ID: 961335140

View in Genome Browser
Species Human (GRCh38)
Location 3:126171482-126171504
Sequence AGGAGCCTTCTGGCCAAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 2, 2: 6, 3: 38, 4: 171}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961335140_961335144 15 Left 961335140 3:126171482-126171504 CCTAACTTGGCCAGAAGGCTCCT 0: 1
1: 2
2: 6
3: 38
4: 171
Right 961335144 3:126171520-126171542 TCTAAAATAAATGTCTTAACTGG 0: 1
1: 0
2: 1
3: 44
4: 429

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961335140 Original CRISPR AGGAGCCTTCTGGCCAAGTT AGG (reversed) Intronic
901411441 1:9087115-9087137 AAGTGGCTTCTGGCCGAGTTAGG - Intronic
902233024 1:15040335-15040357 AGGAGTCTGCTGGAGAAGTTGGG - Intronic
902807898 1:18872294-18872316 AGGGGCCTACTGGCCCAGGTGGG + Exonic
903301964 1:22385605-22385627 AGGAGCCTTATGAGGAAGTTGGG - Intergenic
904061403 1:27713813-27713835 AGGCGCCTTCTGGCCGAGTTAGG - Intergenic
904459180 1:30665347-30665369 AGGAGCCATCTGGCCCTGTCTGG + Intergenic
905421946 1:37853100-37853122 TGGAGACTTCTTGCCTAGTTAGG - Intronic
906617847 1:47246962-47246984 AGGAGACTTTTGGCGAAGTGGGG + Intergenic
908889159 1:68823590-68823612 TCAAGCCTTATGGCCAAGTTAGG - Intergenic
915079760 1:153344170-153344192 GAGAGGCTTTTGGCCAAGTTAGG - Intronic
915796392 1:158738712-158738734 AAGGGGCTTCTGGCCAATTTCGG - Intergenic
916570265 1:166019451-166019473 CTCAGCCTTCTGGCCAAGATAGG + Intergenic
917273342 1:173303082-173303104 AGGTGCCTTCTGACCAAGTTAGG + Intergenic
918658057 1:187053788-187053810 GAGGGGCTTCTGGCCAAGTTAGG + Intergenic
919020636 1:192100946-192100968 CAGAGGCTTCTGGCCGAGTTAGG + Intergenic
919575907 1:199309328-199309350 AGGAGCTTACTGGCGAGGTTAGG - Intergenic
920725612 1:208432144-208432166 AAGATCCTTCTGGACAAATTGGG - Intergenic
921045334 1:211472866-211472888 AGTAGCCATGTGACCAAGTTTGG - Intergenic
922381705 1:225036071-225036093 AGGAGCCTTCTGTCTGAGTTAGG + Intronic
922725063 1:227918828-227918850 AGGTGGCTTCTGGCCAGGTGTGG - Exonic
924363048 1:243261092-243261114 ATGAGGCTTATGGCCAAATTGGG + Intronic
1067896998 10:50193310-50193332 AGGAGAATTCAGGCCAAGTCTGG + Intronic
1067951976 10:50748728-50748750 AGGAGAATTCAGGCCAAGTCTGG - Intronic
1068633436 10:59322062-59322084 AGCAGGCGTCTGGCCAGGTTTGG - Intronic
1069559949 10:69422360-69422382 AGGAGGCTCCTGGACAAGCTGGG + Intergenic
1071304951 10:84291401-84291423 TGGAGCCTTTTGCCCAACTTAGG - Intergenic
1071997264 10:91161468-91161490 AAGAGCCTTCCGGCCCTGTTAGG - Intergenic
1075800156 10:125148709-125148731 TGGAGCCATGTGGCCAATTTAGG + Intronic
1077694948 11:4385489-4385511 AGGTGCCTCCATGCCAAGTTGGG - Exonic
