ID: 961334127

View in Genome Browser
Species Human (GRCh38)
Location 3:126160017-126160039
Sequence GACCCTCTAGGAACACTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 91}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961334127_961334132 18 Left 961334127 3:126160017-126160039 CCAGTCAGTGTTCCTAGAGGGTC 0: 1
1: 0
2: 0
3: 4
4: 91
Right 961334132 3:126160058-126160080 CCCCTGCATCCTGTCTGCTGAGG 0: 1
1: 0
2: 4
3: 40
4: 301
961334127_961334129 -5 Left 961334127 3:126160017-126160039 CCAGTCAGTGTTCCTAGAGGGTC 0: 1
1: 0
2: 0
3: 4
4: 91
Right 961334129 3:126160035-126160057 GGGTCTGTTCATCCAAGCTGAGG 0: 1
1: 0
2: 0
3: 9
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961334127 Original CRISPR GACCCTCTAGGAACACTGAC TGG (reversed) Intronic
901133839 1:6980117-6980139 GCCCCTCCAGGAGCACTTACTGG + Intronic
901494848 1:9615029-9615051 GCCCCTCCAGGGACACTGTCTGG - Intergenic
902929576 1:19721442-19721464 GTCCCACTAGGAAAACTCACAGG - Intronic
903313387 1:22478961-22478983 GCACCTCTAGGACCACTGTCTGG + Intronic
906518547 1:46453723-46453745 GACCCTGTGGGGACACTGTCAGG + Intergenic
908124025 1:61012856-61012878 GACCCTCTGAGAAAAGTGACAGG + Intronic
910549313 1:88457845-88457867 TTCCCTCTAGGCACACTGAAGGG + Intergenic
915732225 1:158061824-158061846 GCCCCTCTGGGAAGACTGCCTGG + Intronic
915903114 1:159860524-159860546 TCCCCCCTAGGAACACTGGCTGG + Intronic
923558954 1:235023793-235023815 AACCCTCTAGGATTTCTGACTGG - Intergenic
1064312268 10:14221873-14221895 GACCCTCCAATAACACAGACAGG - Intronic
1067766343 10:49090469-49090491 GACCCTATAGGACCATTGTCTGG - Intronic
1069935522 10:71913095-71913117 CTTCCTCTAGGAACACTCACTGG - Intergenic
1070471638 10:76786218-76786240 GAAGCTCTAGGAAAGCTGACAGG + Intergenic
1070730297 10:78822981-78823003 GACCCTCTAGGAATAAGGTCTGG - Intergenic
1073831075 10:107384336-107384358 GTCCCCCTGGGAACACTGAAGGG + Intergenic
1076008127 10:126964440-126964462 AACCCTGTAGGAGCACAGACAGG + Intronic
1078543472 11:12229499-12229521 GAGCTTCCAGAAACACTGACTGG - Intronic
1083204418 11:61139557-61139579 GGCCCTCTAGGCAGAGTGACAGG - Intronic
1089087270 11:115831749-115831771 GACCCTCTCTGTACACTCACTGG + Intergenic
1089377258 11:118003228-118003250 GACCACCTGGGACCACTGACAGG + Intergenic
1091448624 12:559207-559229 GAGCCTCTAGGCACACAGCCTGG + Intronic
1122574063 14:102730693-102730715 GACCCTGTGGAAACACTGCCAGG + Intergenic
1125910341 15:43432365-43432387 GACCCTCAAGGAACACTCCATGG + Exonic
1129592944 15:76933207-76933229 GACCCACTTGGAACGCTGACAGG - Intronic
1130412342 15:83657381-83657403 GACCTTCTATGCACACTGCCTGG - Intronic
1133739136 16:8638621-8638643 GACACCCTAGGAAAACTGACTGG - Intronic
1138744613 16:59348689-59348711 TACCTTCTAGGAAGACTGCCTGG - Intergenic
1140550306 16:75857902-75857924 TACTCTCTAGGAAAACTGAGAGG + Intergenic
1141265540 16:82493776-82493798 GACCCTGGAGGAACACTGGTTGG - Intergenic
1142878083 17:2864435-2864457 GAAGCTCTGGGAACACTGGCTGG + Intronic
1144714029 17:17421912-17421934 GACCATGTAGGAAAACTGTCTGG - Intergenic
1152826036 17:82465457-82465479 GGGCCTCAAGAAACACTGACTGG + Intronic
1152921261 17:83067651-83067673 GCCCCTGTGGCAACACTGACCGG + Intergenic
1155061623 18:22233669-22233691 GACCCTCCAGGAACACACAAAGG - Intergenic
1155366830 18:25057217-25057239 GACCCTCTAGGGACCCCCACAGG - Intergenic
1157148212 18:45188001-45188023 CACCCTCTATTAGCACTGACAGG - Intergenic
1163818195 19:19480742-19480764 GACCCACGAGGACCACTGAGGGG - Intronic
935981186 2:108629462-108629484 GAAGCTCTAAAAACACTGACTGG - Intronic
936151044 2:110022657-110022679 GACCCTGGAGGAACACAGAGGGG + Intergenic
936193633 2:110348712-110348734 GACCCTGGAGGAACACAGAGGGG - Intergenic
936490715 2:112969808-112969830 GACCCCCATGGAGCACTGACAGG + Intergenic
