ID: 961340303

View in Genome Browser
Species Human (GRCh38)
Location 3:126213041-126213063
Sequence GGGCGCCCCCAGGAAGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961340295_961340303 2 Left 961340295 3:126213016-126213038 CCGCCGGCTCTGCTTCTCACGGC No data
Right 961340303 3:126213041-126213063 GGGCGCCCCCAGGAAGGGACAGG No data
961340291_961340303 7 Left 961340291 3:126213011-126213033 CCCCACCGCCGGCTCTGCTTCTC No data
Right 961340303 3:126213041-126213063 GGGCGCCCCCAGGAAGGGACAGG No data
961340296_961340303 -1 Left 961340296 3:126213019-126213041 CCGGCTCTGCTTCTCACGGCAGG No data
Right 961340303 3:126213041-126213063 GGGCGCCCCCAGGAAGGGACAGG No data
961340293_961340303 5 Left 961340293 3:126213013-126213035 CCACCGCCGGCTCTGCTTCTCAC No data
Right 961340303 3:126213041-126213063 GGGCGCCCCCAGGAAGGGACAGG No data
961340289_961340303 24 Left 961340289 3:126212994-126213016 CCTTGGGAGGGGCTGGGCCCCAC No data
Right 961340303 3:126213041-126213063 GGGCGCCCCCAGGAAGGGACAGG No data
961340288_961340303 25 Left 961340288 3:126212993-126213015 CCCTTGGGAGGGGCTGGGCCCCA No data
Right 961340303 3:126213041-126213063 GGGCGCCCCCAGGAAGGGACAGG No data
961340292_961340303 6 Left 961340292 3:126213012-126213034 CCCACCGCCGGCTCTGCTTCTCA No data
Right 961340303 3:126213041-126213063 GGGCGCCCCCAGGAAGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961340303 Original CRISPR GGGCGCCCCCAGGAAGGGAC AGG Intergenic
No off target data available for this crispr