1078530082 11:12130447-12130469 ATGATCCTTCTAGCCAAGGTGGG + Intronic
1081860386 11:46330179-46330201 AGGAGCCATTTGGCCAAACTGGG + Intergenic
1082746897 11:56973232-56973254 AGGAGCCTTTTGGCAGAGTCTGG - Intergenic
1083693786 11:64428993-64429015 TGGGGACTTCTGGCCATGTTTGG + Intergenic
1084351009 11:68599384-68599406 TGCTGCCTGCTGGCCAAGTTTGG - Intronic
1086509006 11:87535794-87535816 ATGTGCCTTCTGGCCATGCTGGG + Intergenic
1087580149 11:100040761-100040783 AGGACCCTCCTAGCCAAGTGCGG + Intronic
1088545394 11:110953705-110953727 AGGAGGCTACTGGCCAAGTGAGG - Intergenic
1089069309 11:115687145-115687167 AAGAGCCTGCTGCCCACGTTGGG + Intergenic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1093982875 12:25494044-25494066 AGGAGCCTCCTGGATAGGTTGGG - Intronic
1094091699 12:26657112-26657134 AGAAGCCTTGGGGCCAAGTTGGG - Intronic
1097018197 12:56002087-56002109 AGGAGCTTTCTGGGCAAGTGAGG - Exonic
1097106439 12:56629080-56629102 TGAAGCCTTCTGGGCAAGCTTGG - Intronic
1101901473 12:108794131-108794153 ACCAGCCTCTTGGCCAAGTTTGG - Intronic
1102987367 12:117289486-117289508 GAGGGGCTTCTGGCCAAGTTAGG + Intronic
1106808585 13:33336461-33336483 AGCTGCCTGCTGGCCATGTTCGG + Intronic
1114884611 14:26832940-26832962 AGAAGCCTTCTGGCTGAGTCTGG + Intergenic
1121715369 14:96070144-96070166 AGGAGCCTTGTGGACAAATGAGG + Intronic
1122434877 14:101688737-101688759 GAGGGCCTTCTGGCCGAGTTAGG - Intergenic
1202898505 14_GL000194v1_random:23148-23170 AGGGGCCTTCTGCCTACGTTGGG + Intergenic
1124512438 15:30338765-30338787 AGGAGCCTGGTGGCCAGGTAAGG + Intergenic
1124730476 15:32191986-32192008 AGGAGCCTGGTGGCCAGGTAAGG - Intergenic
1124862195 15:33452979-33453001 AGGAGGCTTCTGGCAAATGTTGG - Intronic
1125750642 15:42025305-42025327 GAGGGGCTTCTGGCCAAGTTAGG + Intronic
1126243392 15:46472782-46472804 AGGAGGATCCTGGCCAAATTTGG - Intergenic
1127909461 15:63404505-63404527 GAGAGCCTTCTGGCCAGGTGTGG + Intergenic
1129878768 15:78993807-78993829 AGAGGCATTCTGGCCAAGGTGGG + Intronic
1130848191 15:87767196-87767218 AGGACTCTTCTGGGCAAGCTGGG - Intergenic
1130873632 15:87993112-87993134 AGGAGCCATATGGCCAAGTCAGG - Intronic
1131229829 15:90651713-90651735 AGGAGCCATCTAGCCAGGTCCGG + Intergenic
1132570765 16:642945-642967 AGGAGCCTTCGGGCCGGCTTGGG - Intronic
1133823894 16:9260261-9260283 AGGGGCCTTCGGGCCAAATCTGG + Intergenic
1136524694 16:30821423-30821445 AGCAGCTTTCTGGTCAAGGTTGG - Intergenic
1138373196 16:56543548-56543570 AGGAGCCTGCTGGCCAGGTGCGG + Intergenic
1139648370 16:68348441-68348463 GGGAGCCTTTTGGCCACGCTGGG + Intronic
1139963995 16:70735335-70735357 CTGATGCTTCTGGCCAAGTTTGG - Intronic
1142350465 16:89577064-89577086 AGTAGCCTACTGGCCCAGCTGGG + Intronic