945742317 2:213678706-213678728 GCTGCTCTAGGAACAGTGACTGG - Intronic
947431463 2:230032027-230032049 GACCCTTCAGGAACACAGAAAGG - Intergenic
1170239930 20:14153402-14153424 GTCCATCTGGGAACACTGAGAGG + Intronic
1174806503 20:53608395-53608417 GATGCTCCAGGAACACTGAAGGG - Intronic
1178360877 21:31947739-31947761 GACCCTGTACCATCACTGACAGG - Intronic
1182495479 22:30704144-30704166 GACCCACTAGGAGGACTCACAGG + Intronic
1183031536 22:35110125-35110147 AACCCTCTAGGACCATTGAGAGG - Intergenic
949371463 3:3339043-3339065 TACACTCTGGGAACACTGTCTGG - Intergenic
951956983 3:28268196-28268218 GATTCACTAGGAAGACTGACAGG + Intronic
954643164 3:52114434-52114456 GACCCTGAAGCAGCACTGACAGG + Intronic
961334127 3:126160017-126160039 GACCCTCTAGGAACACTGACTGG - Intronic
963036242 3:141031628-141031650 GGGCCTCTTGGAACACTGTCTGG - Intergenic
963380568 3:144524689-144524711 GAGCCTATAGCAACACTGACAGG - Intergenic
968567824 4:1323775-1323797 CACCCTCCAGCAACACTGTCCGG - Intronic
968766268 4:2471460-2471482 GACACTGTAGGGTCACTGACTGG - Intronic
968897984 4:3415970-3415992 GGCCCTGTAGGAAAGCTGACAGG - Exonic
973636684 4:52867765-52867787 TACCCTGTGGGAACACTGATTGG - Intergenic
978616580 4:110602966-110602988 GGCCCTCTACAAACACTGCCTGG - Intergenic
983911947 4:173249841-173249863 GACCCTTTAGGACCCCTAACAGG + Intronic
985718806 5:1477968-1477990 GAGCTCCTAGGAGCACTGACGGG - Intronic
996416725 5:123218604-123218626 CACCCTCTATGAACACTATCTGG - Intergenic
999176967 5:149638669-149638691 GACCCTAGAGGACCAATGACAGG - Intergenic
1006284931 6:33085453-33085475 GAGAATCTAGGGACACTGACTGG + Intronic
1008515613 6:52316229-52316251 GAGCTTCTAGGAAGAATGACAGG - Intergenic
1014703089 6:124713877-124713899 GACCCTATAGCATCTCTGACAGG - Intronic
1015033102 6:128619865-128619887 CACCCTCTAGTAGCACTGAAAGG + Intergenic
1016712931 6:147194117-147194139 GTTCCTTTAGGAACACTGAATGG + Intergenic
1023332691 7:39135616-39135638 AAACCTCTTGGAACACTAACAGG + Intronic
1023588039 7:41751307-41751329 GAAATTCTAGGAACAATGACTGG + Intergenic
1035113412 7:156504020-156504042 GACCCTCTAAGTACAGTCACAGG + Intergenic
1035270395 7:157716281-157716303 GACTCTGCAGGAACACTGCCTGG + Intronic
1035270399 7:157716311-157716333 GACTCTGCAGGAACACTGCCTGG + Intronic
1035270403 7:157716341-157716363 GACTCTGCAGGAACACTGCCTGG + Intronic
1035270406 7:157716371-157716393 GACTCTGCAGGAACACTGCCTGG + Intronic
1035270410 7:157716401-157716423 GACTCTGCAGGAACACTGCCTGG + Intronic
1035270414 7:157716431-157716453 GACTCTGCAGGAACACTGCCTGG + Intronic
1035270418 7:157716461-157716483 GACTCTGCAGGAACACTGCCTGG + Intronic
1035270426 7:157716521-157716543 GACTCTGCAGGAACACTGCCTGG + Intronic
1035270430 7:157716551-157716573 GACTCTGCAGGAACACTGCCTGG + Intronic
1035270438 7:157716611-157716633 GACTCTGCAGGAACACTGCCTGG + Intronic
1035270465 7:157716791-157716813 GACTCTGCAGGAACACTGCCTGG + Intronic
1035270509 7:157717061-157717083 GACTCTGCAGGAACACTGCCTGG + Intronic
1038917777 8:32045062-32045084 GAACCTCTTGCAAGACTGACAGG + Intronic
1040708588 8:50160433-50160455 GACCCTTTAAGAAAACTGAGAGG - Intronic
1044072288 8:87777773-87777795 GATCCACTAGGAACACGGAGAGG + Intergenic
1044596286 8:93961881-93961903 GAACCTCTAGGAAAGCAGACAGG + Intergenic
1048133062 8:131718741-131718763 GTGCATCTAGGAACACTGGCAGG - Intergenic
1058409243 9:104712698-104712720 GACTCTCTAGGAGCCCTGAAAGG - Intergenic
1061376051 9:130225528-130225550 GACCCTGTAGTCACACTGACTGG + Intronic
1061378484 9:130240279-130240301 GTCCCTCTAGGAGGACTCACTGG - Intergenic
1062635536 9:137488669-137488691 CTGCCTCTAGGGACACTGACTGG + Intronic
1186282719 X:8010744-8010766 GAACCTCTAGCAACACTCTCAGG - Intergenic
1196995007 X:121373269-121373291 GACCCTCTAGCCAAGCTGACTGG - Intergenic
1201623959 Y:15992895-15992917 CACTCTCTAGGAACACTTGCTGG - Intergenic