGGGAGGAGGG - Intronic
1005222216 6:23599475-23599497 CAGAGGGAGGAGTGGCACTCAGG + Intergenic
1009778214 6:68233743-68233765 CTGAGTGCGGAGAGGCAGTAGGG - Intergenic
1011100393 6:83713967-83713989 CAGACTGATGCTTGGCAGTTAGG + Intergenic
1013591639 6:111623732-111623754 CAGAGTGTGCCGTGGCTGTGAGG - Intergenic
1014556221 6:122844687-122844709 AAGAGTTAGGAGTGGCAGTTTGG - Intergenic
1014793614 6:125702708-125702730 AAGAGTTAGGAGTGGCAGTTTGG + Intergenic
1014891908 6:126853594-126853616 AAGAGTTAGGAGTGGCAGTTTGG - Intergenic
1016845431 6:148564143-148564165 CAGAGTGGGGAATGGCAGGAGGG + Intergenic
1018084127 6:160287420-160287442 AAGAGTTAAGAGTGGCAGTATGG + Intergenic
1022602258 7:31772443-31772465 CTGAGTAAGGAGTGGCAGGAAGG - Intronic
1030528108 7:110677854-110677876 CAGAGTCAGGGGTGGCACAATGG + Intronic
1033478586 7:141715719-141715741 GAGAGTGTGGTGTGGCAGTGAGG + Intronic
1034545328 7:151785376-151785398 CAGAGAGTGGAGTGGCAGGAAGG - Intronic
1034945211 7:155257725-155257747 CAGAGGGAGGAGCGGCAGTGCGG + Intergenic
1034969071 7:155408238-155408260 GAGAGTGGGGCGTGGGAGTGTGG + Intergenic
1034969113 7:155408401-155408423 GAGAGTGGGGCGTGGGAGTGTGG + Intergenic
1040576263 8:48654109-48654131 CAGAGTGAGGGGCAGCAGGATGG + Intergenic
1041782521 8:61593086-61593108 CAGTGTGAGGCATCACAGTAGGG - Intronic
1041860510 8:62507828-62507850 CAGAGTAAGGGATGGCAGAAAGG + Intronic
1044294697 8:90513875-90513897 CAGAGTGTGGGGTGGGAGGAGGG + Intergenic
1047233681 8:123019689-123019711 AAGAGAGAAGCGTGGGAGTAAGG + Intronic
1047609691 8:126508969-126508991 CAGTGTGAAGAGTGGAAGTATGG - Intergenic
1051898088 9:22009276-22009298 CAGAGCGAGGCGGGGCAGTGAGG - Exonic
1055393172 9:75845395-75845417 CAGCGTGAGGCTTTGCAGTGGGG - Intergenic
1059741221 9:117151890-117151912 GAGAGTGGGGCCAGGCAGTAGGG - Intronic
1061039737 9:128133073-128133095 GAGAGTGTGACATGGCAGTAGGG - Intergenic
1061373184 9:130209374-130209396 GAGACTGAGGCCTGGCAGTGCGG + Intronic
1061823527 9:133242055-133242077 GAGAGTGAAGCGTGGGAGTAGGG + Intergenic
1062448748 9:136606770-136606792 CAGAGGGAGGCCAGGCAGAAGGG - Intergenic
1062717216 9:138017259-138017281 CAGAGTTAGGAGTGGAAGGAAGG - Intronic
1187696983 X:21932800-21932822 CAGAGTGAGGCTTGGCTTCAGGG - Intergenic
1188615303 X:32150897-32150919 AAGAGTGAGGAGTAGCAGCACGG - Intronic
1193625500 X:83815435-83815457 GAGAGTGAGGGGTGGGAGAAGGG - Intergenic
1195400389 X:104455039-104455061 CAGCGTGAGGCATGGCAGATAGG + Intergenic
1196243480 X:113370446-113370468 CAGAGAGCGGCGGGGCAGCATGG - Intergenic
1199698093 X:150357983-150358005 CTGAGTGAGGCATGGGTGTAGGG + Intergenic
1200980781 Y:9261552-9261574 CAGAATGAAGGGTGGCAGTGAGG + Intergenic
1201672862 Y:16543828-16543850 CAGAGTGAGGGGTAGGAGGAAGG - Intergenic