1143170897 17:4929683-4929705 AGGACCCTGCAGGCCATGTTGGG + Intergenic
1143965957 17:10756655-10756677 AGGAGATATCTGGCCAGGTTTGG - Intergenic
1145367141 17:22273843-22273865 AGGACCCTTCTGTCCAGGTTAGG + Intergenic
1146533920 17:33633470-33633492 AGGCTCCCTGTGGCCAAGTTTGG - Intronic
1146943328 17:36858753-36858775 TGAAGCCAGCTGGCCAAGTTTGG + Intergenic
1147905222 17:43818168-43818190 AGGAACCTTCTGGAAAACTTGGG + Intronic
1148511958 17:48178424-48178446 AGGAAGATTCTGGCCAAGCTGGG + Intronic
1149268471 17:54952869-54952891 AGGGACCTTCTGACTAAGTTTGG - Intronic
1150387359 17:64772837-64772859 AGGACCCTTCTGTCCAACTGAGG - Intergenic
1151979951 17:77502838-77502860 AGGATCATGCTGGCCAAGTGGGG - Intergenic
1203162629 17_GL000205v2_random:64673-64695 AGGAGCCTTCTGCCCGCTTTGGG + Intergenic
1155818340 18:30344441-30344463 GAGGGGCTTCTGGCCAAGTTAGG - Intergenic
1156064505 18:33123742-33123764 ATGAGCCTTGTTGCCAATTTGGG + Intronic
1157798345 18:50597175-50597197 AGAAGCCTTCTGGACCAGATTGG + Intronic
1158863898 18:61619143-61619165 GAGAGGCTTCTGGCCAATTTTGG - Intergenic
1159126017 18:64225773-64225795 GGCAGCCTTCTGTGCAAGTTAGG + Intergenic
1159133673 18:64310384-64310406 ATGAGTCTTCTGTCCAATTTTGG + Intergenic
1160579151 18:79873783-79873805 AGGCGCCTCCTGGCCCAGTGAGG - Intronic
1161938061 19:7384307-7384329 AGGAGACTTTTGGCCATGTCTGG - Intronic
1162732059 19:12724191-12724213 AAGAGCTTTCTGGTCAAATTTGG + Intergenic
1163325682 19:16601674-16601696 AGGAGTCCTCTGGACAAGCTGGG + Intronic
1163725047 19:18918367-18918389 AGGCGCCTTCTGGCGGAGTTGGG - Intronic
1164434057 19:28213178-28213200 AAGAGGCTTCTGGCAAATTTGGG + Intergenic
1164998633 19:32742449-32742471 AGAAGCCTCCTGGCCAGGTGTGG - Intronic
1202647746 1_KI270706v1_random:157542-157564 ACGGGCCTTCTGTCCAAGTTGGG - Intergenic
926247884 2:11133868-11133890 TGGAGCCTGCTGGCCTAGTCTGG + Intronic
926336125 2:11864170-11864192 AGGACCCTTCTGGCCAAGGCAGG + Intergenic
926958770 2:18331799-18331821 AGGAGCTTTATTGCCAAATTAGG - Intronic
927915702 2:26934718-26934740 ATGAGCCTGCTGGCCAAGTAAGG + Exonic
930533029 2:52614042-52614064 AGGTGCCTTCTGGCCAGGGTAGG - Intergenic
932342681 2:70976279-70976301 AGGAGCCTTCTGATAAACTTGGG + Intronic
936989957 2:118352657-118352679 AGAGGCCTTCTGGCTAAGTGGGG + Intergenic
937555321 2:123147290-123147312 AGGAGCCTACTGGACAGGTTTGG + Intergenic
938489465 2:131754269-131754291 ATGGGCCTTCTGTCCGAGTTGGG - Intronic
940587897 2:155678294-155678316 AGTACCATACTGGCCAAGTTAGG + Intergenic
941820490 2:169839952-169839974 AGGAACCTTCTGGCAGAGTTAGG + Intronic
942094480 2:172524380-172524402 AGGGGCACTCTGGCCAAATTTGG + Intergenic
942151291 2:173077862-173077884 AGGGGCCTTCTTGCCAAATAAGG + Intronic
944591348 2:201220634-201220656 AAGGGGCTTCTGGCCGAGTTAGG - Exonic
945326772 2:208491480-208491502 GAGGGGCTTCTGGCCAAGTTAGG + Intronic
945776130 2:214108556-214108578 AAGAGCCTTTTGTCCAATTTGGG + Intronic
947265742 2:228278176-228278198 AGGAGCCTTTTGGCAATGTAGGG - Intergenic
1172021514 20:31917829-31917851 AGGAACCTTCTGGCTGAGTTAGG + Intronic
1172323411 20:34015704-34015726 AGGAGCCTTCAGGCAAAGCCAGG + Intronic
1174399781 20:50269832-50269854 AGGAGCCCTCTGGCTGAGTGTGG - Intergenic
1176604105 21:8815189-8815211 ATGGGCCTTCTGTCCAAGTTGGG + Intergenic
1176618187 21:9039138-9039160 AGGGGCCTTCTGCCTACGTTGGG + Intergenic
1176706057 21:10120564-10120586 ATGGGCCTTCTGTCCGAGTTGGG - Intergenic
1177179818 21:17732977-17732999 AGTAGCCATGTGGCTAAGTTTGG + Intergenic
1179988937 21:44935872-44935894 AGGAGCCTTCTGGCCACTCCTGG + Exonic
1180346389 22:11706767-11706789 ATGGGCCTTCTGTCCAAGTTGGG + Intergenic
1180354161 22:11824920-11824942 ATGGGCCTTCTGTCCAAGTTGGG + Intergenic
1180384084 22:12167406-12167428 ATGGGCCTTCTGTCCAAGTTGGG - Intergenic
1181592196 22:23892386-23892408 GAGGGGCTTCTGGCCAAGTTAGG + Intronic
1182028407 22:27138204-27138226 AGGAGCCATCTGGCCAGGCAGGG + Intergenic
953183698 3:40619361-40619383 AGAATCTTTCTGGCCAAGTGTGG - Intergenic
953244827 3:41181434-41181456 AGGGGCCTTCTGGGGAAGTTTGG - Intergenic
953246219 3:41196171-41196193 AGGAACCCACTGGGCAAGTTCGG - Intronic
953337824 3:42108813-42108835 AGGAGCATTATGGTCAAATTGGG - Intronic
955403227 3:58608657-58608679 AGGAGAATCCAGGCCAAGTTTGG - Intronic
961335140 3:126171482-126171504 AGGAGCCTTCTGGCCAAGTTAGG - Intronic
961632320 3:128310197-128310219 ATGAGCCTTTTGGCAAGGTTAGG + Intronic
961832809 3:129632945-129632967 TGGAGCCTTCTGCCCAAGCCTGG - Intergenic
964212642 3:154245526-154245548 AGGAGCCATCTGGCCATCTGAGG - Intronic
967001801 3:185343066-185343088 AGGAGGCTAGTGGCCATGTTGGG - Intronic
967117190 3:186352632-186352654 AGGAGCCTGGTGGCCACCTTTGG + Intronic
968130467 3:196190125-196190147 CGGAGCTTCCTGGCCAAGCTGGG + Intergenic
968961512 4:3747263-3747285 GGGCGCCTTCTGACCAAATTTGG + Intergenic
971230695 4:24798719-24798741 AGGAGTTTTCCAGCCAAGTTGGG - Intronic
971428884 4:26542774-26542796 AGCATCGTTCTGGCCAAGTTAGG + Intergenic
971886535 4:32456662-32456684 AGGCTCCTTCTGGCCCAGTTAGG - Intergenic
973374010 4:49275731-49275753 ATGGGCCTTCTGTCCAAGTTGGG - Intergenic
973383402 4:49334508-49334530 ATGGGCCTTCTGTCCAAGTTGGG + Intergenic
973387009 4:49519522-49519544 ATGGGCCTTCTGTCCAAGTTGGG + Intergenic
974863509 4:67552161-67552183 AGGGGGCTTCTGGCCAAGTTAGG + Intergenic
975601650 4:76106426-76106448 AGGCGCCTTCTGGCCGAGTTAGG + Intronic
975714683 4:77194079-77194101 AGGAGCCTTCTCAGCAAGTAAGG - Intronic
976274014 4:83257990-83258012 TGCAGCCTTCTGGCCTCGTTGGG - Intergenic
977578198 4:98697057-98697079 AGGAGCCCTTTGGCCAAGAGGGG - Intergenic
978710494 4:111774663-111774685 AAGGGCCTTCTGGAGAAGTTTGG + Intergenic
985892213 5:2724666-2724688 AGGGGCCGTGTGGCCAGGTTGGG + Intergenic
988684358 5:33513352-33513374 AAGAACCTTGTGGCCAAGTAGGG - Intergenic
990614560 5:57494366-57494388 AGGAGACTTCTTGTTAAGTTTGG + Intergenic
991269326 5:64760697-64760719 AGGTGCCTTCTGGCCAAGTTAGG - Intronic
992440864 5:76796581-76796603 AGGAGGCTTCTGGGCAAGGCAGG + Intergenic
992952038 5:81868509-81868531 AGGTGCCTTCAGGCCACTTTAGG + Intergenic
993934395 5:93983406-93983428 AGGATCCTTCTGGCTAAATCTGG + Intronic
994379142 5:99049795-99049817 AGGCTCCTTCTGGCCAAATTTGG - Intergenic
997469213 5:134107453-134107475 AGGAGCCGGCTGGCCATGTAGGG - Intergenic
1002330279 5:178436166-178436188 AGGACCCTCCTGGAAAAGTTGGG + Intronic
1002682314 5:180976433-180976455 GAGGGGCTTCTGGCCAAGTTAGG + Intergenic
1005991111 6:30902784-30902806 AAAATCCTTCTGGCCAAGGTTGG + Intergenic
1006244152 6:32715602-32715624 AGGCGCCTTCTGGCCGAGTTAGG + Intergenic
1007943247 6:45801815-45801837 AGAAAGCTTCTGGCCAAATTTGG + Intergenic
1015304219 6:131688759-131688781 AGAAGTCTTCTGGCCAGGTGCGG + Intronic
1017371405 6:153713311-153713333 AGTAACCTTCTGGCCAGGTGCGG - Intergenic
1017887603 6:158611796-158611818 GAGGGCCTTCTGGCCGAGTTAGG + Intronic
1017888561 6:158620908-158620930 GAGGGCCTTCTGGCCAAGTTAGG + Intronic
1019374524 7:682296-682318 AAGAGACTTCAGGCCAAGTGCGG + Intronic
1019787017 7:2983532-2983554 AGAAGCCTCCTGGCCAGGTGCGG - Intronic
1019973873 7:4564150-4564172 AGGAGCTCTCTGGCCCAGTGGGG - Intergenic
1021026771 7:15677600-15677622 AGAAGCCTTCTGGAAAAGTTGGG - Intronic
1021661390 7:22921810-22921832 AGAAACCTTCAAGCCAAGTTTGG + Intergenic
1024496802 7:50057435-50057457 AGACGCCTTCTGGCCGAGTTAGG - Intronic
1025935165 7:66029981-66030003 AGGAGCCTCCTTGTCCAGTTTGG - Intergenic
1025949147 7:66129708-66129730 AGGAGCCTCCTTGTCCAGTTTGG + Intronic
1026556797 7:71415553-71415575 ACAAGGATTCTGGCCAAGTTTGG + Intronic
1026642174 7:72137034-72137056 GAGGGGCTTCTGGCCAAGTTAGG + Intronic
1031874119 7:127119019-127119041 GGGGGCCTCCTGGCCCAGTTGGG + Intronic
1033423588 7:141223703-141223725 AGGAGCCTTCTGGGGAAGGTTGG + Intronic
1035945770 8:3960027-3960049 AGGAGCCTTCTGGGCATCTCAGG + Intronic
1038361888 8:26887729-26887751 AGGAGCATTCTGGCTGAGTTTGG - Intergenic
1038534265 8:28342794-28342816 AGGACCCCTCTGGCTACGTTAGG + Intronic
1038550754 8:28466499-28466521 AGGAGACTTCTGGCCAGGCGCGG + Intronic
1040277321 8:46020696-46020718 AGGAGCCTTCTTGCAGATTTGGG + Intergenic
1040278407 8:46025473-46025495 AGGGGCCTTCTTGCCACTTTGGG + Intergenic
1040278817 8:46027217-46027239 GGGAGCCTTCTTGCCACTTTGGG + Intergenic
1041136847 8:54768105-54768127 AGGAGGCTGCTGGACAAGATGGG - Intergenic
1041735523 8:61106794-61106816 AAGAGCCTCCAGGCAAAGTTGGG - Intronic
1045060873 8:98409823-98409845 AGATGCCTTCTGGCCAGGCTGGG + Intronic
1045321302 8:101083667-101083689 AGAAGCCTTCTGGCCAGGTGAGG - Intergenic
1047403176 8:124562884-124562906 AGGAGCCTGCTGGGCCAGGTTGG + Exonic
1047747937 8:127859096-127859118 ACGAGCCTTCAGGCCAGGTGTGG - Intergenic
1048728967 8:137416495-137416517 AAGAGCCTTCTGGCTGAGTTAGG + Intergenic
1051483871 9:17587585-17587607 AGTAGGCTTCTGGCCAAGTGCGG + Intronic
1053048658 9:34940361-34940383 AGGAGCATTCTAGCCAAGTTAGG - Intergenic
1053643330 9:40107681-40107703 ATGGGCCTTCTGTCCGAGTTGGG - Intergenic
1053762822 9:41357809-41357831 ATGGGCCTTCTGTCCGAGTTGGG + Intergenic
1054350399 9:64014297-64014319 AGGGGCCTTCTGCCTACGTTGGG + Intergenic
1054541425 9:66268922-66268944 ATGGGCCTTCTGTCCGAGTTGGG + Intergenic
1056128011 9:83555387-83555409 AGCAGCAGTCTGGCCAAATTTGG + Intergenic
1056745265 9:89296124-89296146 GAGAGACTTCTGACCAAGTTAGG - Intergenic
1060309587 9:122447323-122447345 GAGGGGCTTCTGGCCAAGTTAGG - Intergenic
1060848798 9:126858402-126858424 AGGAGTTTTCTGGCCAGGTGGGG - Intergenic
1061600190 9:131664102-131664124 AGGTTCCCTCTGGCCAAGTTTGG - Intronic
1062018609 9:134304974-134304996 AGGAGCCTCCTGGAGAGGTTCGG + Intergenic
1202791090 9_KI270719v1_random:90652-90674 ATGGGCCTTCTGTCCGAGTTGGG - Intergenic
1203697689 Un_GL000214v1:113643-113665 ATGGGCCTTCTGTCCAAGTTGGG - Intergenic
1186628142 X:11317357-11317379 AGGAGACATCTGGCAAAGTCGGG - Intronic
1189906099 X:45761110-45761132 AGGAGGCCTCAGGACAAGTTAGG - Intergenic
1190395849 X:49982200-49982222 AGGAGCCTTCTGCCCCTGATGGG + Intronic
1192261532 X:69508672-69508694 AGGAGCCTACAGTCCAAGTAGGG - Intronic
1193356153 X:80522268-80522290 AGCACCCTTCTGGCCAATCTTGG + Intergenic
1195095285 X:101495894-101495916 AGGAGGCATCTGGCCATGATTGG - Intronic
1196709895 X:118751991-118752013 AGGATCCTCCTGGCAAAGTTGGG + Intronic
1198404580 X:136299978-136300000 AGGAGCCTTTTGGCTGAGTTAGG + Intergenic
1200297289 X:154933361-154933383 ATAAGCTATCTGGCCAAGTTGGG + Intronic
1200788556 Y:7279866-7279888 AGGAAAATTCTGGCCAATTTAGG - Intergenic
1201151576 Y:11097975-11097997 AGGGGCCTTCTGCCTACGTTGGG + Intergenic
1201525339 Y:14926934-14926956 AGGAGCCTTCTCGCCAAGTTAGG - Intergenic
1202106242 Y:21369891-21369913 GGGCACCTTCTGGCTAAGTTAGG - Intergenic